ID: 960624512

View in Genome Browser
Species Human (GRCh38)
Location 3:119667804-119667826
Sequence GGTTTAATGGAAACATAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960624512_960624516 8 Left 960624512 3:119667804-119667826 CCTTATTATGTTTCCATTAAACC 0: 1
1: 0
2: 1
3: 12
4: 245
Right 960624516 3:119667835-119667857 AAATAAAACAAACAAAAATTCGG 0: 1
1: 3
2: 82
3: 1970
4: 13335
960624512_960624517 16 Left 960624512 3:119667804-119667826 CCTTATTATGTTTCCATTAAACC 0: 1
1: 0
2: 1
3: 12
4: 245
Right 960624517 3:119667843-119667865 CAAACAAAAATTCGGAATTTAGG 0: 1
1: 0
2: 0
3: 23
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960624512 Original CRISPR GGTTTAATGGAAACATAATA AGG (reversed) Intronic
900249728 1:1661752-1661774 GGTATAAAGGAAATATAATTTGG + Exonic
900260768 1:1727659-1727681 GGTATAAAGGAAATATAATTTGG + Intronic
900429617 1:2595545-2595567 GGTTTAATGGGGACAGAATATGG + Intronic
907021384 1:51069475-51069497 TGTTGAATAGAAAAATAATAGGG - Intergenic
907784780 1:57600766-57600788 GCTTTAATGGAAAAATGAGATGG + Intronic
907999625 1:59667863-59667885 GGTATCATGGAAACATAGTGGGG + Intronic
909295367 1:73940799-73940821 GGTTTAATCTAAATATAATGGGG + Intergenic
909761055 1:79287893-79287915 GTTTTAATGGAAAAATTATATGG + Intergenic
909941035 1:81612036-81612058 GGTTTAATTGACTCATAATTTGG - Intronic
911440724 1:97921950-97921972 GGACTAATGAAAAAATAATAAGG - Intergenic
911960939 1:104301649-104301671 GGTTTAAGGGAAAAGTAAAAGGG + Intergenic
912228170 1:107759904-107759926 GATTTTATGAAAAAATAATAAGG - Intronic
912503386 1:110137375-110137397 CGTTCAATGTAAACAGAATAGGG - Intergenic
913041190 1:115025796-115025818 TGTTTGATGGAAACATAAAATGG - Intergenic
913754669 1:122059986-122060008 AGTTGAATGGAAACATCACAAGG - Intergenic
913756925 1:122086283-122086305 AGTTGAATGGAAACATCACAAGG - Intergenic
918338215 1:183543174-183543196 GGTTTCATGTAAACAGAAAAGGG + Intronic
919037810 1:192338442-192338464 ATTTGAATAGAAACATAATATGG + Intronic
919061255 1:192635615-192635637 GGTCTAATGAATACAGAATATGG - Intergenic
919331610 1:196179362-196179384 GATTTTATGGAAAAAAAATATGG - Intergenic
922661954 1:227437779-227437801 GGTTTAATAGAACCATCAGATGG - Intergenic
922850173 1:228726338-228726360 GGTTTGATGGAAAGGTTATAGGG + Intergenic
923253159 1:232195713-232195735 GGTTGTATGGAAAAAGAATACGG + Intergenic
923676918 1:236088287-236088309 GGATTAATGCCAACATAAAAAGG - Intergenic
1063691487 10:8291733-8291755 GCATTAATGGAAACTTAAAAAGG + Intergenic
1066164129 10:32767227-32767249 AATTTAATGGAAAAGTAATATGG - Intronic
1067430840 10:46243901-46243923 GGTTTTTTGGAAAGATAAAATGG + Intergenic
1069053794 10:63822492-63822514 GGTTTATTGGAAACATTCTGGGG - Intergenic
