ID: 960623710

View in Genome Browser
Species Human (GRCh38)
Location 3:119660344-119660366
Sequence AGGTGGAAGCAGGATGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 641}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960623710_960623715 8 Left 960623710 3:119660344-119660366 CCTTCCACATCCTGCTTCCACCT 0: 1
1: 0
2: 1
3: 72
4: 641
Right 960623715 3:119660375-119660397 CTGAACCCTGCAAGAGAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 257
960623710_960623718 27 Left 960623710 3:119660344-119660366 CCTTCCACATCCTGCTTCCACCT 0: 1
1: 0
2: 1
3: 72
4: 641
Right 960623718 3:119660394-119660416 CTGGCCCACTCTGCTGCTGTTGG 0: 1
1: 0
2: 2
3: 31
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960623710 Original CRISPR AGGTGGAAGCAGGATGTGGA AGG (reversed) Exonic
900585711 1:3431330-3431352 GGCTGGAAGCAGAGTGTGGAGGG + Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900862861 1:5245492-5245514 AGGAGGGAGTGGGATGTGGAGGG + Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901171255 1:7259272-7259294 AAGTGCAAGGAGGACGTGGAAGG - Intronic
901277557 1:8004495-8004517 AGGAGAAAGCAGGATGACGATGG - Intronic
902197100 1:14805825-14805847 AGGTGGGAGCTGGATCTGGGGGG + Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
903879167 1:26497108-26497130 AGGATGAGGAAGGATGTGGAAGG - Intergenic
904060472 1:27706065-27706087 AGGTCTGAGCAGGTTGTGGAAGG - Intergenic
904263306 1:29303654-29303676 AGGTGGAACCGAGATTTGGAGGG + Intronic
904291448 1:29488561-29488583 AGGTGGAACCAAGATTCGGAGGG - Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904889068 1:33764364-33764386 GGGTGGTAGCAGGATGGGGGAGG - Intronic
905390373 1:37632527-37632549 TGATTGAAGCTGGATGTGGAGGG + Intronic
905479228 1:38249814-38249836 AGGTGGCTGCAGGATGTCGATGG + Intergenic
905641489 1:39593006-39593028 AGGTATGAGCAGGATGTGGCTGG - Intergenic
905858695 1:41331630-41331652 GGGTGGAAGTGGGTTGTGGAGGG - Intergenic
906065259 1:42975929-42975951 GGGTGGAAGAAGGGTGTGGAAGG + Intergenic
906067844 1:42994959-42994981 GGTTGGAAGAAAGATGTGGAAGG + Intergenic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906270095 1:44470781-44470803 AGGAGGATGCAGGAAGAGGACGG - Intronic
906722139 1:48015942-48015964 GGGTGGAGAAAGGATGTGGAGGG + Intergenic
907359747 1:53904894-53904916 AGGTGGAAGGAGGAAGAGGAGGG + Intronic
907389985 1:54151839-54151861 AGGTTGATGGAGGATGTGGAAGG + Intronic
907450818 1:54544681-54544703 AGCTATAAGCAGGTTGTGGAGGG + Intronic
907457642 1:54585699-54585721 TGGTGGCAGCAGGGTGTGGTGGG + Intronic
908195484 1:61742699-61742721 GGGTGGGAGCCGGAGGTGGAGGG + Intronic
912050790 1:105525857-105525879 AAGTTGAATGAGGATGTGGAGGG + Intergenic
912141261 1:106731097-106731119 TGGTGGAGGAAGGAGGTGGAGGG + Intergenic
912262717 1:108124890-108124912 AGTAGGAATCAGGACGTGGAAGG - Intergenic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
913711661 1:121490284-121490306 AGGTGGCAGCAGGAATTGCAAGG + Intergenic
915267458 1:154729158-154729180 GGGAGGAAGCAGGATGGGAAAGG + Intronic
915447337 1:155981450-155981472 AGGTGGAAGGAAGATGTAGCAGG + Intronic
915603689 1:156937972-156937994 AGCTGGAGGAAGGACGTGGAGGG + Intronic
915665853 1:157444338-157444360 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
916052990 1:161049095-161049117 GAGAGGCAGCAGGATGTGGAAGG - Exonic
916622964 1:166521253-166521275 AGGTGCAAGCAGGAAGAAGATGG - Intergenic
916754662 1:167757536-167757558 TGGAGGAGGCAGGATGTGAAAGG - Intronic
917117214 1:171614676-171614698 AGCTGGAAAGGGGATGTGGATGG + Intergenic
917538526 1:175892011-175892033 AGGTGGAAGCTGGATGAGCTGGG - Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
917869717 1:179230003-179230025 AGGTGGAGGTGGGATGGGGAAGG - Intergenic
918448344 1:184635832-184635854 AGGTGGAAGCAGGCACTGGTTGG + Intergenic
918496962 1:185150948-185150970 AAATGGAAGAAGGAAGTGGAAGG + Intronic
918990909 1:191696130-191696152 AGGTAGAAGCAAGATGGAGATGG - Intergenic
919806643 1:201384585-201384607 AGATGGAACAAGGATGGGGAAGG - Intronic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
921034884 1:211367497-211367519 AGGTGGAAGCAAGATGCTGGAGG + Intronic
921221916 1:212979546-212979568 AGCTGGAGGGAGGAGGTGGATGG - Intronic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
1062943825 10:1444910-1444932 AGATGGAAGGAGAATGTAGACGG - Intronic
1063401098 10:5746694-5746716 AGGTGGATACAGGATGTCTAAGG - Exonic
1063433703 10:6013596-6013618 AGCTGGAAGCTGTGTGTGGAGGG - Intronic
1064205362 10:13319441-13319463 AGGTGGCAGCAAGTTGTTGATGG - Intronic
1065104815 10:22372404-22372426 AGCTGGAAGCATGATGGGCAAGG + Intronic
1065167647 10:22996722-22996744 AGGTGTAAGCAGGCTGTGACTGG - Intronic
1066266803 10:33783765-33783787 AGATGGGTTCAGGATGTGGAAGG + Intergenic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1069531086 10:69220160-69220182 AGGGGGAAGCAGGGTATTGATGG - Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070234742 10:74611647-74611669 AGGGGGAGGCAGGAAGTGGGTGG - Intronic
1070718249 10:78738344-78738366 AGGAGGATGCATGTTGTGGAAGG + Intergenic
1070826875 10:79395990-79396012 AAGTGGGAGTAGGATGGGGAAGG - Intronic
1071571609 10:86700344-86700366 TGGTTGCAGCAGGGTGTGGAAGG - Intronic
1072434250 10:95400994-95401016 AGGTGTAAGCAGGAAGTTGGGGG + Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074180616 10:111059696-111059718 TGGTGGATGAGGGATGTGGAGGG - Intergenic
1074189333 10:111122450-111122472 AGGTGGAGGGAGGCTCTGGAGGG + Intergenic
1074822791 10:117194041-117194063 GGGTGGGAGCAGGATGTGCAAGG + Intergenic
1075092277 10:119450552-119450574 CCCTGGAAGCAGCATGTGGAAGG + Intronic
1075819906 10:125298030-125298052 AGGTGGGAGGGGCATGTGGAAGG + Intergenic
1076146522 10:128126408-128126430 GGCTGGAAGAAGGAAGTGGAGGG - Intergenic
