ID: 960622399

View in Genome Browser
Species Human (GRCh38)
Location 3:119649336-119649358
Sequence ATGAATAAACAAATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1389
Summary {0: 1, 1: 2, 2: 15, 3: 150, 4: 1221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960622399 Original CRISPR ATGAATAAACAAATGGAGAA TGG (reversed) Intronic
900857004 1:5194324-5194346 ATGAACAAACAAATAGATAAAGG + Intergenic
901789586 1:11647313-11647335 ATGAATAAACAATTGCAGGCAGG + Intergenic
901881539 1:12196931-12196953 AAGAAAAAAAAAATGGAAAAGGG - Intronic
902125916 1:14211201-14211223 ATAAATAAACAAATAGAGATAGG - Intergenic
902237484 1:15066894-15066916 ATAAATAAATATATAGAGAAAGG - Intronic
902370764 1:16005557-16005579 ATGAATAAACAAATGAATTCAGG + Intronic
902648568 1:17821519-17821541 AAAAATAATTAAATGGAGAAAGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902830034 1:19006575-19006597 ATGAATGAACAAATAAAGATAGG + Intergenic
902922000 1:19671787-19671809 ATAAATAGACATATGGAGAGGGG - Intronic
903073404 1:20741414-20741436 ATGAAAAAACAAATGTCAAAAGG + Intergenic
903205152 1:21776434-21776456 AGAAATAAACAAAAGGAGAAAGG + Intronic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903273329 1:22205726-22205748 ATGAATGAACAAAAGGTGGAAGG - Intergenic
903396290 1:23004091-23004113 ATGAGTCAACAAAGGGAGATAGG + Intergenic
903949724 1:26989207-26989229 ATAAATGAATGAATGGAGAAGGG + Intergenic
903960520 1:27054343-27054365 ATGAATAACCAAATAGGGGAAGG + Intergenic
904073756 1:27824055-27824077 ATTAAAAAAAAAATGGAGATGGG - Exonic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904362950 1:29990343-29990365 ATGAATAAACAATAGGAAAGTGG - Intergenic
905067776 1:35197964-35197986 ATGAATAAATAAAAGCATAATGG + Intergenic
905067975 1:35199831-35199853 ATGAATAAATAAAAGCATAATGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905155064 1:35970716-35970738 ATAAATAAACAAAGGGAGGGAGG - Intronic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905510064 1:38512144-38512166 GTAAACAAACAAATGGATAACGG + Intergenic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906118755 1:43373431-43373453 ATGAGGAAAAAAATGGAAAAAGG + Intergenic
906174751 1:43761541-43761563 AGGAAAAAACAAAGGAAGAAAGG + Intronic
906541514 1:46590156-46590178 ATTCCAAAACAAATGGAGAACGG + Intronic
906754826 1:48301165-48301187 ATGAATAAACACATTTAGTAAGG + Intronic
907114002 1:51952669-51952691 ATGAATAAAGGAATGAACAAAGG + Intronic
907433202 1:54426559-54426581 ATGTATAAATAAATAGAGACAGG + Intergenic
907589719 1:55654658-55654680 ATAAATAAATAAATGGAAAAGGG + Intergenic
907630180 1:56073190-56073212 ATAAATAAACAAATATAGACAGG + Intergenic
907784297 1:57596665-57596687 AGGAAGAAAAAAATGAAGAAAGG + Intronic
908020738 1:59895886-59895908 GTGAATAAATAAATGGGGAGGGG - Intronic
908228393 1:62079405-62079427 ATGAATATCAAAAAGGAGAAAGG - Intronic
908446953 1:64207966-64207988 AGCAATTAAAAAATGGAGAAAGG + Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908770048 1:67587663-67587685 AAGAAAAAAAAAATTGAGAATGG - Intergenic
908819730 1:68072850-68072872 AGGAAAAAAGAAATGAAGAAAGG - Intergenic
908897083 1:68912535-68912557 AAAAATAAAGAAATTGAGAAAGG - Intergenic
909382909 1:75021132-75021154 ATGAAAAAATACATGGAAAATGG - Intergenic
909395532 1:75167469-75167491 AGGAAAAGAGAAATGGAGAAAGG - Intergenic
909903409 1:81166667-81166689 TTCACTTAACAAATGGAGAAAGG - Intergenic
909923841 1:81414941-81414963 ATGAATAACCAGATGGGAAACGG - Intronic
910010369 1:82453702-82453724 CTGAATCAACAAGTGAAGAAAGG + Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910977245 1:92919722-92919744 AAGAATAAAGAAATGGAGGGAGG + Intronic
911328777 1:96501197-96501219 ATAAATAAATAAATGAAGAAAGG - Intergenic
911393062 1:97270215-97270237 ATTCATAAACAACCGGAGAATGG + Intronic
911586016 1:99691921-99691943 AAGAAGAAAGAAATGGAAAAAGG + Intronic
911627331 1:100139517-100139539 ATGAAGAAATGAATGGAGGAAGG + Intronic
911724651 1:101230293-101230315 GTGAATAAAAAAATGGAAAGTGG + Intergenic
911929182 1:103879405-103879427 ATAAATAACCAAAAGTAGAAAGG - Intergenic
911952265 1:104189655-104189677 ATAAATAAATAAATGAATAAAGG - Intergenic
911981355 1:104571002-104571024 ATAGAAAAACAAAAGGAGAAAGG + Intergenic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912340097 1:108906219-108906241 ATAAATAAATAAAAGTAGAAAGG - Intronic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
912837615 1:113010120-113010142 ATAAATAAACAAATATGGAAAGG + Intergenic
912902250 1:113664129-113664151 GTAAAAAGACAAATGGAGAATGG - Intronic
913533737 1:119751701-119751723 ATGAAAATAAAAATGGAGCAGGG - Intronic
913584862 1:120264755-120264777 ATTAACAAACAAATGAATAAGGG - Intergenic
913670255 1:121091388-121091410 ATGAATAAAATAATGTATAATGG - Intronic
913714831 1:121523161-121523183 ATGAATAAATAAATAAATAAAGG - Intergenic
914399462 1:147304182-147304204 AAGAATAAAAAAGTGGACAAAGG + Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
914566861 1:148876611-148876633 ATTAACAAACAAATGAATAAGGG - Intronic
914605959 1:149253630-149253652 ATTAACAAACAAATGAATAAGGG + Intergenic
914660504 1:149786758-149786780 ATGAATAAAATAATGTATAATGG - Intronic
914686970 1:149988989-149989011 ATGACTAAAGAAATCAAGAAAGG - Intronic
914746036 1:150501827-150501849 ATAAATAAAAAGATAGAGAAAGG + Intronic
914767724 1:150654140-150654162 ATCAATAAAGAGATAGAGAAAGG + Intronic
915153166 1:153851601-153851623 ATTAAAAAAAAAATGGACAAAGG - Intronic
915538334 1:156551328-156551350 ATGAATTGACAAATGGGGCAGGG - Intronic
915560696 1:156685679-156685701 ATGAATAAATTAATGAATAAAGG + Intergenic
916082891 1:161247072-161247094 GAATATAAACAAATGGAGAATGG - Intergenic
916294994 1:163208616-163208638 AAAAATAAAGAAATGGACAAGGG + Intronic
916861707 1:168812911-168812933 ATGGATAAACAAATGTATAGTGG + Intergenic
917000636 1:170354407-170354429 ATGACTATACAAATCCAGAAGGG + Intergenic
917008004 1:170437006-170437028 ATGAAGAAAGATAGGGAGAAAGG + Intergenic
917163480 1:172084141-172084163 ATCAGTAAACAGATAGAGAAAGG - Intronic
917289559 1:173458544-173458566 ATCAACAAACAAGTAGAGAAAGG + Intergenic
917428457 1:174940237-174940259 ACAAACAAACAAAAGGAGAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917811176 1:178659709-178659731 ATGAAAGAACAAATGAGGAACGG + Intergenic
917844925 1:179012744-179012766 AAGAAGAAACAAAGGAAGAAAGG + Intergenic
918070567 1:181131008-181131030 ATAAATGAATAAATGGAGAATGG - Intergenic
918121119 1:181541443-181541465 ATGAAAAAAAAAAGGGGGAAGGG + Intronic
918329158 1:183440380-183440402 ATGAATAAACAAATAAATTAGGG + Intergenic
918344810 1:183597821-183597843 ATGAATGAACAAGTGAAGAGTGG + Intronic
918637240 1:186792431-186792453 ATGAATGAACAAATATATAATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918673302 1:187248542-187248564 ATCAACAAACGAATGGATAAAGG + Intergenic
918941431 1:191003661-191003683 AAAAATAATCACATGGAGAATGG + Intergenic
918996986 1:191774163-191774185 ACTAATAAACAATTGAAGAAAGG + Intergenic
918997261 1:191778200-191778222 ACTAATAAACAAATTCAGAAAGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919272413 1:195364981-195365003 ATGAAAAAAGAAAGAGAGAAAGG + Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919351607 1:196462834-196462856 AAGAAAAAACAACTGGAGACTGG - Intronic
919468792 1:197953438-197953460 ATGAATAAATACATGAAAAAGGG + Intergenic
919530548 1:198713770-198713792 ATGGATAAAAGAATAGAGAAAGG - Intronic
920220651 1:204397508-204397530 ATAAATAAATAAATAGAAAAAGG + Intergenic
920421462 1:205837226-205837248 ATGAATAAATGAAGGAAGAAAGG + Intronic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920607209 1:207400734-207400756 ATGAATTAAAAGATGGGGAATGG - Intergenic
920612173 1:207452397-207452419 ATGAATAAATAAATAGAGAAGGG + Intergenic
920803622 1:209211824-209211846 AGGAAGAAACAAATGAAGTATGG - Intergenic
920861883 1:209715698-209715720 ATGAATAAATAAATCAAGAGAGG + Intronic
921414934 1:214874743-214874765 ATCTAGAAACAAATGAAGAATGG - Intergenic
921415208 1:214878317-214878339 AAGAATAAAGGAATGTAGAATGG - Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
921555328 1:216591856-216591878 ATGAATAAGCTGATGGGGAATGG + Intronic
921757202 1:218872460-218872482 ATCAATAAACAAATGGAATGAGG + Intergenic
921768804 1:219008329-219008351 ATGAATAAGTGAATGGATAATGG + Intergenic
921940135 1:220830567-220830589 AGAAATAAAGAAATAGAGAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922636273 1:227175447-227175469 ATAAATAAATAACTGGATAATGG + Intronic
922742279 1:228020705-228020727 ATGAATAAAGAAGTGAACAAGGG + Intronic
922995033 1:229950141-229950163 ATAAATACACAAATTGAGATGGG - Intergenic
924142216 1:241037422-241037444 ATCAATCAACAAATGGAGGCCGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
924604070 1:245517062-245517084 ATGAATATAAAAATGGGGATGGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063247880 10:4242081-4242103 ATAAATAAATAAATGCACAAAGG - Intergenic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063597258 10:7447194-7447216 AATAAAAAACAAATGGACAAAGG - Intergenic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1064283651 10:13972903-13972925 ATAAATAAACAAATGGAATGTGG - Intronic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1064724908 10:18269368-18269390 AGGAAGAAAAAAATGGAGACAGG - Intronic
1064753906 10:18557893-18557915 ATGAAGAATGGAATGGAGAATGG + Intronic
1064753937 10:18558150-18558172 ATGAAGAATGGAATGGAGAATGG + Intronic
1064754139 10:18559466-18559488 ATGGAGAATCGAATGGAGAATGG + Intronic
1064754264 10:18560307-18560329 ATGGATAATGGAATGGAGAATGG + Intronic
1064755367 10:18568151-18568173 ATGGATAATGGAATGGAGAATGG - Intronic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1064755689 10:18570298-18570320 ATGAAGAATGGAATGGAGAATGG - Intronic
1064770043 10:18713528-18713550 ATTAATATAAAAATGGAGAGTGG + Intergenic
1064796850 10:19021805-19021827 ATAAATAAATAAATGTGGAATGG - Intergenic
1065267130 10:23988441-23988463 ATGATTAAAGAAATGTTGAAAGG - Intronic
1065677415 10:28192910-28192932 AAGTATAAACAAATAGATAATGG + Intronic
1066230820 10:33431270-33431292 ATGAATAAAAGAATGTACAAGGG + Intergenic
1066562570 10:36686193-36686215 ATGATGAAACACATGGAAAAGGG - Intergenic
1066618043 10:37315849-37315871 ATGAATAGAAAAACAGAGAAAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067760815 10:49045340-49045362 AACAATAAACAAATGAAAAAAGG + Intronic