1069086946 10:64151695-64151717 AGTTTGAAGGAAAGATAATAAGG - Intergenic
1069898063 10:71691019-71691041 GGATTAAATGATACATAATAGGG + Intronic
1071401115 10:85272304-85272326 GGTATAATGAAAACATAAGGAGG + Intergenic
1071838487 10:89444101-89444123 GGTTTTATGGAAACAAAAGCAGG + Intronic
1073032780 10:100540911-100540933 GCTCTAAAAGAAACATAATAGGG + Intronic
1073910983 10:108344065-108344087 TGTTGAATGGAAACACAAAAGGG + Intergenic
1075352422 10:121735607-121735629 GGTATAATGGAGAAATAAAACGG - Intergenic
1076021216 10:127075564-127075586 GGTTTAACGGAAGCATGATTAGG + Intronic
1078310276 11:10233932-10233954 GGATTAATGAAAACAACATAGGG - Intronic
1078636942 11:13060319-13060341 GGTTTGGTGGAAATATAAAATGG + Intergenic
1078921058 11:15831118-15831140 GGTTAAATGGAACCATCACAGGG - Intergenic
1079557283 11:21774901-21774923 GGTTCAATGAAAAAAAAATATGG + Intergenic
1079693335 11:23447187-23447209 GCTTTAATGGAATAAAAATATGG + Intergenic
1079920328 11:26425887-26425909 TGGTTAATGGATACATAATTTGG + Intronic
1079932388 11:26581063-26581085 GGTTTATTTCAAACATAATTTGG - Intronic
1080615924 11:33944810-33944832 GCTTTAATGGAAAGATGACAGGG + Intergenic
1087530090 11:99369701-99369723 TGGATAATGGAAAAATAATAAGG - Intronic
1088366261 11:109043055-109043077 ACTTTAAAAGAAACATAATAAGG - Intergenic
1089276441 11:117339315-117339337 ATTTAAATGGAAACATAGTAGGG + Intronic
1089828902 11:121307161-121307183 TGTGTAATGGAAAGATAAAAGGG - Exonic
1090032058 11:123215595-123215617 GTTTTAAAAGAAATATAATAGGG - Intergenic
1098609503 12:72437564-72437586 ACTTTTATGGAATCATAATATGG + Intronic
1098622491 12:72619929-72619951 GGTTTAAAGTAAAAATAAAAAGG - Intronic
1098664525 12:73144943-73144965 GGTTTACTGGAAAAACATTATGG + Intergenic
1099296075 12:80829517-80829539 TGTTCAATGGAAAAATCATAAGG + Intronic
1099711866 12:86237101-86237123 AGTTTAATATAAACATAATAAGG + Intronic
1099903477 12:88742325-88742347 GTTTTAATGGAAAAATATGAGGG + Intergenic
1100190514 12:92186200-92186222 GGTTAAATGTATAAATAATATGG - Intergenic
1100506142 12:95222171-95222193 GGTTTAATTGGATTATAATAAGG - Intronic
1106069754 13:26398523-26398545 GTTTTAATGGAATTATAATAGGG - Intronic
1106939814 13:34765882-34765904 TGTTCAATAGAAATATAATATGG - Intergenic
1107608149 13:42082953-42082975 GGGATAATGGAAAGCTAATAAGG + Intronic
1107794775 13:44039094-44039116 GGTTTAATGCAATCATATTTTGG - Intergenic
1108802194 13:54112555-54112577 GTATTAATAGAAACATAACAAGG - Intergenic
1109760288 13:66819007-66819029 GGTTTAATTTAAACTTAAAATGG + Intronic
1109962391 13:69647874-69647896 TGCTAAATGTAAACATAATATGG + Intergenic
1110096244 13:71525403-71525425 GGATTAATGAAAACATTATCTGG + Intronic
1110476578 13:75922096-75922118 GGTTTAAAAGAAAAATAATTTGG + Intergenic