1076733601 10:132449485-132449507 AGGTGGAGGAAGGAGGTGGAAGG + Intergenic
1077119207 11:899117-899139 AAGTGGAAGCAGCCTGTGGCAGG - Intronic
1077119214 11:899159-899181 AAGTGGAAGCAGCCTGTGGCAGG - Intronic
1077240183 11:1506708-1506730 AGGGGACAGCAGCATGTGGAAGG + Intergenic
1077475929 11:2790477-2790499 AGCTGGATGCTGGGTGTGGATGG - Intronic
1078153461 11:8778408-8778430 AGGGGGAGGGTGGATGTGGACGG - Intronic
1079003221 11:16774745-16774767 AGGTTGGAGCAGGGTGAGGAAGG - Intergenic
1079081135 11:17414476-17414498 GGAGGGAGGCAGGATGTGGAGGG - Intronic
1079328638 11:19515777-19515799 AGGTGGAAGCAGGGTGGGGTGGG + Intronic
1079360512 11:19766785-19766807 GGGTGGGAGAAGGAGGTGGAAGG - Intronic
1079587035 11:22138621-22138643 GGGTGGATGCAGCATGTTGAAGG + Intergenic
1080058323 11:27930801-27930823 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1080704805 11:34680431-34680453 AGGTGAAGGCAGCATGTGGGAGG - Intergenic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1081733737 11:45389365-45389387 GGGTGTAAACAGGAGGTGGAGGG + Intergenic
1081842095 11:46209917-46209939 AGGGGAAAGCAGCATTTGGAAGG + Intergenic
1081981291 11:47268965-47268987 TGGTGGAGGCAGGATGGGCAGGG - Intronic
1082066656 11:47906277-47906299 AGGTGGCAGCAGGCTGGGCATGG + Intergenic
1082892404 11:58154101-58154123 AGGAGGAAGGAGGAGGGGGAAGG + Intronic
1083678361 11:64340337-64340359 AGGTGGCAGCGGGTTGGGGAGGG + Intronic
1083722143 11:64608719-64608741 AGGAGGAGGCAGGATGCGCAGGG - Intronic
1084005040 11:66318010-66318032 GGCTGCACGCAGGATGTGGAAGG + Intergenic
1084106267 11:66982829-66982851 ATGTGCAAGCAGTATGTGCAAGG - Intergenic
1084114507 11:67033991-67034013 AGGTGGCTGCAGGCTGTGCAGGG - Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084434406 11:69130514-69130536 AGGTGGAATCTGCATGTGCAGGG + Intergenic
1084461850 11:69300601-69300623 AGGAGGGAGTAGGGTGTGGAAGG + Intronic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084709234 11:70833833-70833855 AGGTGGCTGCAGGCAGTGGAAGG + Intronic
1085127081 11:74009035-74009057 AGGTGGCAGCAGGGATTGGATGG + Exonic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1086423907 11:86665276-86665298 GGGGGAAAGCAGGATGTGTAGGG + Intronic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1089084216 11:115803169-115803191 AGGAGAAGGAAGGATGTGGATGG - Intergenic
1089696395 11:120218738-120218760 GGCTGGAAGCAGGGTGTGGAGGG + Intronic
1091060244 11:132454366-132454388 TGGTGGAAGCCTGATTTGGAAGG + Intronic
1091121351 11:133060546-133060568 AGGTGCAGGCAGGGTGTGGAGGG + Intronic
1092001816 12:5038992-5039014 AGATGGAAGCAGGAGGGGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093510064 12:19916375-19916397 AGGTGGAAGAAGGATGTGTTTGG - Intergenic
1093769726 12:23004368-23004390 GTGTGGGAGAAGGATGTGGAGGG + Intergenic
1093870413 12:24284393-24284415 AGGTGTAAGGAGAATGTGGGAGG + Intergenic
1094739813 12:33275630-33275652 AGGTGGAGATAGAATGTGGAAGG - Intergenic
1096259506 12:50081976-50081998 TGGTGGCAGCAGAATGTAGATGG - Exonic
1096573722 12:52539987-52540009 AGGTGGAACTGGGGTGTGGAGGG - Intergenic
1096658907 12:53110029-53110051 AGGTTTAAGCAAGTTGTGGAAGG - Intronic
1096771512 12:53938768-53938790 AGGTGGAAGCACTAGGAGGAGGG + Exonic
1096809336 12:54159631-54159653 AGGTCTAAGTAGGATGTGGGAGG + Intergenic
1098005277 12:65990044-65990066 AGGAGGAAGCAGGGAGTTGAGGG + Intergenic
1098416558 12:70241931-70241953 AGGAGAAAGCAGGAAGAGGAAGG + Intergenic
1098438132 12:70490451-70490473 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1098603973 12:72367423-72367445 AGCTGGAAGGAGGAAGGGGAAGG - Intronic
1099640776 12:85280604-85280626 AGGTGGAGGAAGGTAGTGGAAGG + Intronic
1101124324 12:101615349-101615371 AGGAGGAAGAGGGATGAGGAAGG - Intronic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1102150672 12:110687648-110687670 GGGTGGAAGTAGGGGGTGGAGGG + Intronic
1102913053 12:116733103-116733125 AGAAGAAGGCAGGATGTGGAGGG + Intronic
1103780112 12:123392845-123392867 AGGAGGAAGAAAGATCTGGATGG + Intronic
1105778427 13:23684023-23684045 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1106234906 13:27853474-27853496 AGATGAAAGGAGGGTGTGGACGG - Intergenic
1106241292 13:27915761-27915783 TGGTGGGAGGAGGAGGTGGAAGG + Intergenic
1107421786 13:40254243-40254265 AGGTGGCAGAAGGAGGAGGAAGG - Intergenic
1107866837 13:44711201-44711223 AGGTGGGAGCTGGCTGTGGTTGG + Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1109811054 13:67512964-67512986 TGGTGGATTCAGGCTGTGGAAGG - Intergenic
1110218947 13:73052554-73052576 AAGTGGAAGGAGGGTGGGGATGG - Intergenic
1110504297 13:76267558-76267580 AGGTGGAAGCAGGAAGAGCAAGG - Intergenic
1110526242 13:76541453-76541475 AGGTGAAAGGAGGAAGTGGAGGG + Intergenic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1110802742 13:79718643-79718665 GGGTGGAAGGAGGGTGAGGATGG - Intergenic
1111705860 13:91748773-91748795 AGGTTTAAGCAGGATCTTGAAGG + Intronic
1112943590 13:104896649-104896671 AGCTGCAAGCATGAGGTGGAAGG + Intergenic
1113081341 13:106523480-106523502 AGGAGGAAGGAGGATGTGCTGGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113329591 13:109315543-109315565 AAGTTGAATAAGGATGTGGAGGG - Intergenic
1113431118 13:110251226-110251248 GGGTGGCACCAGGGTGTGGAAGG - Intronic
1113664582 13:112132309-112132331 TTGTGGAAGCATGAAGTGGAGGG + Intergenic
1113815185 13:113164692-113164714 AGAAGGAAGGAGGATGTGGACGG - Intronic
1114256520 14:21007019-21007041 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1114407632 14:22471630-22471652 ATGTGGAAGAGGGATGTTGAGGG + Intergenic
1114558016 14:23572812-23572834 AGGTGGTAGGGGGTTGTGGAAGG - Intronic
1114937345 14:27557251-27557273 GGGTGGAAGGAGGGTGAGGATGG + Intergenic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1116282976 14:42932017-42932039 AGGTGTAATCAGGATGTGATAGG - Intergenic