1067869811 10:49947618-49947640 ATAAATAAATAAATAAAGAATGG + Intronic
1067914452 10:50381437-50381459 TGGAGTAAATAAATGGAGAAAGG + Intronic
1068129643 10:52881630-52881652 ATGAATGAACAAATGGGTACAGG + Intergenic
1068487969 10:57683712-57683734 ATGAATAAATAAATGTATGAGGG + Intergenic
1068775327 10:60862639-60862661 AAGAAAAAAGAAAGGGAGAAAGG - Intergenic
1069115015 10:64494214-64494236 ATGCGTAAATAAATGGATAAAGG - Intergenic
1069119239 10:64548160-64548182 ATGAAAATACCAAGGGAGAAGGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069159431 10:65074474-65074496 ATAAATAAAAAAAAAGAGAAGGG - Intergenic
1069272633 10:66548970-66548992 AAAAAAAAAAAAATGGAGAAAGG - Intronic
1069281507 10:66660217-66660239 TTGACTAAAAGAATGGAGAAAGG + Intronic
1069586423 10:69606937-69606959 AAAACTCAACAAATGGAGAAGGG + Intergenic
1070298588 10:75186253-75186275 AAGACTAAACACCTGGAGAAGGG - Intergenic
1070448466 10:76532394-76532416 ATGAATAAATAAATGTATAAAGG - Intronic
1071421744 10:85507144-85507166 ATGAATAAATAAATGAATTATGG - Intergenic
1071473272 10:86002794-86002816 ATAAACAAACCAATGGAGGAAGG - Intronic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071773657 10:88759688-88759710 ATGAAGGATCAAATGGGGAAGGG + Intergenic
1071837371 10:89431929-89431951 AAGAATTAACACAGGGAGAAAGG + Exonic
1071945155 10:90635480-90635502 ATGAATCAATAAATGCAAAAAGG + Intergenic
1072123588 10:92425961-92425983 ATATATAAATAAATGGAGAATGG - Intergenic
1072230822 10:93412743-93412765 ATGAGTAAACAAATGGGAAGGGG + Intronic
1072232962 10:93428621-93428643 ATGAACAGAAAAATGGAAAAAGG - Intronic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072366048 10:94711029-94711051 ATTAATAATAAAATGGAGAGTGG - Intronic
1073648059 10:105327331-105327353 GTGAATTAACAAATGCAAAAAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074608187 10:114995017-114995039 ATAAATAAATAAATGTACAAAGG - Intergenic
1074937444 10:118196319-118196341 ATGAATAAGCACATGAAAAAAGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075540421 10:123308301-123308323 ATGATTAAACATATAAAGAATGG - Intergenic
1075628261 10:123980884-123980906 ATGATTAAACACATAAAGAAGGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076254765 10:129013359-129013381 ACAAATAAATAAATTGAGAATGG + Intergenic
1076766393 10:132636643-132636665 ATAAATAACCAAATGGACATGGG - Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077346814 11:2063332-2063354 TTGAAGAAAAAAATGGAGTATGG - Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077828559 11:5837606-5837628 ATAAATAAATAAAAGGGGAATGG - Intronic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078635896 11:13049794-13049816 ATGAATAAATAAGTGGAGAAGGG - Intergenic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079616329 11:22497893-22497915 ATGAATAAATAAATGGCTAGGGG + Intergenic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1080186974 11:29501645-29501667 ATGCATAAACAAGTGTTGAATGG + Intergenic
1080449192 11:32364638-32364660 AGGATTAAACAAATGAAGTATGG + Intergenic
1080680390 11:34470268-34470290 AGGAATAGACAAATGGAAGAGGG + Intronic
1080716240 11:34803482-34803504 AACAAAAAAAAAATGGAGAAAGG - Intergenic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081405984 11:42698305-42698327 ATGAAAAAAGAAATGAAGGAAGG + Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082023839 11:47556873-47556895 ATAAATAACCAAATAGAGACAGG - Intronic
1082276993 11:50232861-50232883 ATGAATAAATAAACTGTGAATGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1082916318 11:58441946-58441968 CTGATTAAACCAAAGGAGAAAGG + Intergenic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1084608519 11:70186393-70186415 AGGAAGAAAGACATGGAGAAAGG + Intronic
1084705318 11:70812990-70813012 GTGAATGAATGAATGGAGAAAGG - Intronic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085370218 11:75996358-75996380 ATGAATAAATGAATTGACAAAGG - Intronic
1085429689 11:76437333-76437355 ATGAACCCAGAAATGGAGAAAGG - Intergenic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1085606888 11:77908890-77908912 AGTAATAAAGAAGTGGAGAATGG - Intronic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085789057 11:79480260-79480282 ATGAATGAATAAATGGGGGAAGG + Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085874969 11:80395239-80395261 AAAAAAAAAAAAATGGAGAAAGG + Intergenic
1085879808 11:80453099-80453121 ATAAATAAACAAATAAATAATGG - Intergenic
1085912331 11:80842445-80842467 CTCAATAAACAAATGTTGAATGG + Intergenic
1085983545 11:81755527-81755549 ATGAAAAAACAAAACAAGAAAGG - Intergenic
1086099180 11:83081508-83081530 ATAAATAAATAAATAGAAAATGG - Intergenic
1086221582 11:84451589-84451611 ATAAATAAATAAGTGGAGGAGGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086534269 11:87825244-87825266 ATGAAGGAACAAATTAAGAAAGG + Intergenic
1086573944 11:88316491-88316513 ATAAATAAATAAATGAAGCAGGG + Intronic
1087007897 11:93486957-93486979 ATGAATAAACAACACGAGAAGGG + Intronic
1087465254 11:98495732-98495754 ATGCACAAACAAATCGAGGAAGG + Intergenic
1087879305 11:103396098-103396120 AGTAATCAACAAATGGACAAAGG - Intronic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1088333713 11:108679838-108679860 CTTAATAAACGAAGGGAGAAGGG + Intronic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1091081704 11:132675571-132675593 ATGAATAAAGAAATTTAGCAAGG + Intronic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1091247971 11:134115904-134115926 ATAAATAAAAAATTGGAGGAGGG + Intronic
1091329356 11:134718963-134718985 AACAACAAACAAATGGAGACAGG - Intergenic
1091537388 12:1424646-1424668 ATGAAGAAACAAGAGGAAAAGGG - Intronic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1091695724 12:2626907-2626929 ATGAGTAAATAAATGGACGAAGG + Intronic
1091729981 12:2873539-2873561 AAAAATAAATAAATGAAGAAGGG - Intronic
1092439734 12:8489301-8489323 TTGATTTAAAAAATGGAGAAAGG + Intergenic
1092491671 12:8950952-8950974 ATAAACAAAGAAATGCAGAATGG - Intronic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1092631970 12:10390506-10390528 ATAGATAGACAAATTGAGAAGGG + Intronic
1093112852 12:15172809-15172831 ATGAATAACCAAATTAAAAATGG - Intronic
1093126359 12:15333507-15333529 TTGAATAAATAAATGGAGTGAGG + Intronic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1093343424 12:18008038-18008060 ATAAATAAATAAATGCAAAAAGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093727216 12:22528392-22528414 ATGACTAAATAAAAGGAGAGAGG - Intronic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1094195758 12:27748310-27748332 ATGAATAAGTAAATGAATAATGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095520128 12:43053568-43053590 ATGAACAAATAAATGCAGATGGG + Intergenic
1095563921 12:43598314-43598336 AAGAAGAAAATAATGGAGAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1097012394 12:55962482-55962504 ATAAATAAACAAATAAATAAGGG - Intronic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1097185925 12:57196329-57196351 ATGAATAAGGCAGTGGAGAAAGG - Intronic
1097360096 12:58649990-58650012 GTGAATAAGCAAATGGAGTGGGG + Intronic
1097409331 12:59231169-59231191 AGGAAAAGATAAATGGAGAAAGG - Intergenic
1097601594 12:61699490-61699512 ATGCCTAAACAAATAGGGAAGGG + Intergenic
1097626620 12:62010044-62010066 ATGTAAAAGCTAATGGAGAATGG - Intronic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1097670640 12:62533390-62533412 AAAAATAAAAAAATGCAGAAGGG - Intronic
1097827051 12:64184958-64184980 ATGAAAAAACCCATGGAAAATGG - Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1098919500 12:76290844-76290866 ATGAATAAAAATATGGAGGTGGG + Intergenic
1099363395 12:81736406-81736428 ATGAATAAACCAATTCAGCAAGG - Intronic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1100011977 12:89964609-89964631 ATAAATAAATAAATGAAAAAAGG - Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100129579 12:91474854-91474876 GTGGATAAAAAAGTGGAGAAAGG - Intergenic
1100342700 12:93695906-93695928 ATAAATAAATAAATGGGCAAAGG + Intronic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100706003 12:97200807-97200829 ATGAATATTCAACTGTAGAATGG - Intergenic
1100841539 12:98617728-98617750 ATTAAGAAACAAATGTAAAATGG + Intronic
1100875227 12:98954935-98954957 AGGAATAAAGAAATGGAGGGTGG - Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101694994 12:107116674-107116696 ATGAGAAACCACATGGAGAAAGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102449240 12:113028507-113028529 ATGAACAAACACAGTGAGAAGGG + Intergenic
1102683817 12:114708762-114708784 ATGAAGAAAGAAAGGAAGAAAGG - Intergenic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1102828777 12:115975317-115975339 ACAAATAAAGAAATGGGGAAGGG + Intronic
1102999192 12:117372299-117372321 ATAAATAAAGAAATGGACATTGG - Intronic
1103371453 12:120422659-120422681 ATGAATAAATGAATGAATAAAGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104114874 12:125739675-125739697 AAGAATCTACAAATGTAGAATGG + Intergenic
1104177238 12:126344714-126344736 ATGAATAAATAAAGGAAGAAAGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104436247 12:128758986-128759008 ATGAATAAACAAAACGTGACAGG - Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105279768 13:18956596-18956618 ATGAATGAACAAATGGTGAGTGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106100604 13:26692606-26692628 ATGAACATAAAAATGGAGACTGG - Intergenic
1106170161 13:27281849-27281871 ATGAATAATCATATGCAGTATGG + Intergenic
1106631798 13:31481825-31481847 AAGAAAAAAGAAATGAAGAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107325957 13:39243035-39243057 ATGAATAAGTAAATGGTGATTGG + Intergenic
1107350952 13:39514246-39514268 ATGAATTAACAAGCAGAGAAGGG + Intronic
1107438172 13:40400484-40400506 ATGAATGAATGAATGAAGAATGG + Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108297721 13:49041476-49041498 ATGAATAAACAACTGAAGAGTGG - Intronic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108978852 13:56484070-56484092 ATGTATAAAGAATTGGAGAGAGG - Intergenic
1109082864 13:57929349-57929371 ATGAATAATAAAATGTAGAAAGG - Intergenic
1109281076 13:60356416-60356438 ATAAATAAATAAATAGAGAGAGG + Intergenic
1109371911 13:61433137-61433159 ATGAAGAAAAAAATGAAGGAAGG - Intergenic
1109382682 13:61585041-61585063 ATGAATGAACGAATGAAGGAAGG + Intergenic
1109450994 13:62513863-62513885 ATGAATAAATAAATTGGGACAGG - Intergenic