1110514842 13:76397811-76397833 GGTAGAATGGAAAAATAGTAGGG + Intergenic
1111595848 13:90409449-90409471 TATTTATGGGAAACATAATATGG - Intergenic
1111739244 13:92181899-92181921 GATTTAAAGGATAGATAATAAGG + Intronic
1111839444 13:93431371-93431393 GATTTTATGGAGACATCATATGG - Intronic
1112082536 13:95989541-95989563 TGTTTAATGGAAACATCAAATGG - Intronic
1112219950 13:97478349-97478371 AGTTTAATTCAAACATAATTGGG - Intergenic
1114168390 14:20245738-20245760 TGTTAAATGGAAAAATTATATGG - Intergenic
1114709686 14:24765944-24765966 TGTTTAATGGAATTAGAATAAGG - Intergenic
1116735861 14:48690661-48690683 GGTTTATTGGAAAGGTGATATGG + Intergenic
1118132338 14:62981095-62981117 GTTTTGAAGGAAACATTATAAGG + Exonic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119580040 14:75770225-75770247 GTTTTTATGGGAGCATAATATGG - Intronic
1119884984 14:78132647-78132669 TGTTTAATGGAAAAGTAATGAGG - Intergenic
1124826355 15:33099729-33099751 GGATTATTGGAAACATAAATGGG - Intronic
1125088347 15:35758986-35759008 GTCTTAATGGAAACAAAGTATGG + Intergenic
1125217765 15:37296414-37296436 GGGATAATGAAAACAGAATAAGG - Intergenic
1127706448 15:61551836-61551858 TGTTTAACTGTAACATAATAGGG + Intergenic
1127874460 15:63099815-63099837 CGTTTAATGCAAACATTAAATGG - Intergenic
1128373029 15:67054609-67054631 TGTCTAATAGAAATATAATAGGG - Intergenic
1131195821 15:90353813-90353835 GGTTTATTGGAAACTTTTTAAGG + Intronic
1134468767 16:14503021-14503043 GGTTTAAATAAAACATAAGACGG + Intronic
1136926097 16:34375890-34375912 AGTATAATGAAAACACAATAGGG + Intergenic
1136978477 16:35035917-35035939 AGTATAATGAAAACACAATAGGG - Intergenic
1137866052 16:51897760-51897782 AGTTTAATGGATAAAGAATACGG - Intergenic
1138214950 16:55196081-55196103 GGATTAATGGATAAATAAAATGG + Intergenic
1138662388 16:58530152-58530174 GGCTTAATAAAAACAAAATAAGG + Intronic
1138797506 16:59987114-59987136 GCTTTAGTGAAAACATAATCAGG + Intergenic
1139090595 16:63642004-63642026 GGTTTAGTGGGAAGTTAATATGG + Intergenic
1139140343 16:64254919-64254941 TGTATACTGGGAACATAATAAGG - Intergenic
1140850193 16:78928129-78928151 GGTTTAATGAAAACCAAACATGG - Intronic
1144008641 17:11124469-11124491 GGTTTAAAGGAAAAATTATTTGG + Intergenic
1145098896 17:20056943-20056965 ATTTCAATGGAAACAGAATAAGG - Intronic
1150660727 17:67074811-67074833 GGTTTAATGTAAACATCAACTGG - Exonic
1153397807 18:4644558-4644580 GGTATAATGTAAACATGATTTGG + Intergenic
1156110301 18:33718252-33718274 GGTCTATGGGATACATAATAAGG - Intronic
1156117668 18:33805755-33805777 GGTTTAATGGTAAGATTAAAAGG + Intergenic
1156816420 18:41316919-41316941 GCTTTTATGGAATCAGAATAGGG - Intergenic
1156860059 18:41825657-41825679 GGTTGGAGAGAAACATAATACGG + Intergenic
1157001509 18:43531623-43531645 GGTTGCATGGAGACATAAGAAGG + Intergenic