1116435082 14:44887339-44887361 GTGTGGACGCAGGGTGTGGATGG + Intergenic
1117024691 14:51607614-51607636 GGCTGGCAGCAGGAAGTGGATGG + Intronic
1118247792 14:64128249-64128271 AGCTGGAGGGAGGATGTAGAGGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118838514 14:69493942-69493964 AGGGGGAAGCAGCATATGCAGGG + Intronic
1118890466 14:69904062-69904084 AGGTGAAACCAGCAGGTGGATGG + Intronic
1119557651 14:75566057-75566079 AGGAGGAGGCAGGATGGGGGTGG - Intergenic
1120309459 14:82811186-82811208 ATGTAGAAGGAGGATATGGAGGG - Intergenic
1120381755 14:83789496-83789518 AGGTGGGAGCACAATGTGAATGG + Intergenic
1120858276 14:89231818-89231840 AGATGGAAGCAGGTGGTGGCGGG + Intronic
1121317088 14:92968697-92968719 AGGTGGGAGCAGGAATTGGGTGG + Intronic
1122117729 14:99536074-99536096 AGGTGGATGAGGGATCTGGAAGG + Exonic
1122129651 14:99597662-99597684 AGGTGGACCCAGGATGTGTGTGG - Intronic
1122214529 14:100194079-100194101 AGGTGGAAGCAGGGCTTTGAAGG - Intergenic
1122386671 14:101353077-101353099 AGGTGGGAGCATGAGGTGGGAGG - Intergenic
1122797226 14:104212163-104212185 AGAAGGGTGCAGGATGTGGAAGG + Intergenic
1122842160 14:104471254-104471276 GGGTGGATGCAGGAAGAGGAGGG + Intergenic
1123429421 15:20202272-20202294 AGGTGCAAGCAGGATTAGGGGGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1123976208 15:25556743-25556765 GCCTGGAAGAAGGATGTGGATGG + Intergenic
1124039934 15:26092425-26092447 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1124092789 15:26622179-26622201 AGGTCCAAGCAGGATATGGGAGG + Intronic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124529185 15:30488597-30488619 AGGGGGAAGAAGGAAATGGAGGG - Intergenic
1124769477 15:32519096-32519118 AGGGGGAAGAAGGAAATGGAGGG + Intergenic
1125878585 15:43171418-43171440 AGGTCTAAGCAAGTTGTGGAAGG - Intronic
1125918752 15:43511761-43511783 GGGTGGAAGCAAGCTGTGGAGGG + Intronic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126864397 15:52921414-52921436 AGGTGGCAGCTAGATGTGGAGGG + Intergenic
1127501864 15:59561225-59561247 AGGAGGATGTAGGATATGGATGG + Intergenic
1128133122 15:65243907-65243929 AGGGGAAGGCAGCATGTGGAAGG - Intronic
1128222398 15:65978621-65978643 AGGTTGGATCAGGATGTGGTGGG - Intronic
1129049892 15:72772317-72772339 AGCTGTAAGCAGGGTGTGGAAGG - Intronic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1129481774 15:75832311-75832333 AGAAGGAAGCAGGAAGTGGTCGG + Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1130023045 15:80247243-80247265 AGGTGGTGGGAGGATGGGGAAGG - Intergenic
1131612277 15:93977719-93977741 AGGAGGAAGCAGTAGGTTGAAGG - Intergenic
1131623221 15:94089464-94089486 GGATGGAAGCAGGATGGGGCAGG + Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1132758205 16:1496203-1496225 AGGTCGGGGCAGCATGTGGAGGG - Intronic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132871677 16:2118217-2118239 AGGTGGGGGCAGGAGGTGGCGGG + Exonic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133976420 16:10602388-10602410 AGGTGGAGGTGGGAGGTGGAGGG - Intergenic
1134241828 16:12512275-12512297 AGGTGGGAGCTGGATGGTGAGGG + Intronic
1134894963 16:17877478-17877500 AAGTGCACGCAGGATGGGGAGGG - Intergenic
1135848116 16:25937624-25937646 AGGTGGAAGCTGGATTATGATGG + Intronic
1136171002 16:28489414-28489436 AGATGGCTGCAGGATGAGGAGGG - Intronic
1136360959 16:29779478-29779500 AGGGGCAAGCAGGAGTTGGAGGG - Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1137720406 16:50624539-50624561 AATTGGAAACAGGAAGTGGAGGG - Intronic
1137921963 16:52498762-52498784 ACGGGGAAGCAGGATATGCACGG - Intronic
1138246560 16:55470985-55471007 AGGTCACAGCAGGGTGTGGAGGG + Intronic
1138557263 16:57779166-57779188 AGGTGGAAGCAGCCCATGGATGG + Intronic
1138878733 16:60984609-60984631 AGGTGGAAGAAATTTGTGGAGGG + Intergenic
1139099112 16:63744221-63744243 AGGTGGTGGGAGGATGTGGGTGG - Intergenic
1139708991 16:68761872-68761894 AGGGGGTGGCAGCATGTGGAGGG + Intronic
1139905451 16:70362552-70362574 GGGTGGGAGAAGGATGTGGAAGG - Intronic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946317 16:70644861-70644883 AGGAGGAAGTAGGAAGAGGAAGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140847575 16:78905031-78905053 AGCTGAAAGCATGAAGTGGAAGG - Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141167281 16:81669078-81669100 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167311 16:81669216-81669238 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167321 16:81669264-81669286 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167364 16:81669447-81669469 AGGTGAGAGGTGGATGTGGAAGG - Intronic
1141167374 16:81669492-81669514 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141287058 16:82682263-82682285 AGATGGAATCAGCATGTTGATGG - Intronic
1141690437 16:85593534-85593556 ACGTGGAAGCAGGAAGGAGAAGG - Intergenic
1141784576 16:86190524-86190546 AGGTGGGTGCAGGATTTGCAGGG - Intergenic
1141840622 16:86571966-86571988 AGGTGGAAGGAGGTTGAGGATGG + Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1142099650 16:88264570-88264592 AGGGGGGAGGAGGATGTGGGAGG - Intergenic
1142411135 16:89917848-89917870 GGGTGGAAGCGGGAGGGGGATGG - Intronic
1142966281 17:3583770-3583792 GGGTGGCAGCGGGATGTGTATGG - Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143177771 17:4966512-4966534 AGGAGGAAGCATGATGGGAATGG - Intronic
1143720762 17:8807490-8807512 AGGAGGGTGGAGGATGTGGAAGG + Intronic
1143779176 17:9220508-9220530 AGAGCCAAGCAGGATGTGGAGGG - Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1143871315 17:9959030-9959052 AGGTGGGAGGGGCATGTGGATGG + Intronic
1144630441 17:16869424-16869446 AGGTGGGAGCTGGCTGTGCACGG - Intergenic
1145060263 17:19728767-19728789 AGCTGTGAGCAGGAGGTGGAAGG - Intergenic