1109512300 13:63394139-63394161 ATAAATAAATTAATAGAGAAGGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109691423 13:65895816-65895838 ATGTATAAGTAAATGGAAAAAGG - Intergenic
1109730345 13:66404929-66404951 AGGAATAAAAAAATGGAAAGAGG - Intronic
1110154229 13:72294406-72294428 ATGAACAAAAAAATGGGGCAGGG + Intergenic
1110446391 13:75587232-75587254 ATTTATTAAAAAATGGAGAAGGG + Intronic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110576474 13:77062125-77062147 ATTAATAAGAAAATGGTGAAAGG + Intronic
1110581727 13:77137288-77137310 GTCAATAAACAAAAGTAGAAAGG - Intronic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1111304570 13:86390481-86390503 ATAAATAAAAATAAGGAGAAAGG + Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111565585 13:90010624-90010646 TTGAATAAACAAACGGAATAGGG + Intergenic
1111850094 13:93562159-93562181 ATGCATAATAAAATGAAGAAAGG + Intronic
1112266571 13:97929533-97929555 AAGAAAAAAAAAATGGGGAAAGG - Intergenic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1112737434 13:102436648-102436670 AAGAAGAAACAAATGCAGATAGG + Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113293500 13:108931904-108931926 AGGAAGAAAAAAATGAAGAAGGG - Intronic
1113315063 13:109170553-109170575 AGGAAGAAAGAGATGGAGAAAGG + Intronic
1113315620 13:109176467-109176489 ATGAATAAAAAAAAAGAAAACGG - Intronic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113408683 13:110064825-110064847 ATGAATAAATAAAAGTAAAAGGG - Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1114196535 14:20482078-20482100 ATGAACAAACAAACTCAGAATGG - Intergenic
1114544400 14:23487752-23487774 AGGTATAAAGAGATGGAGAAGGG + Intronic
1114644091 14:24244083-24244105 AGGAATAAATAAAGGGAAAAAGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1114943326 14:27644469-27644491 ATGCATGAGGAAATGGAGAAAGG + Intergenic
1114971232 14:28031428-28031450 ATTAATTAACTAATGGAGGAAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115185105 14:30678488-30678510 ATGAAAAAACAACTAAAGAAAGG - Intronic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115694953 14:35886960-35886982 GTGATTAAGCCAATGGAGAATGG + Intronic
1115752669 14:36506989-36507011 TGGAATAAAGAAATGGAAAATGG + Intronic
1116143942 14:41038974-41038996 ATTAATAAATTAATGGAGTAGGG - Intergenic
1116350875 14:43861036-43861058 AAGAAGAAACATTTGGAGAAGGG + Intergenic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1116539274 14:46078695-46078717 ATAAATAAATAAATAGAGGAAGG - Intergenic
1116711598 14:48374682-48374704 ATGATTAAAGACAAGGAGAAAGG + Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1118395258 14:65330754-65330776 ATGAAAATTCAAAGGGAGAATGG + Intergenic
1119105696 14:71921486-71921508 ATGAATAAAGAAATATACAATGG + Intergenic
1119120827 14:72075318-72075340 ATGAATAAATAAATGAATATAGG - Intronic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1119206306 14:72796513-72796535 ATAAATAAATAAATGGAGACAGG + Intronic
1119210505 14:72828165-72828187 AGTAGAAAACAAATGGAGAAAGG - Intronic
1119313042 14:73666953-73666975 ATGAAAAAAAAAAAAGAGAAGGG - Intronic
1119422780 14:74517347-74517369 ATAAATAAATAAAGGAAGAAAGG - Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120800877 14:88686819-88686841 ATCAACAAACAAATGGCAAAGGG + Intronic
1121087957 14:91160984-91161006 ATTAATAAACTAAAGGAAAATGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121184689 14:91956392-91956414 AAGAATAAAAAAAGGGAGAGAGG + Intergenic
1121393941 14:93601486-93601508 ATTAATCAACAAGTGGATAAAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122335108 14:100969834-100969856 ATAAATAAACAAATTTAGATGGG + Intergenic
1123103736 14:105825693-105825715 ATCAATCAACAAGTGGATAAAGG - Intergenic
1123221434 14:106860490-106860512 ATGAATAAGCAAAAAGATAAGGG - Intergenic
1123755573 15:23395283-23395305 AGGAATGAGCAAATGGAAAAGGG - Intergenic
1123828907 15:24113341-24113363 ATGTATAAACAAACAGAAAAGGG - Intergenic
1123976835 15:25561609-25561631 AGGAAGGAACAAAAGGAGAAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124711146 15:32013255-32013277 ATGAAGAGACAAGTGGATAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1124855268 15:33381532-33381554 ATGAAAAAACACCTGGAGGAAGG - Intronic
1125262623 15:37844932-37844954 ATGGATAAACAAATTGTGTATGG + Intergenic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126118433 15:45229772-45229794 ATAAATAAACAAATAGAGACAGG - Intergenic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1126645192 15:50868688-50868710 ATGAAAAGAGAAAAGGAGAATGG - Intergenic
1126669410 15:51102625-51102647 ATGAAGAAATAAATCTAGAAAGG + Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1127631579 15:60832657-60832679 ATGAAAAAAAAAATGGAGGTGGG + Intronic
1127839277 15:62816720-62816742 ATGAATAAGCAAAGGGTTAAAGG - Intronic
1127871041 15:63073919-63073941 ATTAATATAAAAAAGGAGAACGG + Intergenic
1127921832 15:63500774-63500796 ATGACTAAATAAATGGAGAGGGG - Intergenic
1128396862 15:67235416-67235438 ATGAGAAAAGAAATGGGGAAGGG + Intronic
1128440616 15:67705231-67705253 ATGCATAAATGAATGTAGAAAGG - Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1130114365 15:80993514-80993536 ATGAACAACCAAATGAAAAACGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130440569 15:83948947-83948969 AAGAATCACAAAATGGAGAATGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131164242 15:90130727-90130749 ATAAATAAATAAATGAATAAAGG + Intergenic
1131330533 15:91495222-91495244 ATGAAGAAACATATGGAGTCAGG + Intergenic
1131571086 15:93536976-93536998 ATGATTAAACAAATAAATAAAGG - Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131804995 15:96112430-96112452 ATTGATAAAGAAATGGTGAATGG - Intergenic
1131913149 15:97231469-97231491 ATGAAGAAATAAAAGAAGAAAGG + Intergenic
1133083872 16:3346317-3346339 ATGAATAAATAAATAGGAAAAGG + Intergenic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134129406 16:11639082-11639104 ATGAGTAAACAAATGGGTAGAGG + Intergenic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134357465 16:13497383-13497405 ATCAATAAAGAAAAGGAGAGGGG + Intergenic
1134460803 16:14427742-14427764 AGGAATGAGCAAATGGAAAAGGG + Intergenic
1134632236 16:15765157-15765179 ATGAATGAATAAATGGATAGAGG + Intronic
1134661506 16:15987945-15987967 ATAAATAAACAAATACAGGATGG - Intronic
1134671246 16:16056742-16056764 GTGAATAAAACAAAGGAGAATGG - Intronic
1134847800 16:17455245-17455267 ATGAATAAACAGCTCCAGAAAGG - Intronic
1135600216 16:23776519-23776541 GTGAATAATCAAATAGAGATGGG - Intergenic
1135690722 16:24535382-24535404 ATAAATAAATAAATAGAAAAGGG - Intergenic
1136061297 16:27728425-27728447 ATAAATAAACAAATAAATAAAGG - Intronic
1136184485 16:28578571-28578593 ATGAATAAATACATGGCGAGAGG + Intronic
1136533360 16:30884479-30884501 AAAAAAAAACAAATGGAGATAGG - Intronic
1137820732 16:51442788-51442810 ATGGAGAATCAAATAGAGAAGGG + Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138806961 16:60101171-60101193 AAGAATAAACAAATGAAGATTGG - Intergenic
1138832594 16:60393236-60393258 AGGAATAAACAAAGGCAGGATGG - Intergenic
1138928459 16:61621537-61621559 ACAAATAAATAAATGAAGAAAGG + Intergenic
1138963500 16:62055472-62055494 AGAAATAAACTAAGGGAGAAAGG - Intergenic
1139213229 16:65101492-65101514 AAGAATGAATAAATGGAGATAGG - Intronic
1139245590 16:65439374-65439396 AAGAATAAATCAATGGAGAGTGG - Intergenic
1140112832 16:72018307-72018329 ATGAAGAAACCAATGGATATGGG + Intronic
1140117384 16:72054550-72054572 AGGAATTACGAAATGGAGAAGGG + Intronic
1140118467 16:72063153-72063175 AGGAATTACGAAATGGAGAAGGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141157245 16:81605755-81605777 ATAAATAAACTATTGGAGAGTGG - Intronic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1142532793 17:594319-594341 ATAAATAAATAAATAAAGAATGG + Intronic
1142553845 17:758633-758655 ATGTATAAAAAAAAAGAGAAGGG + Intronic
1142636315 17:1259968-1259990 ATAAATAAAGTAATTGAGAACGG + Intergenic
1142720487 17:1772549-1772571 ATAAATAAATAAATGTAAAAGGG - Intronic
1142901509 17:3014998-3015020 ATAAATAAATAAATAGAGACAGG - Intronic
1143343317 17:6231389-6231411 ATGAGTAAACAAATCAAGAATGG + Intergenic
1143533155 17:7517967-7517989 ATGAATGAAAAAATGGAGAGAGG - Intergenic
1143858160 17:9868126-9868148 ATGAATGAATGAAAGGAGAAAGG + Intronic
1144037295 17:11378889-11378911 AAGAAAAAACAAATGAATAATGG + Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144223254 17:13119596-13119618 ATCTTTAAACAAAAGGAGAAAGG - Intergenic
1144311309 17:14016568-14016590 ATGAAAAAAAAAATAGAAAAAGG - Intergenic
1144509366 17:15862170-15862192 AAGAAAAAAAAAAGGGAGAAGGG - Intergenic
1145764671 17:27450174-27450196 TTGAATAAACAAATGAGGGAGGG - Intergenic
1145977211 17:28991199-28991221 ATAAATAAATAAATGGAGGCTGG - Intronic
1146202291 17:30869458-30869480 AAGAAAAAACGAAGGGAGAATGG - Intronic
1146271054 17:31486246-31486268 ATAAATAAACAAATAGAGACAGG + Intronic
1146351560 17:32099418-32099440 ATTTTTAAGCAAATGGAGAATGG - Intergenic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1146821701 17:35988091-35988113 ATGAATAAACAAATTGAGCCAGG + Intronic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147972329 17:44225659-44225681 ATAAATAAATAAATGTAGAATGG - Intergenic
1148190203 17:45672949-45672971 ATGAATGAATGAATGAAGAAAGG + Intergenic
1148236049 17:45969896-45969918 ATGTATGATCAAATGGATAATGG - Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148500856 17:48089827-48089849 ATAAATAAATAAATGGCAAAAGG + Intronic
1148798511 17:50209154-50209176 ATGAACAAACAAATGGGGCCGGG + Intergenic
1149106179 17:52969203-52969225 ATTGATAAATAATTGGAGAAGGG - Intergenic
1149116285 17:53100395-53100417 ACAAATAAAAAAATGGAGGAAGG + Intergenic
1149295322 17:55256860-55256882 ATGCATTAACAGATGGGGAATGG + Intergenic
1149488736 17:57066252-57066274 ATAAATAAATAAATAGAGTAGGG - Intergenic
1150188899 17:63216380-63216402 AGGAATAACCAAATGGAAGAGGG - Intronic
1150198424 17:63326358-63326380 AAGAATAAGCAAATGGATTAAGG + Intronic
1150537576 17:66059040-66059062 TTGACCAAAAAAATGGAGAAAGG + Intronic
1150735434 17:67732955-67732977 ATTAATAAACAAATTCAGCAAGG - Intronic
1150751609 17:67868708-67868730 ATTTTTAAGCAAATGGAGAATGG - Intronic
1151233042 17:72698639-72698661 ATGAATAAATAAAAGGAAAGTGG - Intronic
1151252900 17:72851271-72851293 ATGAATAAACAAATAGCCCAGGG - Intronic
1152187382 17:78866376-78866398 AAAAAAAATCAAATGGAGAAGGG - Intronic
1152361414 17:79834824-79834846 ATGAGCAAATACATGGAGAACGG - Exonic