1164069905 19:21758052-21758074 GATTTAATAGAAACAAAATATGG + Intronic
1164101633 19:22059693-22059715 GATTTAATAAAAACAAAATATGG - Intronic
1164123868 19:22292414-22292436 GATTTAATGAAAACAAAATATGG - Intronic
1165533050 19:36419739-36419761 GTTTAAATAGAAACACAATAAGG - Intergenic
1166828170 19:45622122-45622144 GGTTTAATGAATAGATGATAAGG - Intronic
1167529607 19:50007110-50007132 GGTTTATTGCTTACATAATAGGG - Intronic
1168624453 19:57906089-57906111 GGTTTTGTGGGAACATAATTGGG + Intronic
928094485 2:28395229-28395251 TGTTGAATGTAAACATAATGAGG + Intronic
930918041 2:56718437-56718459 AGTATAATGTAAAGATAATATGG + Intergenic
930933037 2:56912333-56912355 TGTTTAATAGAAATATAATGAGG - Intergenic
931053409 2:58439680-58439702 GGTTAATTGGAAAAAAAATATGG + Intergenic
931241388 2:60455781-60455803 GGTTTTATGGACATTTAATAGGG + Intronic
932867646 2:75362615-75362637 GGTTAAATGGAGATATGATAGGG - Intergenic
932958612 2:76385960-76385982 GGTTTAATGAAACCATGATTAGG + Intergenic
933467163 2:82667237-82667259 TGTTTAATGGAAAACAAATAAGG - Intergenic
933517097 2:83318386-83318408 GGTGTACTGGAAACAATATAAGG + Intergenic
935440683 2:103091928-103091950 GGTTTTTTGAAAAAATAATAAGG - Intergenic
935958142 2:108399045-108399067 GTTTTAATGGATACAGAATGGGG - Intergenic
936723556 2:115284311-115284333 GGTTTAACAGAAACATGACAAGG - Intronic
939581380 2:143951869-143951891 TGTTTAAAGGAAACATGCTAGGG - Intronic
940215328 2:151297669-151297691 GTTTTAATGGAAAGTTAAGATGG + Intergenic
941134272 2:161694381-161694403 GGTTTAAGGGAAGTAAAATATGG - Intronic
942089280 2:172472982-172473004 GCTTCAATGGAAACAAAATAGGG - Intronic
942538368 2:176989319-176989341 GGTCTAAAGGAGAGATAATAAGG - Intergenic
942971036 2:181958152-181958174 GGCTTAATGGAAGCAGAACAGGG + Intronic
943632138 2:190266068-190266090 TCTGTAATGGAAAGATAATAGGG - Intronic
943908628 2:193533655-193533677 TGTTTGATGTAAAGATAATAAGG + Intergenic
944626516 2:201575276-201575298 TGTTGCATGGAAACATAGTAAGG - Exonic
946020084 2:216634584-216634606 CGTTGAATGGAAAAATAAAAGGG + Intronic
947552966 2:231060493-231060515 GGATTATTGGAAAAATGATATGG - Intronic
948399000 2:237669060-237669082 GTTTTAATGGCCACAAAATATGG + Intronic
1170321766 20:15107711-15107733 TGTTTCATTGAAACATAAAATGG - Intronic
1174439397 20:50537638-50537660 GGTTTAAAGAAAACATACAAGGG - Intronic
1174708187 20:52678227-52678249 AGGTGAATGGAAACATGATAAGG - Intergenic
1177813313 21:25948321-25948343 GGCTTATTAGAAACAGAATATGG + Intronic
1183137379 22:35902128-35902150 AGTATAATTGAAACGTAATAAGG - Intronic
1184715058 22:46277213-46277235 GGTTAAGTGAAAACAAAATAGGG - Intronic
949112103 3:273515-273537 GGCTTAATGGCAAAACAATAAGG - Intronic
949220123 3:1622449-1622471 GGTTTTATGCATAAATAATAAGG - Intergenic
