ID: 960629573

View in Genome Browser
Species Human (GRCh38)
Location 3:119716461-119716483
Sequence AGCTATCTGTTACAATGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960629573_960629579 21 Left 960629573 3:119716461-119716483 CCCCCGCATTGTAACAGATAGCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 960629579 3:119716505-119716527 ACAAAGAAGATGTTCATATCTGG 0: 1
1: 0
2: 0
3: 14
4: 222
960629573_960629580 22 Left 960629573 3:119716461-119716483 CCCCCGCATTGTAACAGATAGCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 960629580 3:119716506-119716528 CAAAGAAGATGTTCATATCTGGG 0: 1
1: 0
2: 1
3: 19
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960629573 Original CRISPR AGCTATCTGTTACAATGCGG GGG (reversed) Intronic
1064465113 10:15571644-15571666 GGCTGTCTGTTAAAATGCAGGGG - Intronic
1066616527 10:37300578-37300600 AACTTTCTCTTACAATGCGGTGG - Intronic
1076773041 10:132677494-132677516 GGCTCTCTGTCACACTGCGGGGG - Intronic
1078696769 11:13641746-13641768 TCCTATCTGTTACAATGCTTTGG + Intergenic
1083174447 11:60940700-60940722 AGCCATTTGTTACAAAGTGGGGG - Intronic
1085229621 11:74954073-74954095 AGGTAACTGTTAAAATGCAGAGG - Intronic
1089910106 11:122089851-122089873 AGCTATTTTTTACATTGAGGTGG + Intergenic
1093831413 12:23764044-23764066 AGCTATTAGTTACAATGAGAAGG + Intronic
1095083977 12:38039842-38039864 AGCTATCTGTGACACTGCTTTGG + Intergenic
1097891629 12:64782407-64782429 AGCTATCTGTAACAATCAGCTGG - Intronic
1112547817 13:100388886-100388908 AGCCATCTGTTAAAATGCCTTGG + Intronic
1116580138 14:46630427-46630449 TGCTACCTGTTACAATGCAAGGG - Intergenic
1119131731 14:72179144-72179166 AATAATCTGTTCCAATGCGGGGG - Intronic
1133884302 16:9811185-9811207 ACCTATCTGTTACAAGGTCGTGG - Intronic
1137045973 16:35662346-35662368 AGCTATCTGTGAAAATGCATTGG + Intergenic
1137047070 16:35676074-35676096 AGCTATCTGTGAAAATGCTTTGG + Intergenic
1137047102 16:35676588-35676610 AGCTATCTGTGAAAATGCTGTGG + Intergenic
1144575188 17:16425399-16425421 AGCTATCTGGAACAAAGTGGGGG - Intronic
1145729482 17:27163386-27163408 AGCTATCTGTGAAAATGCTTTGG + Intergenic
1145729513 17:27163899-27163921 AGCTATCTGTGAAAATGCGTTGG + Intergenic
1166653380 19:44592222-44592244 AGCTGTCTGTTACAGAGAGGGGG - Intergenic
928099922 2:28431007-28431029 AGCTCTGTGTCACAATGCCGAGG - Intergenic
934977707 2:98816415-98816437 AGATATCTGTAATAATGCTGAGG + Intronic
937939522 2:127274372-127274394 ACCTGTCTTTTACAATGCTGAGG - Intronic
939690439 2:145253861-145253883 AGCTTTCTTTTAGAATGTGGTGG + Intergenic
1181336423 22:22134515-22134537 AGCTATCTGTCAAAATGCTTTGG + Intergenic
952144109 3:30513072-30513094 AGCTATTTGAGACAATGAGGTGG - Intergenic
953065157 3:39462436-39462458 AGTTATCTGTTAAAACGCTGAGG + Intergenic
955785894 3:62538543-62538565 ATCTATCTGTTAAAATTGGGAGG - Intronic
956925796 3:73986978-73987000 AGCCATCTTTTACCATGAGGTGG - Intergenic
959546758 3:107605411-107605433 GGCTATATGTTAAAATGCTGTGG - Intronic
960629573 3:119716461-119716483 AGCTATCTGTTACAATGCGGGGG - Intronic
962806086 3:138928813-138928835 GGCCATCTGTAACAGTGCGGGGG + Intergenic
971866619 4:32180307-32180329 AGCCATCTGTTACATGGCTGGGG + Intergenic
972868823 4:43269938-43269960 GGCTATCTGTTACACTGTTGTGG + Intergenic
973096616 4:46209846-46209868 AGCTATATGTTACATTGATGTGG - Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
987892547 5:23898896-23898918 AGCTATCTGTCAAAATGCTTTGG + Intergenic
994685189 5:102942110-102942132 AGCAATCTGTTCCAATGCTAAGG + Intronic
999459273 5:151743734-151743756 AGCTATCTGTATCCATGTGGGGG - Intronic
1000421273 5:161040538-161040560 AGCTATCTGTGAAAATGCTTTGG + Intergenic
1000536958 5:162490936-162490958 AGCTAGCTGTTTCATTGCTGTGG + Intergenic
1002878088 6:1228767-1228789 AGCTAGCTGTCATAATGGGGAGG - Intergenic
1008420771 6:51296690-51296712 ATTCATCTGTTACAATGCAGAGG - Intergenic
1015352525 6:132238535-132238557 AGGTATTTGTTAAAATCCGGTGG + Intergenic
1023287700 7:38636512-38636534 AGCTCACTGTTACAAAGCTGGGG - Intergenic
1039915023 8:41853661-41853683 AGGTATCTGTTATAAGGCGGTGG - Intronic
1040132503 8:43813735-43813757 AGCTATCTGTTAAACTGCTGCGG + Intergenic
1055392236 9:75835418-75835440 AGCTATGTGTTACAGTAGGGAGG + Intergenic
1057610034 9:96533951-96533973 AGATATCTGTGAAAATGCTGAGG - Exonic
1058574854 9:106389672-106389694 AGCCATCTGGTACAATATGGTGG + Intergenic
1191237702 X:58149021-58149043 AGCTATCTGTGAAAATGCTTTGG + Intergenic
1191976872 X:66882312-66882334 AGCAATCTGATAGCATGCGGAGG + Intergenic