1152605841 17:81289623-81289645 ATAAATAAATAAATGGAATAAGG + Intronic
1152713228 17:81885393-81885415 ATGAATAAGGAAATGAAGATTGG + Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153187859 18:2504947-2504969 TTGACAAAACAAAAGGAGAATGG + Intergenic
1153319389 18:3757420-3757442 ATAAATAAATAAATGGTGCAAGG + Intronic
1153466072 18:5389180-5389202 ATGAATGAACACATTGATAAAGG - Intergenic
1153627363 18:7034413-7034435 ATGAATAAACAAACATAAAATGG + Intronic
1154052696 18:10976457-10976479 ATGAAGTAACCAATAGAGAAGGG - Intronic
1154150391 18:11901842-11901864 ATAAATAAATAAAGGGGGAACGG + Intronic
1154280043 18:12994541-12994563 AAGAATAAAAACATGGAAAAGGG + Intronic
1154397925 18:14008943-14008965 ATGAATAAATAAGTGGGCAAAGG - Intergenic
1155224739 18:23719335-23719357 ATAAATAAACAAATAAGGAAAGG + Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155899266 18:31367882-31367904 AAAAATAATCAAATGGGGAAAGG + Intergenic
1156186732 18:34671738-34671760 ATGAAGAAATAAAGGAAGAAAGG - Intronic
1156334941 18:36161822-36161844 AAGAATAAACAAGTGGGGTAGGG - Intronic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156727147 18:40142073-40142095 ATAAATAAAGAAATCAAGAATGG - Intergenic
1156935297 18:42698376-42698398 AAAAATGAATAAATGGAGAAGGG - Intergenic
1156941663 18:42774676-42774698 ATAAATAAACAAATTGAGTAAGG - Intronic
1157001936 18:43537194-43537216 ATGTACAAACAAATTGACAAAGG - Intergenic
1157034853 18:43959148-43959170 ATGAATAAATAAATAAATAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158088820 18:53685669-53685691 AGAAATAAAAAAATGTAGAAAGG - Intergenic
1158134864 18:54197126-54197148 ATGAATGAATAAAGGAAGAAAGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158430449 18:57380754-57380776 ATGAAAGAACAAATGGGTAATGG + Intergenic
1158488251 18:57887495-57887517 ATGAAGAAACAAGTCCAGAAAGG + Intergenic
1158638918 18:59185638-59185660 ATGAGTAAACGAATGAAGTAGGG + Intergenic
1158767813 18:60476325-60476347 ACGAATAAAGAAATGAATAAAGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158789423 18:60759152-60759174 ATGAATGAACAAAAGAGGAAAGG - Intergenic
1158905804 18:62010624-62010646 ATGAATAAAAAAATATAGTATGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159336211 18:67070742-67070764 ATGAATAAATGAATGAAGAAGGG - Intergenic
1159440155 18:68468080-68468102 ATGAATTAACACATGGAGGGTGG + Intergenic
1159457742 18:68683002-68683024 ATAAATAAATAAAAGGAGAGGGG + Intronic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159703676 18:71660685-71660707 AAGAATAAACAATGGGAGAGAGG - Intergenic
1160284818 18:77532128-77532150 ATAAATAAATAAAAGAAGAAGGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161506549 19:4647083-4647105 ATGAATAAACAAAATGAGATCGG - Intronic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1162112519 19:8407614-8407636 ATGAATGAATGAATGGAGACTGG + Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1162539146 19:11283387-11283409 GTGAACAAACCAATGTAGAAAGG + Intergenic
1162590164 19:11586249-11586271 ATAAATAAATAAATAGAGACGGG + Intronic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1163152691 19:15424498-15424520 ATGGGTAAGCAACTGGAGAAAGG + Intronic
1163238393 19:16043273-16043295 ATGAATAAACGAATGGATGGAGG + Intergenic
1163238428 19:16043404-16043426 ATGAATAAACGAATGGATGGAGG + Intergenic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163865936 19:19773395-19773417 ATAAATAAAATAAAGGAGAAGGG - Intergenic
1164428593 19:28166963-28166985 ATGTATAATCAATTTGAGAAAGG - Intergenic
1164516357 19:28939594-28939616 ATCAATCAACAAGTGGATAAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164936513 19:32219090-32219112 ATGAATGAATAAATGAAGGAAGG + Intergenic
1165174305 19:33916166-33916188 ATAAATAAATAAATGTAGAAAGG - Intergenic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165867574 19:38948446-38948468 ATGAATAAATAAATGGGGGAAGG + Intronic
1165988238 19:39789456-39789478 ATCAATCAACAAGTGGATAAAGG + Intergenic
1166061759 19:40330185-40330207 ATAAATAAATAAAAAGAGAAGGG - Intronic
1166062403 19:40334919-40334941 AATAATAAACAAGTGAAGAAAGG + Intronic
1166299883 19:41907547-41907569 ATGAATGAACAACTGGAGGGAGG - Intronic
1167718803 19:51163152-51163174 ATTGATCAAGAAATGGAGAAAGG + Intergenic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
1168703084 19:58453117-58453139 ATAAATAAATAAATTGAGGAGGG + Intronic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925611070 2:5703629-5703651 AGGAAGAAACAAATGCAGAAAGG - Intergenic
925694151 2:6557034-6557056 ATAAATAAACAAATAGGGGAGGG - Intergenic
925939104 2:8798033-8798055 ATGAATACACAAATCCTGAAAGG + Intronic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926500094 2:13642932-13642954 AGAAATAACCAAATGGAAAAGGG + Intergenic
926554994 2:14347148-14347170 ATGAGTAAACAAATGTAGAACGG + Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
926821533 2:16856056-16856078 ATGAAAAAAGAAAAGGAAAATGG - Intergenic
926887086 2:17607747-17607769 ATAAATTAACAAATGAATAAAGG + Intronic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927071978 2:19540220-19540242 TTGAATTAACAAATGTAAAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927462472 2:23310869-23310891 ATGACTGAACAAATGAATAAGGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928711134 2:34006893-34006915 ATAAATAAACAAACAGAGGATGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929349961 2:40938675-40938697 AGGAAGAAAGGAATGGAGAAAGG + Intergenic
929643738 2:43607284-43607306 ATGAATAAACTTCTGGGGAAAGG + Intergenic
929738334 2:44575377-44575399 ATATCTAAATAAATGGAGAAGGG - Intronic
930396119 2:50826718-50826740 ATGAACTAGAAAATGGAGAATGG + Intronic
931006435 2:57855244-57855266 TTTAATAAACAAATCAAGAAAGG - Intergenic
931219429 2:60276030-60276052 ATGAATAAATAAATGGCACAGGG - Intergenic
931402411 2:61943327-61943349 ATGAAAAAACACAAGGAGAGTGG - Intronic
931765738 2:65454561-65454583 ATAAATGAATAAGTGGAGAAAGG + Intergenic
931819680 2:65938773-65938795 ATGAATGGAAAAGTGGAGAAGGG + Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
931956432 2:67431214-67431236 ATAAATAAACATATGTATAAAGG - Intergenic
932499027 2:72165050-72165072 ATCAAAAAACAAAAGGATAAGGG + Intergenic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933362743 2:81308483-81308505 ATGAAAAAAGAAAGGAAGAAAGG - Intergenic
933391349 2:81672210-81672232 ATGCATAAACATATTGAGTAAGG - Intergenic
933881402 2:86673585-86673607 ATGATTAAAAAAATTGAGGAGGG - Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
935529050 2:104210524-104210546 ATAAATAAATGAATGGATAAAGG - Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
935664937 2:105502970-105502992 ATGAAAATACAAATGGGGTAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936592751 2:113819685-113819707 ATTAATATTCAAAAGGAGAAGGG + Intergenic
936664957 2:114584377-114584399 ATAAATAAACAAATAAATAAAGG - Intronic
936668095 2:114621724-114621746 ATAAATAAATAAATGGATAGAGG + Intronic
936817437 2:116476152-116476174 AGGAAGAAAGAAAGGGAGAAAGG + Intergenic
936829249 2:116622326-116622348 ATGAAAAGACAATTGCAGAATGG + Intergenic
937018795 2:118632040-118632062 ATGAAAAAACAAAAATAGAAAGG + Intergenic
937122422 2:119450093-119450115 ATAAATAAATAAATGGAGGGAGG + Intronic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937372155 2:121306318-121306340 TTAAATAAACAACTGGAGACTGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937814115 2:126232068-126232090 ATAACTAAATAAATGAAGAAAGG - Intergenic
937936053 2:127246256-127246278 ATAAATAAATAAATGAATAAAGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938681440 2:133695401-133695423 ATGAATAAACGAATTTGGAAAGG + Intergenic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
938767733 2:134471789-134471811 ATGCATAAACAGTTGGAGAGAGG + Intronic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938794973 2:134710411-134710433 ATGATTAAATAAATAGAAAATGG + Intronic
938851003 2:135259400-135259422 ATAAATAAAAATATGTAGAATGG - Intronic
938897753 2:135768996-135769018 ATAAACAAACAAATGGAGGCTGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939069287 2:137519262-137519284 ATAAATAAATAAATAGAAAAAGG + Intronic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
939580306 2:143938638-143938660 ATGAAAAAAAAAATTGAAAATGG - Exonic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
939798311 2:146676338-146676360 ATGAAAAATCAAGTTGAGAATGG + Intergenic
940136147 2:150437606-150437628 GTGAATAAAGGAAAGGAGAAAGG + Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940438179 2:153680143-153680165 ATGAATAAATAAATGAATATAGG + Intergenic
940628441 2:156206968-156206990 ATGATCAAAGAGATGGAGAATGG - Intergenic
940664776 2:156594831-156594853 ATGAATAAGCCAATGTTGAAAGG + Intronic
941117996 2:161493751-161493773 AAGAATAATAAATTGGAGAAGGG + Intronic
941496933 2:166217092-166217114 AAGAATAAACAATGGGGGAAAGG + Intronic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942637425 2:178022723-178022745 ATGAAATATCATATGGAGAATGG + Intronic
942672670 2:178392950-178392972 GTGAATAAGGGAATGGAGAAAGG - Intronic
942800378 2:179868371-179868393 ATGTGTAAAGAAAAGGAGAAGGG + Intergenic
942827769 2:180200624-180200646 ATGAATAAAAATGTGCAGAAAGG + Intergenic
943165515 2:184319239-184319261 ATGAATTAGAAAATGAAGAAAGG - Intergenic
943167211 2:184345027-184345049 ATGAAAAAACAAATATGGAATGG - Intergenic
943686611 2:190825156-190825178 ATTAATAAACAAATTTAGTAGGG - Intergenic
943881139 2:193145198-193145220 ACAAATAAATAAATGGATAATGG - Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
944036472 2:195300467-195300489 ATGAATAAACTCTTGGAGGAAGG + Intergenic
944454269 2:199877108-199877130 ATGAACAAACAAACTGAAAAGGG + Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
944781169 2:203019029-203019051 AAGAATAAAAATATGGTGAAGGG - Intronic
944872835 2:203931605-203931627 ATGAATACAGAACTGTAGAATGG + Intergenic
944899402 2:204198815-204198837 ATGAATAGTCATATGGAGATAGG - Intergenic
945246357 2:207720759-207720781 AGAAATACACAAAGGGAGAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945653047 2:212588845-212588867 ATGAAGGAAGAAAGGGAGAAAGG + Intergenic
945685196 2:212960377-212960399 AGTAAAAAAGAAATGGAGAATGG - Intergenic
945689657 2:213017678-213017700 GTGAACTAATAAATGGAGAAGGG - Intronic
945801708 2:214440717-214440739 ATGTATGAACAACTGAAGAATGG - Intronic