950209633 3:11112707-11112729 ATTTTAATGGAACTATAATATGG + Intergenic
951211340 3:19978838-19978860 ATTTTAATGTAAACATTATAAGG + Intronic
951932905 3:27989316-27989338 GGTAAAATGGAAACACACTAGGG + Intergenic
952838414 3:37624435-37624457 GGTTTAGTGGAAAGAGAGTAAGG - Intronic
954357025 3:50090126-50090148 GATTTAACAGAATCATAATACGG - Intronic
954570727 3:51638587-51638609 GGATTAATGGAAAAATACTGTGG + Intronic
955612459 3:60772433-60772455 GGTTTCATGGAAAAATAATAGGG + Intronic
956556489 3:70528918-70528940 GGTTTGATGGAAACTTCAAATGG - Intergenic
957231696 3:77526124-77526146 GGTTTAGTGGAACCCTAATGTGG - Intronic
958046026 3:88284825-88284847 GCTAGAATGGAAACATAATAAGG + Intergenic
959265653 3:104134041-104134063 AGTTTAATGGAAAAAGAAGAGGG - Intergenic
960196681 3:114777167-114777189 GGTTTAACCCAAAGATAATATGG + Intronic
960624512 3:119667804-119667826 GGTTTAATGGAAACATAATAAGG - Intronic
964682723 3:159360130-159360152 TGTTCAATGCAAACATCATAAGG + Intronic
965098936 3:164272316-164272338 TGGTTAATGGAAACAAAAAATGG + Intergenic
966167815 3:177040884-177040906 GATTTAATGGGAACTTACTATGG + Intronic
970077480 4:12240577-12240599 GCTTTATTCAAAACATAATATGG - Intergenic
970922356 4:21409970-21409992 GGTTGAATGGGAACATATTTTGG + Intronic
972162903 4:36246893-36246915 GGTTTAATTGAAACTTAAAGAGG + Intergenic
972300218 4:37778351-37778373 TGTAAAATGGAAAAATAATAGGG + Intergenic
972892161 4:43571164-43571186 GGTATTATAGAAACAAAATATGG - Intergenic
974068371 4:57101590-57101612 GGATTAATGGCAAAATGATATGG - Intronic
975018428 4:69454695-69454717 GGACTAATAGAAAAATAATAAGG + Intergenic
975073626 4:70176973-70176995 GGTTTAGTGGTTAAATAATATGG + Intergenic
975684888 4:76909882-76909904 GGTAGAATGGAAAGATAATGAGG - Intergenic
976313986 4:83639764-83639786 AATTTAATGAATACATAATAGGG + Intergenic
977752984 4:100632050-100632072 GGCTTGATAGAAACATAAAATGG - Intronic
978065404 4:104393464-104393486 GTTTTAATGGGAAATTAATAAGG - Intergenic
978486957 4:109265432-109265454 AGTTTAATGGAAAAAGTATAAGG - Intronic
978671463 4:111252146-111252168 TTTTTATTGGAAACAAAATAGGG - Intergenic
980586320 4:134820927-134820949 GCCTTAAAGGAAACAAAATATGG - Intergenic
980749934 4:137075806-137075828 GATTTACTGGAAACACAATGCGG + Intergenic
982010756 4:151103919-151103941 GGTGTAATGGAAAAAGCATAAGG + Intronic
982093221 4:151897962-151897984 GGATTACTGGAAACTAAATAAGG - Intergenic
984218677 4:176946291-176946313 TGTTTTATGTAAACATTATATGG + Intergenic
985351566 4:189068876-189068898 TGTTTAAGGGAAACATCATTTGG + Intergenic
985612949 5:900109-900131 AGTTTAATGAAAACATATTGTGG + Intronic
988252164 5:28773196-28773218 GTGTTTATGCAAACATAATATGG + Intergenic