1146639066 17:34526482-34526504 AGGTGGAAGCAGCAAGTGTGGGG + Intergenic
1147162056 17:38574056-38574078 TGGGGGAAGCAGGGTGTGTAAGG + Intronic
1147192513 17:38746388-38746410 AGGTGGGGGGTGGATGTGGATGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147488289 17:40840185-40840207 AGGTGGAAAGAGGATATGGAAGG - Intergenic
1148451906 17:47784061-47784083 AGATGGAAGAAGGATGTGTTGGG - Intergenic
1148870692 17:50657331-50657353 ACCTGGAAGCAGGCTGAGGAGGG + Intronic
1149476907 17:56969754-56969776 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151345742 17:73500275-73500297 AGATGGAAGGAGGATGGAGAAGG - Intronic
1151347310 17:73510024-73510046 AGGTGGTAGCTGGCTGTGGCTGG + Intronic
1151499835 17:74481593-74481615 GGGTGGAGGCAGGAAGGGGAAGG + Intronic
1151542430 17:74771414-74771436 AGGTGGGAGCTGGAGGTGCAGGG - Exonic
1151658263 17:75505752-75505774 AAGTGGTACCAGGATGTGGAGGG - Intronic
1151825000 17:76519238-76519260 AGGTGGAGGAAGGATGTGGGGGG - Intergenic
1151852195 17:76697656-76697678 AGGTGGAGGCGGGAGGGGGAAGG + Intronic
1152110973 17:78357715-78357737 AGGGGGAAGCAACATTTGGAGGG - Exonic
1152811847 17:82386107-82386129 AGGCGGAGGCAGGATGGGGGAGG - Intergenic
1153902412 18:9629472-9629494 AGATGCATGTAGGATGTGGAGGG - Intergenic
1154361790 18:13669133-13669155 AGGTGGTAGCAGGAAGTAGTTGG - Intronic
1154489358 18:14907762-14907784 AGGGGGAAGCCAGATCTGGAAGG - Intergenic
1155227067 18:23738075-23738097 AGATGGAAGTAGAGTGTGGAGGG + Intronic
1155248741 18:23935961-23935983 AGCTGGAGGCAGGATGTGGCTGG + Intronic
1156359308 18:36370178-36370200 TGGTGGAAGCAGGCTGAGGTGGG - Intronic
1156493970 18:37513696-37513718 AGCTGGAACCAGGATGAGCATGG - Intronic
1157213032 18:45760128-45760150 AGTTGGAGGCAGGAAGTGGTGGG - Intergenic
1157330025 18:46696949-46696971 AGGTGGGTGGAGGATGGGGAGGG + Intronic
1157569405 18:48702562-48702584 AGGTGGAGGCAGGATGTGTGGGG + Intronic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158545040 18:58389042-58389064 ATGTAAAAGCAGGATGTGAAAGG - Intronic
1159360830 18:67400425-67400447 AGGTAGCAGCAGGATGATGAGGG - Intergenic
1160178648 18:76615901-76615923 AGGTGGAAGGGGGATGGGAAGGG + Intergenic
1160322057 18:77905511-77905533 AGGTGGAAGGTGGAAGGGGAGGG + Intergenic
1160785966 19:900446-900468 ATGTGGGGGCAGGATCTGGATGG - Intronic
1161606403 19:5217100-5217122 AGGAGGATGCAGGATGGTGAAGG + Intronic
1161794729 19:6380134-6380156 GGGAGCAAGCAGGATGTCGAAGG + Exonic
1161914103 19:7216030-7216052 AGATGGAAGCAGGCTGGGCACGG + Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162926863 19:13935162-13935184 AGGTGGAGACAGTATGTGCAGGG - Intronic
1163440376 19:17319759-17319781 GTGTGGACGCAGGGTGTGGATGG - Exonic
1163511106 19:17735575-17735597 AGGTGGAAGTGGGAGGTGGCTGG - Intergenic
1163639251 19:18452054-18452076 AGGTCACAGCAGGATCTGGAGGG + Intronic
1163721345 19:18899595-18899617 AGGTGGATGCCGGGTGGGGAGGG + Exonic
1163755017 19:19101454-19101476 AGGTGCACACAGGCTGTGGAGGG + Intronic
1164572616 19:29385276-29385298 AGGGGGTGGCAGGAGGTGGATGG + Intergenic
1164675895 19:30101214-30101236 AGCTGGGACAAGGATGTGGATGG + Intergenic
1165075740 19:33278997-33279019 GGCAGGAGGCAGGATGTGGAAGG + Intergenic
1165081624 19:33310240-33310262 GGGAAGAAGCAGGATGTGAATGG - Intergenic
1165081632 19:33310277-33310299 GGCTGGAAGCAGGATGTGCATGG - Intergenic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165117697 19:33538844-33538866 AGGTGGAGCCAGGATGTGGCAGG - Intergenic
1166010131 19:39935471-39935493 GTCTGGAAGCAGGATGTGGGTGG - Intergenic
1166061476 19:40328374-40328396 AGGTGGTAGGAGGAGCTGGAGGG - Intronic
1166338547 19:42123135-42123157 AGGTGGGAGTAAGATGTGGATGG - Intronic
1166379962 19:42350693-42350715 AAGAGGAAGCAGGGTGTCGAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167777146 19:51565709-51565731 GGGAGGAGGCAGGATGAGGAAGG - Intergenic
1168113866 19:54209888-54209910 AGGTGGAAGCAGGCAGAGTATGG - Intronic
1168294264 19:55370879-55370901 AGGTGGAGGCAGGAGGAAGAGGG + Intergenic
1168369569 19:55820957-55820979 ATCTGGAACCTGGATGTGGAAGG + Intronic
1168397364 19:56059995-56060017 AGGTGAAGACAGGATGAGGAAGG + Intronic
927191414 2:20519585-20519607 AGCAGGAAGCGGGATGAGGAGGG - Intergenic
927247408 2:20968590-20968612 AGGTTGGAGCTGGATGAGGAAGG - Intergenic
928077545 2:28278936-28278958 AGGCGGAAGCCAGATGTGAATGG + Intronic
928103323 2:28452202-28452224 GGCCGGAAGCAGGAGGTGGAAGG - Intergenic
928118216 2:28563336-28563358 AGGAGAGAGCAGGAAGTGGAGGG + Intronic
928236176 2:29543187-29543209 AGGTGGCAGCAGATTATGGAAGG + Intronic
928268836 2:29836094-29836116 TGCAGGAAGCAGGATGGGGAAGG - Intronic
928531904 2:32201002-32201024 AAGTGAAAGCAGCATGTGCAGGG - Intronic
929307303 2:40378207-40378229 AGGGGGAAACAGTATATGGAAGG + Intronic
929584229 2:43103605-43103627 AGGTGGAAGGAGGAAGGGAAGGG + Intergenic
929687130 2:44044654-44044676 AGGTGGGAGGAGGGTGTGGCTGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929956115 2:46460047-46460069 AGGTGGAAGGAGGGGGAGGAGGG - Intronic
929956179 2:46460361-46460383 AGGTGGCAGCAGCAGGGGGAGGG + Intronic
930231905 2:48851848-48851870 AGGTGGAAGAGGGAAATGGAAGG - Intergenic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
931671718 2:64653832-64653854 AGGAGGAAGCAGGAGGCGGGCGG + Exonic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
932104223 2:68928129-68928151 AGGTGTACACAGGATGTGGTTGG + Intergenic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932593593 2:73081071-73081093 AGGTGGGAGCAGCGTGTGGCTGG - Intronic
934562466 2:95320410-95320432 AGGAGGAGGCAGGGTGTGGTGGG + Intronic
934934497 2:98454764-98454786 GGGTGGGAGGAGGAAGTGGAGGG + Intronic
936379385 2:111970685-111970707 AGGTGGAAGGAGGAGGAGGGAGG - Intronic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