945895557 2:215477717-215477739 TTGGATAAAGAAATGCAGAAAGG - Intergenic
945901389 2:215541544-215541566 ATGAATTAACATATTGATAATGG - Intergenic
945977654 2:216283255-216283277 ATGAATAAATGAATGCAGAAAGG - Intronic
945978529 2:216289538-216289560 ATGGAGAAACAACTGGAGACTGG - Intronic
946618798 2:221538839-221538861 ACGAAGAAACAAATGTAAAAAGG - Intronic
947384827 2:229580582-229580604 ATAAAGGAACAAATGGAGAGAGG + Intronic
947674412 2:231964134-231964156 GACAAAAAACAAATGGAGAAGGG - Intronic
947938816 2:234030745-234030767 ATGAATAAATAAATGCATAAAGG - Intergenic
948108685 2:235436341-235436363 ATGAACAAACAAATGGTCTAGGG + Intergenic
948558041 2:238830453-238830475 ATAAATAAATAAATGGGGAAGGG + Intergenic
948582642 2:238998299-238998321 ATAAATAAATAAATGAAGGAAGG - Intergenic
948635080 2:239329578-239329600 ATCACAAAACAAATGGAGCACGG - Intronic
1169008044 20:2225335-2225357 TTGAATAAATGAATGAAGAATGG + Intergenic
1169215146 20:3789232-3789254 TCAAATAAACAAAAGGAGAATGG - Intronic
1169476363 20:5934537-5934559 ATACATAAACAAATTGAGAGTGG + Intergenic
1169493733 20:6093260-6093282 AAGAAGAAACAAATGAAGGAAGG - Intronic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169608745 20:7354361-7354383 ATGTTGAAACTAATGGAGAAAGG + Intergenic
1169657524 20:7941863-7941885 ATTAAGAGACAAATGGATAAGGG - Intergenic
1169781035 20:9310727-9310749 ATAAATAAAAAAAGGGAGCAGGG + Intronic
1169847870 20:10015328-10015350 AGGAATAACAAAATGGAAAAGGG - Intronic
1169901015 20:10551641-10551663 ATAAATAATCACATGAAGAATGG + Intronic
1170171432 20:13417633-13417655 ATGAACAAGCAAATGGAAAGTGG - Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170956595 20:20985636-20985658 ATGAATGAATGAATGGTGAATGG - Intergenic
1171111623 20:22489504-22489526 ATAAATAAACAAATAAATAAAGG + Intergenic
1171491268 20:25519603-25519625 ATGGATAAACAAATTGATACAGG + Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172405102 20:34682427-34682449 ACAAATACCCAAATGGAGAAAGG + Intergenic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173169531 20:40712911-40712933 ATAAATAAATAAAAGGAGAAGGG - Intergenic
1173240992 20:41297142-41297164 TTGAATCAACACAAGGAGAATGG + Intronic
1173405483 20:42760839-42760861 ATTAATAATAGAATGGAGAAAGG - Intronic
1173777991 20:45727523-45727545 AGGAAGAAGCAAATGGAGTAAGG + Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174673355 20:52329677-52329699 ATGAACAAACAAAGGAAAAAAGG - Intergenic
1174722578 20:52829190-52829212 ATGAAACAACAAATGGAGAGTGG - Intergenic
1174729153 20:52897664-52897686 ATGAATGAACAAAAGCTGAACGG + Intergenic
1175086500 20:56463861-56463883 ATGAATGAACGAAAGGAAAAGGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175942516 20:62544156-62544178 ATGAATAAATAAATGAAGTGCGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176975653 21:15318011-15318033 AAGAAAAAAGAAATGGAAAATGG + Intergenic
1176989718 21:15480801-15480823 ATGAATGAACAAATAAAGATAGG + Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177108594 21:16994695-16994717 ATGGAAAAAGAAATGGAAAATGG - Intergenic
1177221957 21:18206490-18206512 AAAAATAAAGAAATGGAAAAAGG - Intronic
1177261894 21:18740156-18740178 ATGAATAAAGACAGGAAGAATGG + Intergenic
1177306851 21:19329537-19329559 ATAAATAAATAAATGAAGATGGG - Intergenic
1177306906 21:19330465-19330487 AAAACTAAACAAATAGAGAAAGG - Intergenic
1177345596 21:19864726-19864748 ATGAATAAAGACAAGGAGAGTGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177463409 21:21442650-21442672 AGGAATAAATAAATGCAGAGAGG + Intronic
1177522555 21:22246956-22246978 ATGTATAAACATTTGTAGAAAGG + Intergenic
1177564517 21:22801424-22801446 ATTAATAAATAAATCTAGAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177723566 21:24938850-24938872 ATGCAAGAACAAATGCAGAAGGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179045135 21:37837189-37837211 ATAAGAAAAAAAATGGAGAAGGG - Intronic
1179423724 21:41255999-41256021 AAGAATAAAAAAAGGGAAAAGGG - Intronic
1179463986 21:41559046-41559068 ATAAATAAATAAATAGAGGAAGG + Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181363986 22:22359719-22359741 ATAAACCAACAAATGGATAAAGG - Intergenic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1181995930 22:26882483-26882505 ATTAAGAAAAAAATGGAGAAAGG - Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1182766530 22:32761731-32761753 GTAAATAAATAAATGGAGGAAGG - Intronic
1182979614 22:34656539-34656561 ATGCATAAACATATGGGGAATGG + Intergenic
1183144647 22:35978762-35978784 AGAAATAAACAAATGAAAAAGGG + Intronic
1184173892 22:42775120-42775142 ATGGAGAAACAACTGGAGACTGG + Intergenic
1184750121 22:46480905-46480927 ATGAATGAAGAAATGAAGGATGG - Intronic
949120220 3:375197-375219 ATGAAAAATGAAATGGAGCATGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950277179 3:11672015-11672037 GGAGATAAACAAATGGAGAAAGG - Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
951053123 3:18117262-18117284 ATGAATAATTTAATGGAGAAGGG - Intronic
951069903 3:18315380-18315402 ATCAATCAAAAAATGGACAAAGG - Intronic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
951649083 3:24929153-24929175 ATTAGTAAACAAATGTATAAAGG + Intergenic
951703149 3:25516489-25516511 ATGAATAATCAAATTGAGACTGG + Intronic
951946140 3:28138609-28138631 ATGTATAAACAAATGAGAAAGGG + Intergenic
952025052 3:29070126-29070148 TTGACTAAAGCAATGGAGAAAGG - Intergenic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952182485 3:30932811-30932833 ATGAAAAATAAAATGCAGAAAGG - Intergenic
952354967 3:32575517-32575539 ATGAGTAAAGAAAAGGAGACTGG - Intergenic
953075344 3:39564866-39564888 AAGAAAAAATAAATGGAAAAGGG - Intergenic
953090211 3:39717190-39717212 ATGACTGAATAAATGGAGAGAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954243792 3:49314851-49314873 ATAAATAAATAAATAGAGACAGG - Intronic
954736044 3:52707149-52707171 ATAAATAAATAAAAGGTGAAGGG - Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955176368 3:56618142-56618164 ATGGATAGATAAATGCAGAAAGG - Intronic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955216874 3:56991265-56991287 ATGAATGAGCAAATGGGGAAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956849642 3:73217313-73217335 ATGAAGAATGAAATGAAGAAAGG - Intergenic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957005478 3:74940930-74940952 ATGTGTAAATAAATTGAGAAGGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957368364 3:79256597-79256619 ATGAATTCACAAATTTAGAATGG - Intronic
957791690 3:84949828-84949850 TAGAATAAAATAATGGAGAAAGG - Intergenic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
957795550 3:85001204-85001226 GTGAATAATTAAATAGAGAAAGG - Intronic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
957946594 3:87070877-87070899 ATGAATAAGAGAATGGATAATGG - Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958713910 3:97754691-97754713 ATGAATAAATAAATAAATAAAGG - Intergenic
958727568 3:97924397-97924419 ATGAATAAGAAAAAGGTGAAAGG + Intronic
958780089 3:98530486-98530508 ATGAAAAAACAACTTAAGAAAGG + Intronic
958955523 3:100461803-100461825 ATGATTAATTAGATGGAGAATGG - Intergenic
958996292 3:100909140-100909162 AAAAACAAGCAAATGGAGAAAGG + Intronic
959682302 3:109109414-109109436 ATGAGAAAACAAATGGAGATAGG - Intronic
959722272 3:109505440-109505462 AAGAAAAAAAAAAAGGAGAAGGG - Intergenic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
959852326 3:111103578-111103600 ATAAATAAAGAAATAAAGAAAGG + Intronic
959852866 3:111110977-111110999 ATGAATACAGAAATGCAGAAGGG - Intronic
959921030 3:111868452-111868474 ATGAATAAGCAAATGGCAAGGGG - Intronic
960300407 3:115996723-115996745 ATAAATAAAGAAATGAATAAAGG - Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960450171 3:117797044-117797066 AAGAATAAACAACTGGTAAATGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960824146 3:121765800-121765822 ATGAAAAACCAAAAGGAGCAGGG - Intergenic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961802435 3:129462137-129462159 TTGTATAAATACATGGAGAAAGG + Intronic
961908948 3:130294024-130294046 ATAAAAAAACAAAAAGAGAAAGG + Intergenic
962057515 3:131887523-131887545 GTGAAAAAACAAATGTAGGAGGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962351741 3:134661356-134661378 ATGAATAAAGAATGGGTGAATGG - Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963345655 3:144094206-144094228 ATAAATAAATAAATAGAGAATGG - Intergenic
963376773 3:144477109-144477131 ATGAAGAAATAAAAGGAGAGAGG - Intergenic
963385631 3:144589332-144589354 ATGAAAAAAAAAATGGAAAAAGG - Intergenic
963412258 3:144945043-144945065 ATGAAAAAAAAAAGGGAAAAAGG - Intergenic
964371658 3:156006391-156006413 ATGAATGAACCAATGAAGAAAGG + Intergenic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
965339443 3:167468919-167468941 AGGAATAAAAAAAGAGAGAAAGG + Intronic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
965582009 3:170278658-170278680 ATAAATAAATAAATGAAGGAAGG + Intronic
965613161 3:170565814-170565836 ATGAAGAAACAAGTGGAAGAGGG + Intronic
965663374 3:171065495-171065517 ATGAATTCACAAATGCAGTATGG + Intronic
965749549 3:171961648-171961670 ATGCATAATGAAAAGGAGAAAGG + Intergenic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966635969 3:182134120-182134142 ATAAATAAAGAAGAGGAGAAAGG + Intergenic
967801496 3:193667326-193667348 ATCAACAAACAAATGGAAATGGG - Intronic
967855806 3:194116610-194116632 ATAAATAATAAAATGGTGAATGG + Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968189035 3:196654090-196654112 ATGAATGAACAACTGGAGAGTGG - Intronic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
970262058 4:14235735-14235757 TTGAATGAACAAATGGTGATGGG - Intergenic
970315621 4:14826087-14826109 AAAAAAAAAAAAATGGAGAAAGG - Intergenic
970501728 4:16684414-16684436 AAGAACTAACAAATGAAGAATGG + Intronic
971150386 4:24025224-24025246 ACGAATTAACAAAAGGAGACTGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971613220 4:28753523-28753545 ATCAGTGAACAAATGGAGGATGG - Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
972012614 4:34203800-34203822 ATGGTTAAACAAATGAATAAGGG - Intergenic
972024739 4:34362655-34362677 ATAAATAAAAAAAAGGAGATGGG + Intergenic
972193258 4:36620750-36620772 ATGAAAAAACAAGTAAAGAATGG + Intergenic
972384819 4:38554755-38554777 ATCAACAAACGAATGGATAAAGG - Intergenic
972540800 4:40037664-40037686 ATAAATAAATAAATAGAAAAAGG + Intergenic