988340380 5:29962418-29962440 GCTTTTATGGGCACATAATAGGG + Intergenic
989468420 5:41785559-41785581 GGATTAATGGCAACAAAAAAAGG + Intronic
989896581 5:47095501-47095523 GGTTGAATGCACACATCATAAGG + Intergenic
990595339 5:57307475-57307497 TCTTTAATGGAAATATAATGGGG + Intergenic
991146649 5:63314151-63314173 GGAATAATGAAAACATAAGAGGG + Intergenic
994677470 5:102843096-102843118 GGTTTATTTAAAACATAATTAGG - Intronic
994791946 5:104238819-104238841 GGTTGAAATGAAACATAATGAGG + Intergenic
995019159 5:107347599-107347621 AGTTTATTTGAAACAGAATATGG - Intergenic
995920028 5:117300869-117300891 TGTATAAGGTAAACATAATATGG - Intergenic
996285241 5:121783395-121783417 GGTATAATAGAAACAGCATATGG + Intergenic
996315265 5:122153892-122153914 GGTTTAATGGACAAAGAACATGG - Intronic
996577992 5:124997830-124997852 GGATAAATAGAAACATAGTAAGG + Intergenic
997010993 5:129877072-129877094 TTTTTAAGGGAAATATAATAAGG + Intergenic
998312360 5:141147217-141147239 GGATTAACTGAAACATAAAATGG + Intronic
1202772259 5_GL000208v1_random:18860-18882 GGTTGAATGCACACATCATAAGG + Intergenic
1004343506 6:14827903-14827925 GGTTGAATGGACACAGAAGAAGG + Intergenic
1008367287 6:50697229-50697251 GTTTCTATGTAAACATAATATGG - Intergenic
1010112764 6:72260241-72260263 GGTTAATAAGAAACATAATATGG + Intronic
1010174589 6:73013003-73013025 TGTTTAATGGAGACCTCATAGGG + Intronic
1010697725 6:78997755-78997777 GGTTTAATGAAAACAAAACATGG + Intronic
1011254178 6:85404182-85404204 GTTTTAAAAGAAAGATAATAGGG + Intergenic
1011489445 6:87875338-87875360 GGTTTACTGGAATCAGAATTGGG + Intergenic
1011906227 6:92371867-92371889 AGTTTAATGGAAAGAAAAAATGG + Intergenic
1011970935 6:93221791-93221813 AATTTAATGGGAACATAAAATGG + Intergenic
1013614434 6:111828521-111828543 GGATGAATGCAAACAAAATATGG + Intronic
1013975084 6:116067853-116067875 GGTTTAATGGAAACTTTTTCAGG + Intergenic
1014648889 6:124010716-124010738 GGTTAGACTGAAACATAATAAGG + Intronic
1014716478 6:124870545-124870567 GGTCAAATGGAAACATCATAAGG - Intergenic
1017572970 6:155767091-155767113 TGTTTAAAAGAAAGATAATAAGG - Intergenic
1019137313 6:169918368-169918390 TGTTTAATGGAAACATAGACCGG + Intergenic
1020822228 7:12984410-12984432 GGGTAAATGGAAACTTAAAATGG + Intergenic
1021252177 7:18343418-18343440 AGTTTAATGGAAACAATATTAGG + Intronic
1023240033 7:38134031-38134053 GTTTTAATGGAAACCTAGTGAGG + Intergenic
1023427020 7:40048476-40048498 GGTTTTATGTAAATAAAATACGG + Intronic
1024407319 7:48997300-48997322 GATTTAATGAAAAAATAACATGG - Intergenic
1025779275 7:64585337-64585359 GGCTTAATAAAAACAAAATATGG - Intergenic
1025865883 7:65380237-65380259 GATTTAATAAAAACAAAATATGG - Intronic
1027729642 7:81854482-81854504 AAAATAATGGAAACATAATAAGG - Intergenic
1028088770 7:86671479-86671501 ATTTTACTGGAAACAAAATATGG - Intronic
