ID: 960628009

View in Genome Browser
Species Human (GRCh38)
Location 3:119700497-119700519
Sequence GCACGGTTCTTTGCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960628002_960628009 22 Left 960628002 3:119700452-119700474 CCCAGTCAGATATCTAGGATGGG No data
Right 960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG No data
960628004_960628009 21 Left 960628004 3:119700453-119700475 CCAGTCAGATATCTAGGATGGGG No data
Right 960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG No data
960628008_960628009 -10 Left 960628008 3:119700484-119700506 CCAAACTGACATAGCACGGTTCT No data
Right 960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG No data
960628000_960628009 23 Left 960628000 3:119700451-119700473 CCCCAGTCAGATATCTAGGATGG No data
Right 960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960628009 Original CRISPR GCACGGTTCTTTGCTAAAAC TGG Intergenic
No off target data available for this crispr