972903304 4:43712226-43712248 ATGAATAAAGAAATTAAAAAAGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973859767 4:55051591-55051613 ATACATAAATAAATGTAGAAAGG + Intergenic
974007944 4:56578201-56578223 ATGAATAAATAAAAGTACAAAGG + Intronic
974583753 4:63841894-63841916 ATTAAGAAACAAGTGGAGGATGG - Intergenic
974583818 4:63843415-63843437 TTAAATACAGAAATGGAGAAAGG + Intergenic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974669909 4:65016017-65016039 ATGGATAAACAAGTGGTGAAGGG - Intergenic
974766273 4:66350322-66350344 ATGAATGAAGAAATTAAGAAGGG + Intergenic
975053005 4:69889555-69889577 ATAAATAAATAAATGGGGGAGGG - Intergenic
975212015 4:71711976-71711998 ATAAATACAAAATTGGAGAAAGG - Intergenic
975462507 4:74670942-74670964 ATGAATGAATATATGAAGAAAGG + Intergenic
975517766 4:75265925-75265947 ATTAATCAACAAGTGGATAAAGG + Intergenic
975675743 4:76825670-76825692 ATGAACAAACAAATGGTTACAGG - Intergenic
976233303 4:82868527-82868549 ATAAATAAATAAATAGAAAATGG + Intronic
976279777 4:83315878-83315900 AAGAATGAAGAAATGGAGGAAGG - Intronic
976407511 4:84676845-84676867 AAGCATAAAAACATGGAGAATGG + Intronic
976560302 4:86493461-86493483 ATCTAAAAACAAATGGAGAAAGG - Intronic
976781462 4:88763264-88763286 ATGAATGAACGAATGGGAAAGGG - Intronic
976992813 4:91389423-91389445 ATGAATAAGCAAATAGGTAATGG - Intronic
977338179 4:95724209-95724231 ATGAAAAAAAAAAAAGAGAAAGG - Intergenic
977598185 4:98907053-98907075 CTGAATAAATACTTGGAGAATGG - Intronic
977970308 4:103205596-103205618 ATCAATGAAGAAAAGGAGAAAGG - Intergenic
978200926 4:106022851-106022873 ATGAATAAACAAATGTTGTTTGG - Intergenic
978260699 4:106754031-106754053 ATCAATTATCAAATGGATAAGGG + Intergenic
978318820 4:107470543-107470565 ATGAAAAAAAAAAGGGAGACAGG + Intergenic
978487586 4:109273046-109273068 ATGAAAAATCAACTGGGGAAGGG + Intronic
979117557 4:116846575-116846597 ATCAACAAATAAATGGATAAAGG - Intergenic
979381331 4:120010178-120010200 TTGCAAAACCAAATGGAGAATGG - Intergenic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
980504865 4:133705451-133705473 ATGAAAACAAAAATGTAGAAGGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980684524 4:136209337-136209359 TTGAATAAACTAATGAATAATGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981741824 4:148010380-148010402 ATGAAAAAACCAATGGTTAAAGG - Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
981869285 4:149467342-149467364 ACGAATAAACAAATGAATTAAGG - Intergenic
981869837 4:149472854-149472876 AAAAAAAAAGAAATGGAGAAAGG + Intergenic
982001059 4:151021616-151021638 CTTAATAACCAAATAGAGAAGGG - Intergenic
982163505 4:152593467-152593489 ATGCATAAACAAATCGACATTGG + Intergenic
982244719 4:153340242-153340264 AAGAAAAAACAAATGAAGAATGG - Intergenic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
982506703 4:156227709-156227731 ATGAATACACAAATTCAGATGGG + Intergenic
982557723 4:156889894-156889916 GTGAATAAAAAAATGTTGAATGG + Intronic
982806428 4:159770960-159770982 ATGAATAAATAAAGGAAGTAAGG + Intergenic
982983955 4:162180213-162180235 ATGAATAAATATATGTAAAATGG + Intergenic
983027977 4:162760394-162760416 AAAAAAAAACAAAAGGAGAAGGG - Intergenic
983332694 4:166351650-166351672 AAGGATAAATAAATGGATAATGG - Intergenic
983606077 4:169585808-169585830 AACAATAATCAAATGGTGAAAGG + Intronic
983698714 4:170565401-170565423 ATGAATAAGCCAATGCAGAAAGG - Intergenic
983977949 4:173959217-173959239 ATAAATTAACAAAAGGAAAATGG + Intergenic
983994436 4:174164202-174164224 ATCTATAATCAAATGGATAAAGG + Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
984507498 4:180638041-180638063 ATGAATCAACAAGGGGTGAAAGG - Intergenic
984512709 4:180698608-180698630 AAGAATAAATTCATGGAGAAAGG + Intergenic
984556263 4:181217789-181217811 GAGAATGAACAATTGGAGAATGG + Intergenic
984556380 4:181218902-181218924 GAGAATGAACAATTGGAGAATGG - Intergenic
984962471 4:185111096-185111118 AGGAATAAAAGCATGGAGAAGGG + Intergenic
985249477 4:188009012-188009034 TTGATTAAAAAAATGGTGAAAGG - Intergenic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986587088 5:9329729-9329751 ATAAATAAATAAATGTACAAAGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986852311 5:11828534-11828556 ATAAATAAATAAATAGAAAAAGG + Intronic
987003372 5:13684219-13684241 GTGAAGAAATAAATGAAGAAAGG + Intergenic
987654689 5:20791573-20791595 CTGAATAACCACGTGGAGAAGGG - Intergenic
987701138 5:21399896-21399918 ATTTATCAACAAATGAAGAAAGG + Intergenic
987710803 5:21499026-21499048 ATGGATAAACAAATGAGGACAGG - Intergenic
987874378 5:23660999-23661021 TTAAATAAACATATTGAGAAGGG - Intergenic
987946884 5:24621290-24621312 ATGAATAAATAAATGGATATGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988045459 5:25945781-25945803 TTGAAAAAAAAAATGGTGAAAGG + Intergenic
988303213 5:29461213-29461235 ATGCATATACAAAGGGAGAGGGG - Intergenic
988309037 5:29533515-29533537 ACAAAAAAACAACTGGAGAAAGG - Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988695192 5:33614850-33614872 ATGAGTAAACACATGGAAAGTGG + Intronic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
988740949 5:34070268-34070290 CTGAATAACCACGTGGAGAAGGG + Intronic
988799341 5:34681796-34681818 ATGAAAAAAGAAATGCAGCAGGG - Intronic
989180030 5:38567489-38567511 ATAAATAAATAAATACAGAATGG - Intronic
989277636 5:39608453-39608475 ATTAATAAATAAATGCAGATTGG - Intergenic
989346063 5:40430695-40430717 ATGAACAACCAAAGGAAGAAGGG - Intergenic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990264763 5:54062807-54062829 AGGAATGAAAAAATGGGGAATGG + Intronic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
990436749 5:55800198-55800220 ATGAAGAAACAAATATAGAGAGG + Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990635379 5:57720365-57720387 ATGAATAAACAATTGTATTAGGG - Intergenic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
991138547 5:63211848-63211870 ATGAATAAATCAAGGCAGAAGGG + Intergenic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
991357251 5:65781832-65781854 GGGAATTAACAAATGGTGAATGG - Intronic
991419276 5:66424908-66424930 ATAAATAACCAGATGGGGAAAGG + Intergenic
991577516 5:68120522-68120544 ATAAATAAACAAAAGGAGATGGG - Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991633012 5:68675530-68675552 AAGAGTGAACAAATGGGGAAGGG - Intergenic
991761143 5:69918084-69918106 ATGGATAAACAAATGAGGACAGG - Intergenic
991786186 5:70200016-70200038 ATGGATAAACAAATGAGGACAGG + Intergenic
991840371 5:70793134-70793156 ATGGATAAACAAATGAGGACAGG - Intergenic
991878630 5:71200402-71200424 ATGGATAAACAAATGAGGACAGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992161734 5:74011006-74011028 ATGAATAAATGAAGGAAGAAGGG + Intergenic
992688735 5:79222805-79222827 GTGAATTAGCAAAGGGAGAAAGG + Intronic
992782317 5:80139470-80139492 AGAAAGAAACAAATGGGGAAGGG - Exonic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
993105086 5:83591431-83591453 ATGAAAAAATAAATGAACAAAGG - Intergenic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
993337356 5:86677568-86677590 GAGAAAAAACAAAGGGAGAAAGG + Intergenic
993491151 5:88551689-88551711 ATGAAGAAACAAATACAAAAGGG - Intergenic
993542984 5:89175449-89175471 ATGATTAAATAAATGGGGAGAGG + Intergenic
993849455 5:92988735-92988757 TTAAATAAATAAATGGTGAATGG + Intergenic
993956924 5:94245520-94245542 ATAAAAAAAGAAAGGGAGAAAGG - Intronic
994489911 5:100427875-100427897 ATGAAAAAATAAATGAGGAAAGG - Intergenic
994495860 5:100512533-100512555 ATAAAAAAACACATGGAGAGAGG + Intergenic
994634267 5:102324624-102324646 AGGCATAAAGAAAGGGAGAAAGG - Intergenic
994717886 5:103345960-103345982 ATGCAAAAACAGATGGATAATGG - Intergenic
994748228 5:103705878-103705900 ATGATTAAAGAAATGGAGAAAGG + Intergenic
995146379 5:108791454-108791476 ACGAACAAAAAAATGGACAAAGG - Intronic
995312360 5:110728635-110728657 ATGACTAATTAAAGGGAGAAAGG - Intronic
995409252 5:111836065-111836087 ATGAATGAACGAAGGGAGGAAGG - Intronic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995806873 5:116063215-116063237 ATGAATGAATAAATGAATAATGG - Intergenic
996043310 5:118842006-118842028 ATGAATTAACAAATGTAGTAAGG + Intronic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996380423 5:122857382-122857404 ATAAATAAATAAATGATGAAGGG - Intronic
996419299 5:123244012-123244034 AGGAAAAAACAAAGGTAGAAAGG - Intergenic
996473764 5:123891075-123891097 GTGAATGAATAAATTGAGAAGGG + Intergenic
996491440 5:124102642-124102664 ATACATAAACAAATGGAGTGTGG + Intergenic
996561327 5:124832694-124832716 ATGACTAAACAAAGGAAAAAGGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
996883518 5:128328019-128328041 ATGAAAATATAAATGAAGAAAGG - Intronic
997029290 5:130105182-130105204 AAGAAAAAAGAAAGGGAGAAAGG - Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997713305 5:136024033-136024055 AAGAATGAAGAAATGAAGAAGGG + Intergenic
997946080 5:138202715-138202737 ATAGATAAATAAATGGGGAAAGG + Intronic
998416096 5:141947050-141947072 ATAGATAAACAAAAAGAGAATGG - Intronic
998480278 5:142457550-142457572 ATGAATAAATTAATGGGGGATGG - Intergenic
998661604 5:144245082-144245104 ATAAATAAATAAATGTACAATGG - Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998906023 5:146906298-146906320 ATAAATAAATAAATGGAAAATGG - Intronic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000105627 5:158056296-158056318 ATGAAAAAACAAATAGGGAGGGG + Intergenic
1000526354 5:162363355-162363377 CTGAATTACCAAATGGAGACTGG - Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1001864069 5:175087787-175087809 ATGTCTAAATAAATGAAGAAAGG - Intergenic
1002399333 5:178982758-178982780 ATGAATGAACAAAGTAAGAAGGG + Intronic
1002597389 5:180333191-180333213 AGATATAAAAAAATGGAGAAGGG - Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003061322 6:2865057-2865079 AGGCATAACCAAATGGAGACGGG + Intergenic
1003083928 6:3045881-3045903 ATGAATGAACAAATAAAGGATGG + Intergenic
1003699067 6:8442031-8442053 AAGAACAAACAAATGAAGGAGGG + Intergenic
1003979073 6:11372383-11372405 ATCAACAAATAAATGGATAAAGG - Intronic
1004255955 6:14064586-14064608 ATAAATAAATAAATAAAGAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004406229 6:15336113-15336135 ATGAATAAATAAATAAATAAAGG + Intronic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1004790328 6:19018968-19018990 ATGAAAAAACAAATGGTGGGAGG + Intergenic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1005001171 6:21243483-21243505 ATGAATAAATAAATGAAAAATGG + Intergenic