937024052 2:118682774-118682796 AGGTGAATGCAGGGTGGGGAAGG - Intergenic
937098722 2:119252367-119252389 AGGGGGTGGCAGGGTGTGGAAGG - Intronic
937214916 2:120306389-120306411 AGGTGGCAGCAGGTGGAGGACGG - Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
938935258 2:136121916-136121938 AGGTGCCAGGAGGAGGTGGATGG + Intergenic
939341622 2:140902940-140902962 GGTTGGAAGCTGGATGTAGACGG - Exonic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940261587 2:151785442-151785464 AGAAGGAGGCAGGAGGTGGAGGG + Intergenic
940412995 2:153388077-153388099 AGGTGGAAGCAGGTAGGGGAAGG + Intergenic
940765936 2:157789564-157789586 GGATGGAAGCAGGCTCTGGAAGG - Intronic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
942720246 2:178943479-178943501 AGGAGTAGGCAGGATGAGGATGG - Intronic
944848184 2:203690155-203690177 AGGTGGCAGCAGGAGGCAGAGGG - Intergenic
945808010 2:214513980-214514002 AGATGACAGCAGGATGTTGATGG + Intronic
945976317 2:216273889-216273911 GGGTGGAGGCAGGAGGTGGTGGG + Intronic
946367111 2:219255157-219255179 AGGTGGAAGGATGAGGTAGAAGG - Intronic
946456710 2:219832423-219832445 AGGTGAAAGGTGGATCTGGAGGG - Intergenic
946712150 2:222517453-222517475 AGTTGGAAGGGGGATGTGGTGGG - Intronic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
946904633 2:224404813-224404835 AGGTGGAGGCAGTTTGGGGAAGG - Intergenic
947129165 2:226903982-226904004 AGGTGGAAGAAGGATGGAGTGGG - Intronic
947334506 2:229067737-229067759 AGATGGATGCAGGCTATGGATGG - Intronic
947373837 2:229475329-229475351 AGGTGGAAGCAGGCAGGGCAAGG - Intronic
947542808 2:230990444-230990466 CTCTGGAAGCAGGATGAGGACGG + Intergenic
947985856 2:234446867-234446889 CGGTGGAAGGAGGAGGTGGGAGG - Intergenic
948091854 2:235301952-235301974 AGGAGGGAGGAGGATGAGGAGGG - Intergenic
948091859 2:235301968-235301990 AGGAGGGAGGAGGATGAGGAGGG - Intergenic
948185448 2:236017949-236017971 ACGTGGAAGGAGTTTGTGGATGG + Intronic
948458678 2:238118891-238118913 AGTTGGACGGAGGAGGTGGATGG + Intronic
948458776 2:238119273-238119295 AGTTGGACGGAGGAGGTGGATGG + Intronic
948458785 2:238119314-238119336 AGTTGGATGGAGGAGGTGGATGG + Intronic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
948458804 2:238119393-238119415 AGGTGGATGGAGGAGGTGGATGG + Intronic
948458829 2:238119481-238119503 AGGTGGATGGAGGAGGTGGATGG + Intronic
948458834 2:238119494-238119516 AGGTGGATGGAGGAGGTGGGTGG + Intronic
948458858 2:238119575-238119597 AGGTGGATGGAGGAGGTGGATGG + Intronic
948790070 2:240372442-240372464 AGGTGGGAGAGGGATGTGGGAGG + Intergenic
948895885 2:240926613-240926635 AGGTGGAGGCAGGAGCCGGAGGG + Intronic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1169075317 20:2756472-2756494 AGGAGGCAACAGGATGTGGGTGG + Intronic
1169178616 20:3542542-3542564 AGGTGGAAGGGGGAAGGGGAAGG - Intronic
1169208387 20:3752545-3752567 AGGAGGAAGGAGGTTGTGCAGGG + Exonic
1170269642 20:14510920-14510942 AGGTGGATGCAGGGAGTGGGTGG + Intronic
1170434840 20:16315666-16315688 AGCAGGAAGCAGGATGGGGCTGG + Intronic
1172595501 20:36148520-36148542 AGGTGAGACCAGGCTGTGGAAGG + Intronic
1172693725 20:36807667-36807689 AGGTGGTATTAGGATGTGGCAGG - Intronic
1173167878 20:40698762-40698784 GGAAGGAAGGAGGATGTGGAAGG + Intergenic
1174509589 20:51041026-51041048 TGGGGGAAGGAGGAAGTGGAGGG - Intergenic
1174707054 20:52667691-52667713 AAGTGGAAGAAGGATGGGAAAGG - Intergenic
1174713649 20:52733469-52733491 AGGTAGTAGTAGGATGTTGAGGG + Intergenic
1175178087 20:57125737-57125759 AGGTGGACAGAGGATGCGGATGG - Intergenic
1175291948 20:57881863-57881885 AGGTGGAAGCAGGGTCTGCATGG - Intergenic
1175372222 20:58499695-58499717 GGGTGGAAGCAGGGTGTGAAGGG - Intronic
1175387407 20:58606064-58606086 GCCTGGAAGCAGGATGTGGCAGG - Intergenic
1176377729 21:6094775-6094797 AGTTGGAAACAGGCTGGGGAGGG - Intergenic
1176379779 21:6106431-6106453 AGGTTGCAGATGGATGTGGACGG + Intergenic
1176980783 21:15378508-15378530 AGGGGTCATCAGGATGTGGATGG + Intergenic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1178011488 21:28291441-28291463 AGCTGGCAGAAGAATGTGGAAGG - Intergenic
1178235677 21:30838385-30838407 AGGTTGAAGCAGAAAGTGTAGGG - Intergenic
1179123012 21:38566324-38566346 TGGGGGAAGCAGGAATTGGAGGG - Intronic
1179219026 21:39390138-39390160 AGGTGGGAGTAGGATGTTGGAGG + Intronic
1179266212 21:39805745-39805767 AGGTGGGAAATGGATGTGGAGGG + Intergenic
1179305657 21:40151843-40151865 AGGTTGAGGCAGGATTTGGAGGG + Intronic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179743695 21:43431806-43431828 AGGTTGCAGATGGATGTGGACGG - Intergenic
1179745745 21:43443469-43443491 AGTTGGAAACAGGCTGGGGAGGG + Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1179927807 21:44547766-44547788 AGATGCAAGCAGGAAGTGAAGGG - Intronic
1179938272 21:44619099-44619121 AGGTGCAAGCAGGAAGTGAAGGG + Intronic
1180011715 21:45055476-45055498 AGGAGGAGGCGTGATGTGGAGGG + Intergenic
1180393977 22:12312526-12312548 AGGTGTAAGCAGGAGGCAGAAGG - Intergenic
1180405770 22:12552224-12552246 AGGTGTAAGCAGGAGGCAGAAGG + Intergenic
1180754670 22:18152700-18152722 AGGTCTAAGGAGGATGGGGAGGG - Intronic
1180797317 22:18612175-18612197 AGGTGGTACCTGGATGTGGGAGG - Intergenic
1181224405 22:21383097-21383119 AGGTGGTACCTGGATGTGGGAGG + Intergenic
1181254227 22:21551716-21551738 AGGTGGTACCTGGATGTGGGAGG - Intronic
1182468577 22:30533003-30533025 GGATGGAAACAGGATGGGGATGG + Intronic
1182772222 22:32803767-32803789 AGGTGGAATCAGGGTGTGCAGGG + Intronic
1182889736 22:33807424-33807446 AGGTGGGAGCAGGAGGTATATGG - Intronic
1183113570 22:35671324-35671346 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1183404464 22:37623674-37623696 AGGTGGGGGCAGGAGGTGGAGGG - Intronic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184240036 22:43207118-43207140 GGCTGGAAGCAGGAAGAGGAGGG + Intronic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1184851616 22:47124507-47124529 AGGTGGAAGCTCTATGGGGAGGG + Intronic