1028347644 7:89802546-89802568 GGATTAATGGCAAAATGATAGGG - Intergenic
1028572995 7:92313021-92313043 GCACTAATGGAAACATAATGAGG - Intronic
1030433311 7:109481395-109481417 GTTTAAAAGGAAACAAAATAGGG - Intergenic
1030586582 7:111427711-111427733 GGCATAATGGAAACATAGCATGG - Intronic
1030620829 7:111789508-111789530 GGTTTAAAGGAATAATAATTGGG - Intronic
1031345963 7:120667199-120667221 TGTATAATGAAAACATAGTATGG + Intronic
1032990176 7:137385757-137385779 GGTTCAATGAAAACATAAGTAGG - Intronic
1033495563 7:141890439-141890461 GGATAAATGGAAGAATAATAAGG + Intergenic
1033776972 7:144622096-144622118 GGTTTAATGGAGAGATCTTAAGG + Intronic
1034328368 7:150258788-150258810 AGTTAAATGGAGACATAACAGGG - Intronic
1035267587 7:157700003-157700025 GTGTGAATGGAAACATATTAGGG - Intronic
1036805655 8:11831012-11831034 AGGTAAATGGAAACATAAGACGG - Intronic
1037085971 8:14850926-14850948 GGTTTAATTGAATCACAGTACGG - Intronic
1038826991 8:31014582-31014604 GCTTTAATAGAAACACAATTTGG - Intronic
1041762642 8:61383648-61383670 AGTTTAATTGATACTTAATAAGG - Intronic
1044466199 8:92509296-92509318 TGCTTAATGGAAACATGACATGG - Intergenic
1044954568 8:97466306-97466328 GGTTTAATTGACAAATAAAATGG - Intergenic
1046110733 8:109720874-109720896 GATTTAAAGGATAGATAATATGG + Intergenic
1048068275 8:130994555-130994577 GGGTTTATGGTAAGATAATATGG - Intronic
1048707656 8:137171605-137171627 GGTTTAATGGACTCACAGTAAGG - Intergenic
1050722845 9:8610808-8610830 GGTTTAATGAAATGATTATATGG - Intronic
1050956667 9:11670076-11670098 TGTTTAATCGAAATGTAATATGG + Intergenic
1052171685 9:25406119-25406141 GGTAGAATGGAAAGGTAATATGG + Intergenic
1052311007 9:27069074-27069096 GGGTTGATGGATACAAAATATGG - Intergenic
1055770267 9:79709435-79709457 GATTTAATGGTAACATACTTGGG - Intronic
1055905990 9:81293450-81293472 TGTCCAATGGAAACATAATGTGG + Intergenic
1057712608 9:97460839-97460861 GGGTTAAAGGAAGAATAATATGG + Intronic
1186699896 X:12078987-12079009 AATTTCATGGAAACATAATTAGG + Intergenic
1187533218 X:20115222-20115244 TTTTTAATGGAAACAAAATTGGG - Intronic
1188835104 X:34945485-34945507 GGTTTGATGGAATCCTAAAAGGG - Intergenic
1192319782 X:70080882-70080904 TTTTTAATGGAAAAATAATCAGG + Intergenic
1194431743 X:93816176-93816198 GGTTTAATGAATAAATAAGAAGG + Intergenic
1197275684 X:124476210-124476232 GGGTTAATGGAAAGATGCTAAGG - Intronic
1197396310 X:125931870-125931892 GGTTTTATGGAGTCAGAATAGGG + Intergenic
1199408851 X:147495547-147495569 GATTTAAATGAAAAATAATATGG - Intergenic
1200576362 Y:4893491-4893513 TGTTGAATGGAAAAAAAATATGG - Intergenic
1200905545 Y:8478613-8478635 GCCTTACTGGAAACATAATTTGG + Intergenic
1201940311 Y:19451714-19451736 AGTTTAATGGAAACATGGTTTGG + Intergenic