1005164333 6:22902214-22902236 GTAAATTAACCAATGGAGAAAGG + Intergenic
1005358272 6:25006236-25006258 ATGAATAAACGAATGAATGAAGG - Intronic
1005546883 6:26881477-26881499 ATGGATAAACAAATGAGGACAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005694483 6:28338388-28338410 ATAAATAAATAAATATAGAATGG + Intronic
1005700212 6:28393298-28393320 ATGCTTAAAGAAGTGGAGAAAGG + Intronic
1006663005 6:35664896-35664918 ATTATGAAATAAATGGAGAAGGG - Intronic
1007000080 6:38302973-38302995 ATAAATAATCCAATGGAAAATGG - Intronic
1007057392 6:38901043-38901065 ATTGAAAAAAAAATGGAGAAAGG - Intronic
1007166963 6:39835608-39835630 ATGAACAAACATATGGAGGAAGG + Intronic
1007401841 6:41607223-41607245 ATCAATAAATAAAAGAAGAATGG + Intergenic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008419276 6:51278305-51278327 ATGAATAAACAAAAGCATAAAGG - Intergenic
1008779433 6:55085103-55085125 AACAAAAAAGAAATGGAGAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008883435 6:56405684-56405706 TTGAATAAATAAATAGGGAAGGG + Intergenic
1009017639 6:57922559-57922581 ATGGATAAACAAATGAGGACAGG + Intergenic
1009035760 6:58115736-58115758 ATGAATGAATGAATGAAGAATGG - Intergenic
1009312008 6:62166923-62166945 ACAAACAAACAAATGAAGAATGG + Intronic
1009533514 6:64851569-64851591 ATGAATAATAAACTGGATAAAGG + Intronic
1009891616 6:69691042-69691064 AAGAAAAAACAAAGGTAGAAAGG - Intronic
1010118358 6:72342217-72342239 ATGAATGACAAAATGGAGAGTGG - Intronic
1010143404 6:72637972-72637994 AGGAATAAACAAAATGAGATGGG + Intronic
1010149347 6:72712139-72712161 ATGAATGAATGAATGAAGAATGG + Intronic
1010230832 6:73533641-73533663 ATGAATAATTGAATGGATAAAGG + Intergenic
1010342530 6:74771675-74771697 ATGAATAAAGAAATATATAATGG - Intergenic
1010388907 6:75313742-75313764 AAGAATAAAGCAATAGAGAAGGG - Exonic
1010591040 6:77712654-77712676 ATGTATAAATTAATGAAGAAAGG + Intronic
1011053965 6:83185787-83185809 ATAAATAAATAAATGAAAAAAGG + Intronic
1011104695 6:83766648-83766670 CTGACTAAAGAAATGGGGAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011671670 6:89689307-89689329 AGGTATAAACAAATGGTGTAGGG + Intronic
1011903243 6:92327330-92327352 ATGAATTAATGAATGAAGAAAGG - Intergenic
1012074869 6:94670863-94670885 AAGAACAAACAAATGCAGGAAGG + Intergenic
1012161122 6:95887260-95887282 ATAAATAAACACATCAAGAAGGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1012642832 6:101642387-101642409 ATGGAAAGAGAAATGGAGAATGG - Intronic
1012973028 6:105751950-105751972 ATCAACAGACAAATGGATAAAGG - Intergenic
1013406481 6:109848472-109848494 ATAAATAAATAAATAGAAAATGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013732837 6:113189271-113189293 TTGAATAAACCAAAGTAGAATGG - Intergenic
1013799523 6:113925767-113925789 AGGAAGAAACAAATGAATAATGG + Intergenic
1013818820 6:114131562-114131584 ATGATTAAAAAGTTGGAGAAGGG + Intronic
1014024156 6:116625551-116625573 ATGAAAAAAGAAAGGTAGAATGG + Intronic
1014053623 6:116987518-116987540 ATCAATAAATAAATCCAGAAAGG - Intergenic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014520503 6:122436852-122436874 AAGAAGACACAAATAGAGAATGG + Intergenic
1014533099 6:122583738-122583760 ATGAATAAACTAATCTAGAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014830514 6:126097901-126097923 AAGAATAAACAAAAAGAGTATGG - Intergenic
1014901882 6:126975805-126975827 ATGAATAACAAAATGCAAAAGGG - Intergenic
1015001458 6:128221591-128221613 ATGATTTAAGATATGGAGAAAGG - Intronic
1015038023 6:128681111-128681133 ATCAATCAACAAGTGGATAAGGG - Intergenic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1015172763 6:130272217-130272239 ATTATTAAATAAATGGAGATGGG - Intronic
1015800064 6:137051762-137051784 TTTAATGAACAAATGGAGGATGG + Intergenic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016195224 6:141328114-141328136 ATTAATAGATAAATGGATAAAGG + Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1016397982 6:143647407-143647429 ATGAATAAACACATGTGAAATGG - Intronic
1016473528 6:144401183-144401205 ATGAATAAAAAAATATAGAAAGG - Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016831369 6:148436572-148436594 AAGAGTAAGCATATGGAGAAAGG - Intronic
1016944397 6:149515156-149515178 AAGAAAAAAAAAATGGAGACCGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017502211 6:155036164-155036186 ATGAATAAAGGAAGGGAGGAGGG + Intronic
1017539744 6:155388349-155388371 TTGAATCACCAAATGGAGATTGG + Intergenic
1017897129 6:158690237-158690259 GTGAATAAATAAATTGAGCAGGG + Intronic
1017991481 6:159492988-159493010 ATGAATAAAGGAAAGGACAAGGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018563467 6:165126622-165126644 ATGCAAAAATAAATGGAAAATGG + Intergenic
1018725397 6:166608925-166608947 ATGAATAAACAACTTAAGATTGG + Intronic
1018738018 6:166703849-166703871 AGAAAAAAACAAAAGGAGAATGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020969538 7:14918386-14918408 ACTAATAAACAAATGTAGCAAGG + Intronic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021281670 7:18727435-18727457 AAGAAAAAAAAAATAGAGAAAGG - Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021730368 7:23589765-23589787 ATAAATAAATAAATAGTGAATGG - Intergenic
1021773026 7:24023998-24024020 ATGAATAATCAGTTAGAGAATGG - Intergenic
1021958948 7:25853116-25853138 GTGTTTAAACAAATGGAGATGGG - Intergenic
1022052643 7:26692950-26692972 ATAAATTAAAAAATGGATAAAGG + Intronic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022295256 7:29044713-29044735 TTGAAAAGACAAATCGAGAAAGG - Intronic
1022781012 7:33583226-33583248 ATAAATAAAAATAGGGAGAAAGG - Intronic
1022883442 7:34616013-34616035 ATGACTTAAAAAATGGAAAAAGG + Intergenic
1022967044 7:35483494-35483516 TTGAAAAAATAATTGGAGAAAGG - Intergenic
1023301316 7:38775159-38775181 ATGAAAAAATAAAGGGGGAAGGG + Intronic
1023318341 7:38965458-38965480 ATAATTAAACAAATGAAAAATGG - Intergenic
1023453727 7:40315550-40315572 AAGAATAAAGTAAAGGAGAATGG + Intronic
1023502995 7:40870766-40870788 ATAAGTAAACAAATGGAGAACGG - Intergenic
1023761882 7:43471795-43471817 ATGAATAAATAAAATGAGAAGGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024040930 7:45553391-45553413 ATCAACAAACAACTGCAGAATGG + Intergenic
1024170841 7:46784036-46784058 ATGAATAAATGAATGTAGAAGGG + Intergenic
1024328612 7:48134026-48134048 ATGCACAAACAAATCAAGAAAGG + Intergenic
1024479436 7:49848608-49848630 ATGATTTTACAAGTGGAGAAAGG - Intronic
1024503216 7:50135877-50135899 ATGAGAAAACAAATGGAAATTGG + Intronic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025733373 7:64126085-64126107 ATAAATAAACAAATAAATAAAGG - Intronic
1025771181 7:64509036-64509058 GGGAAGAAACAAATGGAGAGGGG - Intergenic
1026277162 7:68890092-68890114 ATAAATAAACAAATAAAGAGAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1028334760 7:89638245-89638267 ATAAATAAATAAATGAAGTAAGG - Intergenic
1028428978 7:90724668-90724690 ATGACTAAATTAATAGAGAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029583482 7:101453991-101454013 ATGTATAGACATATGTAGAAAGG - Intronic
1029633828 7:101770520-101770542 AGGAAAAAAGAAATGAAGAAAGG - Intergenic
1030067714 7:105673202-105673224 ATGAATAAGCGTATGGGGAAGGG - Intronic
1030319045 7:108145411-108145433 GTTAATAAAGAAATGGAGAAGGG + Intergenic
1030552979 7:110987986-110988008 TTAGAAAAACAAATGGAGAAAGG + Intronic
1030856029 7:114558661-114558683 ATTAGTATACAAATGGAGACGGG - Intronic
1031053882 7:116972979-116973001 GTGAATAAACAAATGGGTGAGGG - Intronic
1031090015 7:117343095-117343117 ATCAATCAACAAATGGATAAAGG - Intergenic
1031204089 7:118731860-118731882 ATTAATGAATAAATGCAGAATGG - Intergenic
1031445845 7:121852665-121852687 ATGAATAAATAAATAAAGGAAGG + Intergenic
1032549929 7:132775529-132775551 ATTAATAAATAAAAGGAGAAAGG - Intergenic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033610599 7:142960653-142960675 ATAAAGAAAAAAATGCAGAAAGG + Intronic
1033675052 7:143532740-143532762 AGGAAGAAACAATTGGATAAAGG - Intergenic
1033696784 7:143796701-143796723 AGGAAGAAACAATTGGATAAAGG + Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034127871 7:148690135-148690157 TCTAATAAACAAATGGAGCAGGG + Intergenic
1034242195 7:149619117-149619139 ATGAATAAATAAATAGACACTGG + Intergenic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1034870737 7:154681283-154681305 AGGAATAATCAAATTTAGAAGGG + Intronic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1035422935 7:158744071-158744093 ACAAACAAACAAATGTAGAAAGG + Intronic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1035658275 8:1327884-1327906 ATTAATGAAAAAGTGGAGAATGG - Intergenic
1035905524 8:3506025-3506047 ATAATTTAACAAATGTAGAAAGG + Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036002093 8:4617813-4617835 ATGAATATACTCATGGAGGAGGG - Intronic
1036092174 8:5678700-5678722 GTGAATAAACAGATGTAGACAGG + Intergenic
1036507714 8:9370513-9370535 GGGAATAGACAAATGGCGAAGGG + Intergenic
1036646763 8:10615897-10615919 ATTAATAAATAAATGGAACAGGG - Intronic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037747597 8:21659317-21659339 ATGAATGAATAAATAGATAAAGG - Intergenic
1037747947 8:21661696-21661718 ATGAATGAATGAATGGAGAGTGG - Intergenic
1037867464 8:22457313-22457335 ATAAATAAATAAATGAAGATGGG - Intronic
1038149080 8:24926404-24926426 ATAAATGAAAAACTGGAGAATGG - Intergenic
1038312922 8:26458768-26458790 ATGAATAAATAAAAAAAGAAAGG + Intronic
1038374733 8:27028411-27028433 ATAAATAAATAAATGAATAAAGG - Intergenic
1038379403 8:27078669-27078691 AGGAAAAAACAAATGGGAAAGGG + Intergenic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1038694642 8:29795519-29795541 ATAAATGAACAAAGGGATAAAGG + Intergenic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1038833178 8:31086159-31086181 AGGAATAAAAAAATGCATAATGG - Intronic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1040492210 8:47934544-47934566 ATAAATAAATAAATAGATAACGG + Intronic
1040709913 8:50175681-50175703 ATACATGAAGAAATGGAGAAAGG + Intronic
1040717789 8:50279259-50279281 ATCAATAAACATGTGGAAAATGG + Intronic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041033502 8:53762616-53762638 AAGAATAAACAAATAGATGATGG + Intronic
1041046335 8:53890409-53890431 ATGAATAAAAAAATGGATACAGG - Intronic
1041250262 8:55927229-55927251 AGGAATAAACATGTGAAGAATGG - Intronic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041502131 8:58550700-58550722 ATGAAACAACAAATGCACAATGG - Intergenic