1184903780 22:47464988-47465010 AGCTGGAAGTGGGGTGTGGAAGG - Intronic
1184946658 22:47808704-47808726 CGGTGGAAGCAATGTGTGGAGGG - Intergenic
949978231 3:9480204-9480226 AGGTAGAATCAGGTTGTGGTTGG - Intergenic
950312393 3:11969999-11970021 AGGTGTCAGAAGGAGGTGGATGG + Intergenic
950472234 3:13193464-13193486 TGGGGGATGAAGGATGTGGACGG + Intergenic
951187063 3:19725641-19725663 AGGTCTAAACAGGTTGTGGAAGG + Intergenic
951217821 3:20040840-20040862 AGGTGGAAGCGGGAGGGGGAGGG - Intronic
951601894 3:24386066-24386088 AGGTGGATGCTGGATTTGGCTGG - Intronic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
952160615 3:30689619-30689641 AGGGGGAACCAGGCTGTGGTGGG + Intronic
952651271 3:35729462-35729484 AAGTGGAAGGAGGATGTAGCTGG - Exonic
953421095 3:42753892-42753914 AGGTGGCTGGAGGATGTGAATGG + Intronic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954049345 3:47960182-47960204 AGATGGCTGCAGCATGTGGAGGG - Intronic
954673719 3:52304260-52304282 AGGTGGAAGCAGGGAGTTGAGGG - Intergenic
954810413 3:53243859-53243881 TGGTGGGAGAAGGATGTGGGTGG + Intronic
955052148 3:55423354-55423376 AGGTGGAAGCAGGTTTAGAATGG - Intergenic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955808404 3:62760585-62760607 AGGAGGAGGCAGGAGGTGGCAGG - Intronic
956204403 3:66740767-66740789 AGGTGGGAGCAGGATATTTAGGG + Intergenic
956573665 3:70726512-70726534 AGGTGGGAGCACTATGGGGAGGG - Intergenic
957123291 3:76124986-76125008 AGGTGGAAGGAGGGGGTGAATGG - Intronic
957282942 3:78177150-78177172 AGGAGAAAGCTGGATCTGGAAGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
959239768 3:103775509-103775531 AGGAAGAAGGAGGATGTAGAAGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960747224 3:120903481-120903503 AGCTGGAAGGAGAATTTGGATGG - Intergenic
961137634 3:124526624-124526646 AGGAGGAGTAAGGATGTGGAGGG + Intronic
962119645 3:132548314-132548336 ATGTGTAAGCAGGCTGTGAAAGG + Intergenic
962315322 3:134355713-134355735 AGTTGGAATGAGGATGTGGCTGG - Intergenic
962452320 3:135530608-135530630 ATGTGGAAGCAGGATTGGAAGGG - Intergenic
963499485 3:146107743-146107765 AGGCTGAGGCAGGAGGTGGAAGG - Intronic
964374432 3:156035591-156035613 AGGAGGAAGCAGGAGGGGGGAGG - Intergenic
964504504 3:157383990-157384012 AGGTAAAAGCTGGATGTGGGGGG + Intronic
965597870 3:170425661-170425683 TGGGGGAAGCAGGACATGGAGGG + Intronic
965616634 3:170600715-170600737 ATGTGGATGCAGGATGTTGGAGG + Intronic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966721381 3:183065694-183065716 AGGTTTAAGCAAGTTGTGGAAGG + Intronic
966728597 3:183131411-183131433 AGTTTGAAGGAGGAGGTGGAAGG + Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967117916 3:186358556-186358578 AGGTGGAAACAAAATGTGGCTGG - Intronic
967426369 3:189332185-189332207 AGTTGGAAGTAGGAAGTGGTGGG - Intergenic
967457395 3:189704069-189704091 AAGTGGAAACAGGATATGTATGG - Intronic
967504597 3:190239329-190239351 AGGTGGAGGCAGGATTAGGTGGG - Intergenic
967921188 3:194615760-194615782 GGGTGGCAGCATGGTGTGGAGGG - Intronic
967978856 3:195053111-195053133 AGGTGGGAGCGGGAGGTGGGAGG - Intergenic
969500989 4:7552812-7552834 GGGAGGAATCAGGGTGTGGAGGG + Intronic
969506462 4:7591232-7591254 AGGAGGCAGCAGCAGGTGGAGGG - Intronic
969922845 4:10557244-10557266 AGGTGGAGGGAGGTTCTGGAGGG - Intronic
970120291 4:12746014-12746036 AGGTGGAAGAAGGATGACGGAGG + Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
971311540 4:25529614-25529636 GGGTGGGAGAAGGATGAGGATGG + Intergenic
971968948 4:33596951-33596973 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
973554473 4:52068538-52068560 AGGAGGAAGCAGGTGGGGGATGG + Intronic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
974894432 4:67921811-67921833 AGGTGGCAGCAGGATTTAGTGGG - Intronic
974895815 4:67937221-67937243 AGTTGGAAGAAAGGTGTGGATGG - Intronic
975560414 4:75703738-75703760 AGCAGGCACCAGGATGTGGATGG + Intronic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
977412301 4:96683560-96683582 AGGTGGGAGGAGGGTGAGGATGG - Intergenic
980969469 4:139555816-139555838 GGGTGGATGCAGGCTGTGGCCGG + Intronic
981488767 4:145317705-145317727 GGATGGAAGCAGGATGGGGCAGG - Intergenic
983431627 4:167658787-167658809 TGGTGGAAGCAGGAAGTGCTAGG - Intergenic
983798664 4:171899902-171899924 AGAGGGAAGTAGGGTGTGGAAGG - Intronic
984441482 4:179776015-179776037 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
984624409 4:181989294-181989316 GGATGGAAGCAGGGTGGGGATGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985188517 4:187345588-187345610 AGATGGATGTAGGATGGGGAAGG - Intergenic
985930253 5:3051538-3051560 AGGTGGCAGCAGGATGTGCAAGG + Intergenic
986286072 5:6360085-6360107 AGGAGGAGGCAGGATGTGGCAGG + Intergenic
986812835 5:11378151-11378173 TGGTGGAAGCAGGAAATGGCTGG + Intronic
987022425 5:13888320-13888342 AGGTGGAAGCATGTTGTAGCTGG - Intronic
987566410 5:19593660-19593682 AGGAGGAAGAAGGAGGTAGAAGG - Intronic
987910167 5:24132486-24132508 AGGTGGGAGAGGGATGGGGAGGG + Intronic
988046777 5:25966524-25966546 AGGTCAAAGCATGTTGTGGAAGG + Intergenic
988535758 5:32066378-32066400 AGGTGGAAGCAGGACTTGGTTGG - Intronic
988608779 5:32705546-32705568 AGGAGGAAGAGGGATGGGGAGGG + Intronic
988834040 5:35014099-35014121 AGGTGCAGACAGGATTTGGAAGG - Exonic
989076977 5:37574089-37574111 GGGTGGAAGCAGGATTGGGTAGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
991046956 5:62232708-62232730 AGGTGCAAGCAGGATTAGGGGGG - Intergenic
991496985 5:67236522-67236544 AGGTGGTAGCCGGATCAGGAAGG + Intergenic
992366497 5:76096581-76096603 AGGTGGCAGAAGTATGTGAAAGG + Intronic
992697115 5:79300805-79300827 AGCTGGAAGCAAGACGTGGACGG + Exonic
