ID: 960627929

View in Genome Browser
Species Human (GRCh38)
Location 3:119699625-119699647
Sequence CTGTGAGAAGATAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960627922_960627929 30 Left 960627922 3:119699572-119699594 CCTTTCCGGTATAGAGAGAACAT No data
Right 960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG No data
960627923_960627929 25 Left 960627923 3:119699577-119699599 CCGGTATAGAGAGAACATTTTAG No data
Right 960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960627929 Original CRISPR CTGTGAGAAGATAAGGAGGT GGG Intergenic
No off target data available for this crispr