1041527641 8:58824853-58824875 ATGAATATACAAATGGGGGGTGG + Intronic
1041562114 8:59229982-59230004 ATGCATTAACAAATGGGCAAAGG + Intergenic
1041638252 8:60168004-60168026 ATCAATCAACAAGTGGATAAAGG + Intergenic
1041684738 8:60633016-60633038 AAGAAAAAAAAAATGAAGAAAGG + Intergenic
1042119607 8:65471589-65471611 ATGAATGAATAAATGATGAATGG + Intergenic
1042455023 8:68990882-68990904 ATGAATAAACATATGTGAAATGG + Intergenic
1042527931 8:69784208-69784230 ATTAAAACACTAATGGAGAAAGG + Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043179862 8:77075103-77075125 ATGAATAAATAAATAAAGAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1043667705 8:82838267-82838289 ATGAATAAAAGAACAGAGAATGG + Intergenic
1043722848 8:83568598-83568620 ATGTATAAACAAAAGGGAAATGG + Intergenic
1043758450 8:84032676-84032698 ATGAAAAAACAAAGAGAGAGTGG + Intergenic
1043931810 8:86099881-86099903 ATTTATAAACATTTGGAGAAGGG + Intronic
1044106269 8:88210978-88211000 ATGAGGAAACAAGTTGAGAAGGG + Intronic
1044228051 8:89741724-89741746 AACAAAAAACAAATGGGGAAAGG + Intergenic
1044229937 8:89762217-89762239 ATGAATAAACAAATGAACCTGGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044251029 8:90004034-90004056 ATGAATCAAAAAAGGAAGAATGG - Intronic
1044532827 8:93327238-93327260 AGGAATAAAACAATGAAGAAAGG + Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1044579964 8:93814999-93815021 TTGTATAAAGAAATAGAGAAAGG + Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044634128 8:94305551-94305573 ACAAAGATACAAATGGAGAAGGG + Intergenic
1045110430 8:98935022-98935044 ATTACTAAAGAAAAGGAGAATGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045420416 8:102009028-102009050 AAAAATAAAAAAGTGGAGAAGGG + Intronic
1045783366 8:105894579-105894601 TTGAATAAATAAATGTAGAAGGG + Intergenic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046256857 8:111710868-111710890 AGGACCAAACAAATAGAGAAAGG + Intergenic
1046361540 8:113164944-113164966 TAGAATAAACCAATGGAGGAAGG - Intronic
1046560773 8:115834506-115834528 ATGAAAAAAAAAAAGAAGAAGGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1047376967 8:124308587-124308609 ATAAATAAATAAATGGTGGAGGG + Intergenic
1047459851 8:125052441-125052463 GTATATAAACGAATGGAGAAAGG - Intronic
1047881439 8:129198539-129198561 ATAAATAAATAAATGGATGAAGG - Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048039191 8:130708908-130708930 ATCAATGAGTAAATGGAGAAAGG + Intergenic
1048086906 8:131191516-131191538 AAGAAGAAATGAATGGAGAAAGG - Intergenic
1048196728 8:132337561-132337583 ATGAATATATGAATGAAGAAGGG + Intronic
1048266526 8:132992099-132992121 ATGAATAAGCAACTGAACAAAGG - Intronic
1048343238 8:133556612-133556634 ATGAAGAAACGAAAGAAGAAAGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1050202862 9:3165955-3165977 ATGAAGAATAAAAGGGAGAAAGG - Intergenic
1050747419 9:8892383-8892405 ATGAATAAATAAATTGGGCAAGG - Intronic
1050817827 9:9837745-9837767 AAGAATAAAAAAATGCAGCAAGG - Intronic
1050994493 9:12197748-12197770 ATAAATAAAGAAATGTATAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051121511 9:13757090-13757112 ATGAACGAACAAATGGATGATGG - Intergenic
1051154998 9:14132874-14132896 ATGAAGAAAAAAAGGAAGAAAGG - Intronic
1051598917 9:18852556-18852578 ATTAACTAACAAATAGAGAAAGG - Intronic
1051797896 9:20895085-20895107 ATGAGTCAAACAATGGAGAAAGG - Intronic
1051931346 9:22389921-22389943 AATAATAAACCAAAGGAGAAAGG - Intergenic
1051938205 9:22470388-22470410 ATGAGTAAACAATCTGAGAAAGG + Intergenic
1052230870 9:26150923-26150945 ATGAATAAAGGTATAGAGAAGGG - Intergenic
1053377418 9:37619428-37619450 ATTAATATAGAAATGGAGTAGGG + Intronic
1053464536 9:38296096-38296118 AAGAAAAAAGACATGGAGAAGGG + Intergenic
1053584653 9:39444407-39444429 ATGAAAAAGGAAATGGATAAGGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054106233 9:61003153-61003175 ATGAAAAAGGAAATGGATAAGGG + Intergenic
1054581664 9:66920815-66920837 ATGAAAAAGGAAATGGATAAGGG - Exonic
1054759950 9:68995507-68995529 ATGAAAAAGCAAATGGAGGCCGG + Intronic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1054987063 9:71274096-71274118 ATGGATGAACTAATGGATAAGGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1055960842 9:81818779-81818801 AGGAATCTAAAAATGGAGAAGGG - Intergenic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1056613644 9:88142233-88142255 ATAAATAAAATAATGAAGAAAGG + Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057273161 9:93662028-93662050 ATGAATCAACAAATGGTGAGTGG + Intronic
1057278321 9:93688997-93689019 AGCAATGAACAAATGGAAAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058005412 9:99908434-99908456 ACAAATAAACAAATGGGAAATGG - Intronic
1058397134 9:104567419-104567441 GTGAATAAACAAGTAAAGAATGG + Intergenic
1058570225 9:106333870-106333892 ATGAAGAAACAAATGTAGCAAGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059835532 9:118147898-118147920 TTGACTCAATAAATGGAGAATGG - Intergenic
1059931083 9:119261806-119261828 AAGAATAAACGAAGGAAGAAAGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060119994 9:120979912-120979934 ATGAATAAATGAATGAATAACGG + Intronic
1060289560 9:122288528-122288550 ATTAACAAACGAATGGTGAAAGG - Intronic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060632515 9:125172532-125172554 AAAATTAAAGAAATGGAGAACGG + Intronic
1060809250 9:126601003-126601025 ATAAATAAATAAATAAAGAATGG + Intergenic
1061035707 9:128113282-128113304 ACAAATAAAGAAATAGAGAAGGG + Intergenic
1185842285 X:3403058-3403080 ATAAATAAATAAATGGATGAAGG - Intergenic
1185975088 X:4711224-4711246 TTGAGTAAAGAAATGGAGGAGGG + Intergenic
1186331886 X:8543142-8543164 ATGAATAAATAAGTGAACAAAGG + Intronic
1186554344 X:10541802-10541824 ATTAAGAAACAAATAGAGGAAGG + Intronic
1187208831 X:17209139-17209161 AGGAATAAAGAAGTGCAGAAAGG + Intergenic
1188016722 X:25114481-25114503 ATAAATAAACAAATGCAGCCGGG - Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188327624 X:28824914-28824936 ATGAATACACAAATACAGAAAGG - Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1188475353 X:30586235-30586257 ATAAATAAACAAAAGAAAAAAGG + Intergenic
1188658232 X:32725882-32725904 AATAATAATCACATGGAGAATGG - Intronic
1188713820 X:33435575-33435597 ATCACTAAAGTAATGGAGAAGGG + Intergenic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189436274 X:40995558-40995580 AAGAATAAAAAAAGTGAGAATGG - Intergenic
1189728937 X:43998387-43998409 ATAAATAAACATATGGATGAAGG - Intergenic
1189736623 X:44077412-44077434 AGAACTAAACAAATGGAGAGAGG + Intergenic
1189777183 X:44480940-44480962 AGCAAGAAACAAATGGAGAAAGG + Intergenic
1190139984 X:47834511-47834533 ATGAATAAATGAAAGAAGAATGG - Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190622160 X:52298337-52298359 ATGAATGAATGAATGGAGAGAGG - Intergenic
1190731494 X:53229354-53229376 ATAAATAAATAAATGTAGAAGGG + Intergenic
1190751438 X:53365241-53365263 ATAAATAAACATATGGAAGACGG - Intergenic
1190782237 X:53608999-53609021 ATAAATAAATAAATAGAAAAAGG - Intronic
1190800406 X:53783279-53783301 ATAAATAAATAAATGTAGAAGGG + Intergenic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192306081 X:69961068-69961090 ATGACCAAACAAATGAAGTAGGG - Intronic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1192891394 X:75395119-75395141 ATCAATAAAGAAATTAAGAAGGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193003324 X:76587608-76587630 ATAAATAAATAAATAAAGAAGGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193077204 X:77366738-77366760 ATGGATAAATAACTGCAGAATGG + Intergenic
1193158351 X:78199055-78199077 ATAAATAAATAAATAGAAAATGG - Intergenic
1193550228 X:82883357-82883379 ATTAATAAACAAATTTAGTAAGG + Intergenic
1193915669 X:87359796-87359818 ATGAATGAAAAAATGAAGGAAGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1194779410 X:98005726-98005748 ATTAAATAACAAATGAAGAATGG - Intergenic
1194826461 X:98570405-98570427 ATGAATCAGCAAATGGACCAAGG - Intergenic
1194922720 X:99787092-99787114 ATAAATAAACACATAGAGGAGGG - Intergenic
1195092766 X:101478341-101478363 AGCAATACACAAATGGAAAATGG + Intronic
1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG + Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195495685 X:105530393-105530415 ATAAAAAATAAAATGGAGAAAGG - Intronic
1195828649 X:109031351-109031373 AAGAGAAAACAAATGAAGAACGG - Intergenic
1195867160 X:109445523-109445545 ATTAATAAACAAAAGGAAACAGG + Intronic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1196091052 X:111743186-111743208 AAAAAAAAGCAAATGGAGAAAGG - Intronic
1196235356 X:113273879-113273901 ATGAATAAGTGAATGGAAAAAGG + Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1196695633 X:118608335-118608357 ATCAATAAACAAATTGCTAAAGG + Exonic
1196798793 X:119523871-119523893 ATGAATGAACAAGTGGAGACTGG + Intergenic
1196916423 X:120540333-120540355 ATCATTAAACAACTGGAAAAAGG + Intronic
1197020669 X:121684039-121684061 AGGAAGAAACAAAAGAAGAAAGG - Intergenic
1197066964 X:122245183-122245205 ATGAGTCAACAACTGTAGAAGGG + Intergenic
1197081013 X:122416725-122416747 ATGAATAAAATAATTGAAAAAGG - Intergenic
1197084769 X:122458909-122458931 ATGAAGACACAAATAAAGAAAGG + Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198226880 X:134653335-134653357 GTTAAAAACCAAATGGAGAAGGG - Intronic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198705324 X:139442776-139442798 ATATATAAGCAAATAGAGAATGG + Intergenic
1198755692 X:139979724-139979746 AAGAAAAAAGAAAAGGAGAAAGG + Intergenic
1198915752 X:141669765-141669787 ATGAAAAAAAAAATGTAAAAAGG + Intronic
1199321020 X:146439426-146439448 ATAAATAAAAAAATGTAGATAGG + Intergenic
1199431390 X:147764292-147764314 ATTAATAAAAAAGAGGAGAATGG - Intergenic
1199502194 X:148519196-148519218 GCCAATAACCAAATGGAGAAGGG - Intronic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200425389 Y:3014742-3014764 ATGAATAAGCAAATGAACAGAGG - Intergenic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201372030 Y:13276268-13276290 ATAAATAAATAAGTAGAGAAAGG + Intronic
1201426267 Y:13855048-13855070 ATTAATTAACAAAAGGAAAATGG - Intergenic
1201430728 Y:13899476-13899498 ATGAATAAATAAGTGAACAAAGG - Intergenic
1201525284 Y:14926289-14926311 ATGAATAAACGAAGAGAAAAAGG + Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic
1201701460 Y:16886852-16886874 TTGAGTAAAGAAATGGAGGAAGG - Intergenic