992734196 5:79702590-79702612 AGCTGGAAGGGAGATGTGGAAGG + Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993457274 5:88141335-88141357 AGGAGGGGGCAGGAGGTGGAGGG + Intergenic
993939556 5:94042135-94042157 AGGTTTAAGCAAGTTGTGGAAGG + Intronic
995064710 5:107846584-107846606 TGGTGGAAGCAGCAATTGGAAGG + Intergenic
996840709 5:127844675-127844697 GGGACGCAGCAGGATGTGGATGG + Intergenic
997196498 5:131983770-131983792 TGGTGGAAGCAGAATGTATAGGG - Intronic
997696306 5:135863808-135863830 AGGAGGAAGGAGCATGTGGAGGG + Intronic
998187652 5:139994929-139994951 AGATGGAAGGAGGTTGTGAAGGG + Intronic
998227246 5:140336490-140336512 CGCTGGAAGCACGATGGGGAAGG - Intronic
998737183 5:145155531-145155553 AGATGGCAGCAGGCTGAGGATGG - Intergenic
999149502 5:149417363-149417385 AGGAGGAAGAAAGATGGGGAGGG - Intergenic
1000267277 5:159649681-159649703 AGGTGGCAGGAGGATGTGAACGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001655300 5:173344633-173344655 AGGTGCATGGAGGATGGGGAAGG - Intergenic
1001677950 5:173534185-173534207 AGCTGGAAGCAGGAAGTGCTGGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003395135 6:5746587-5746609 AGGTGGCAGCAGGATTTGGCTGG + Intronic
1004031128 6:11870574-11870596 AGGTGAAGGCAGGGTGGGGACGG - Intergenic
1004157550 6:13183624-13183646 AGGAGGAAGGAGGGTGGGGAGGG + Intronic
1004185711 6:13419632-13419654 AGGAGGAAGCAGATCGTGGAGGG - Intronic
1004273070 6:14212030-14212052 AGGTGGGAGCAGGGAGTAGAGGG - Intergenic
1004401703 6:15294645-15294667 AGGTTGATGCAGGACATGGAAGG + Intronic
1005549511 6:26898844-26898866 AGCTGGCAGCAGGATGAGGCTGG - Intergenic
1005932028 6:30491235-30491257 ACCTGGCAGCAGGATGGGGAGGG + Exonic
1006031385 6:31179182-31179204 AGGTGAAGGCAGGGTGTGGTGGG - Intronic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006806669 6:36793569-36793591 AGGTGGGAGCAGGTTGGGGCTGG - Intronic
1007019726 6:38507390-38507412 AGGTGGTAGCTGGGAGTGGAGGG - Intronic
1007341527 6:41194066-41194088 AGGTGAAAGGAGGATCAGGAAGG - Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1008121886 6:47627827-47627849 AGATGGAAACAGAATCTGGAAGG + Intergenic
1008559256 6:52707212-52707234 AGGTTTAAGCAGGTTGTGGAAGG + Intergenic
1008878313 6:56353383-56353405 AGCTGGAAGCTGGAAGTGGTGGG - Intronic
1010037559 6:71343930-71343952 AGGAGGGAGCAGGAAGTGGCAGG + Intergenic
1010563951 6:77385276-77385298 TGGTGGAAGCAGAATGTACAGGG - Intergenic
1011314475 6:86016436-86016458 AGGCTGGTGCAGGATGTGGAAGG + Intergenic
1012707012 6:102544249-102544271 AGGTGGCAGGAGGGTGAGGAGGG + Intergenic
1013189871 6:107793105-107793127 AGGTGGAGGCACAATGTGGTCGG + Intronic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015082209 6:129240550-129240572 AGGTGTGACCAGGATGTTGATGG - Intronic
1016201503 6:141415898-141415920 AGGTGGGAGGATGAGGTGGAAGG - Intergenic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1017322012 6:153105394-153105416 GGGTGGCAGCAGGATGCGGTAGG - Intronic
1018829726 6:167433665-167433687 TGGTGGTGGCAGAATGTGGATGG + Intergenic
1018829862 6:167434279-167434301 TGGTGGTGGCAGAATGTGGATGG + Intergenic
1018990380 6:168669245-168669267 AGGGGGACGCAGGATGTTGTGGG - Intronic
1019069821 6:169335008-169335030 AGGTTTAAGCAAGGTGTGGAAGG - Intergenic
1019389789 7:779600-779622 ATCTGGGAGCAGGAGGTGGAGGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019772411 7:2891835-2891857 AGGAGGAAGAAGGTTCTGGAAGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1021173866 7:17427447-17427469 AGGTGGAAACAGGGTTTGGATGG + Intergenic
1021486681 7:21175627-21175649 AGATGAAGGCAGGATGAGGAGGG + Intergenic
1021996031 7:26179093-26179115 AGGTGGAAGCTGGAGGGGCAAGG - Intronic
1022528724 7:31053807-31053829 GGCTGGACGCAGCATGTGGAGGG + Intronic
1023104965 7:36755115-36755137 AGGTAGAAGCATGTTTTGGAAGG + Intergenic
1023167966 7:37361997-37362019 AGGTGGAAGCAGAGTCTGCAAGG + Intronic
1023877616 7:44295978-44296000 ATGTGACAGCAGGATGTTGAGGG - Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1024116348 7:46197402-46197424 AGGTGGGAGCAGGGACTGGAGGG - Intergenic
1025797172 7:64749338-64749360 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1029414561 7:100434860-100434882 AGGTGTAAACAGGATGGGCAAGG + Intergenic
1030872053 7:114767752-114767774 AGGTGTAATCAGGATGTGATAGG - Intergenic
1030968123 7:116019015-116019037 AGGTAAAGGCTGGATGTGGAAGG + Intronic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1031917837 7:127579650-127579672 AGATGGACGGAGAATGTGGAGGG - Intergenic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033216248 7:139495687-139495709 AGGTGGAACCAGAATCTGGTGGG - Intergenic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035080225 7:156209549-156209571 AGGCGGAAGAAGGAGGTGCAGGG - Intergenic
1035090447 7:156305828-156305850 AGCTTGCAGCAGGATGTGGGTGG - Intergenic
1036643818 8:10600060-10600082 AGAGGGGAGCAGGATGTGGGTGG - Intergenic
1037777963 8:21848137-21848159 AGGTGGAAGCAGGTGTAGGAGGG - Intergenic
1037878128 8:22558905-22558927 AGGTAGAAGCATGTTCTGGACGG + Intronic
1038228140 8:25675498-25675520 AGGTGGGGGCGGGAGGTGGACGG - Intergenic
1038581752 8:28753960-28753982 TGCTTTAAGCAGGATGTGGAAGG + Intronic
1039165168 8:34670923-34670945 TGGGGGAAGCAGGATGTTTAGGG - Intergenic
1039367378 8:36944469-36944491 GGGTGGAAGGAGGATGAGGGTGG + Intergenic
1039842204 8:41302267-41302289 AGATGGAAGCTGGATGTAGATGG - Intronic
1040565609 8:48564424-48564446 TGGTGGAAGAAGGATGTGGTGGG + Intergenic
1040595207 8:48831861-48831883 TGGTGGGAGAAGGATGTGGTGGG + Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041810282 8:61901196-61901218 AGGTTTAAGCAAGATGTGGAAGG - Intergenic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042001180 8:64124922-64124944 AGTTGGAAGGGGGATGTGGTGGG + Intergenic
1042175480 8:66033870-66033892 AGGTGGAAAGAGAATTTGGATGG + Intronic
1042524034 8:69746044-69746066 AGGTGGAAGGAAGAGGAGGAAGG - Intronic
1042866086 8:73357746-73357768 AGGTGGCAGCTGTATGGGGAGGG + Intergenic
1043128251 8:76427776-76427798 ATTAGGAAGCAGGGTGTGGAGGG - Intergenic
1044658919 8:94576741-94576763 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1045074088 8:98543229-98543251 AGCTGGAAGAAGGATGAAGAGGG + Intronic
1045769738 8:105722207-105722229 AGCAGGAAGCAGGGTGGGGAAGG - Intronic
1046103851 8:109644505-109644527 AGGTGGAAGGAGGTGGTGGTGGG - Intronic
1046148265 8:110189835-110189857 AGGTGGCAGCAGGAAGAGCAAGG + Intergenic
1047362790 8:124184378-124184400 AGGTGGAAGAAGAATGAGGTTGG + Intergenic
1047436639 8:124840366-124840388 AGGTGCAAACAGGAAGTGCATGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048331042 8:133471004-133471026 AGGAGGAAGGAGGATGGGAAGGG - Intronic
1048550815 8:135432316-135432338 AGGTGAAAGCATTATGTGGAAGG - Intergenic
1048616088 8:136076893-136076915 AGGTGGAAAGGGGATGGGGAGGG + Intergenic
1048879081 8:138858531-138858553 AGGGGAAAGCTGGATGTGGTGGG - Intronic
1049072721 8:140369275-140369297 AGTTAGAAGCAGGCTCTGGAAGG + Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049427965 8:142545677-142545699 GGGTGGGAGGAGGGTGTGGAAGG - Intergenic
1050626536 9:7510162-7510184 GGATGGAGGGAGGATGTGGACGG + Intergenic
1051147681 9:14045883-14045905 AGGGGGAAGCTGGATGAGAAAGG + Intergenic
1051257748 9:15232350-15232372 AGGTGGAAACGGGAGGTGGGGGG + Intronic
1051504078 9:17808834-17808856 AGGAGGAGGCTGGAGGTGGAGGG + Intergenic
1052074947 9:24130000-24130022 GGGTGGGAGGAGGATGAGGACGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053876653 9:42552417-42552439 TGGTGGGGGCAGGATGTGGGGGG + Intergenic
1054235046 9:62549304-62549326 TGGTGGGGGCAGGATGTGGGGGG - Intergenic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055426826 9:76205226-76205248 AGCTGGAAGCGGGAGGTGGAGGG - Intronic
1056303239 9:85263662-85263684 AGGTGGGAGCAAGATCTAGAAGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056930660 9:90873880-90873902 AGGTGGGAATAGGATGTGCAAGG + Intronic
1057174184 9:92983777-92983799 AGGTTAAAGCAAGTTGTGGAAGG - Intronic
1057226845 9:93297022-93297044 AGGTGAAAGGAGGATGCTGAGGG - Intronic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1058713181 9:107698646-107698668 AGGAGCAGGGAGGATGTGGATGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059589885 9:115647366-115647388 AGGAGGAGGCAGGAAATGGAAGG - Intergenic
1060152594 9:121298432-121298454 AGGTGGGAGCAAGTTGTGGGTGG + Intronic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1060714044 9:125904491-125904513 AGGAGGAAGCATGAAGTGGAAGG - Intronic
1060943397 9:127556211-127556233 AGGAGGAAGGAAGTTGTGGATGG + Intronic
1061033344 9:128100020-128100042 GGGTGGCGGCAGGATGTGCAGGG + Intronic
1061224930 9:129275914-129275936 AGGTGGATGGAGGAGGGGGAGGG - Intergenic
1061374481 9:130215904-130215926 AAGAGGGAGCAGGATGTGGGAGG - Intronic
1062101467 9:134730775-134730797 AGGTGGAAATTGGATGAGGAGGG + Intronic
1062225071 9:135445608-135445630 AGGTGGTTGCAGGAGCTGGAAGG + Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1185642414 X:1596101-1596123 AGGTGTGAACAGCATGTGGAGGG - Intronic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185720871 X:2380410-2380432 ATAAGGAAGCAGGATGTTGAAGG + Intronic
1186470737 X:9820324-9820346 AGCTGGAAGCTGGCTGTGGCTGG - Intronic
1187983990 X:24790550-24790572 AGGAGGGAGCAGGATGTGAGTGG - Intronic
1188182368 X:27072388-27072410 GGGTGGGGGCAGGATGTGGCTGG - Intergenic
1188442554 X:30227589-30227611 AGGTGGGAGTAGGGTGAGGATGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189701605 X:43719318-43719340 GGATGGAAGGTGGATGTGGATGG + Intronic
1190053499 X:47169288-47169310 TGGAGGAAGAAGGATGGGGAGGG - Intronic
1190170290 X:48107099-48107121 AGGCTGAGGCAGGAGGTGGAAGG - Intergenic
1190188202 X:48254463-48254485 AGGCTGAGGCAGGAGGTGGAAGG - Intronic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1190657096 X:52622227-52622249 AGGCTGAGGCAGGAGGTGGAAGG - Intergenic
1190741135 X:53289478-53289500 AGGTGGGATCAGCTTGTGGAGGG - Intronic
1191005710 X:55709462-55709484 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1191177200 X:57516915-57516937 TAGTGGAAGGAGGGTGTGGATGG + Intergenic
1192438335 X:71156252-71156274 ATGTGGAAGTAGGGTGTGCAGGG - Intronic
1193705449 X:84815667-84815689 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1195731281 X:107970355-107970377 GGGAAGAAGCAGGGTGTGGACGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196074330 X:111558368-111558390 AGGTTTAAGCAAGCTGTGGAAGG - Intergenic
1196134649 X:112195108-112195130 AGGTTGAGGCAGAATGTGGATGG + Intergenic
1196591482 X:117490385-117490407 GGGTGGAAGATGAATGTGGAGGG - Intergenic
1196871857 X:120120235-120120257 AGGTGGAAGGAGGAGGAGGCAGG + Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1196978075 X:121181924-121181946 AGCTGGAAGAAGGAAGTGGTGGG + Intergenic
1197243716 X:124146925-124146947 AGGTAGCCACAGGATGTGGATGG + Intronic
1197481226 X:126989020-126989042 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1197918317 X:131560399-131560421 TGGTGAGAGCAGGCTGTGGATGG - Intergenic
1198200099 X:134407898-134407920 AGGTGGAAGTAGAAGGTGAAAGG + Intronic
1198314728 X:135453928-135453950 AGGTTCAAGCAGGCTTTGGAGGG + Intergenic
1198430094 X:136556729-136556751 AGGAGCAAGCAGGGTGTGGATGG - Exonic
1198636723 X:138710369-138710391 AGGTGGAAGCTGGAGGGGAAGGG + Intronic
1198844660 X:140897993-140898015 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1200795838 Y:7340565-7340587 GGGTGGGAGGAGGATGAGGATGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic