ID: 960631568

View in Genome Browser
Species Human (GRCh38)
Location 3:119737182-119737204
Sequence TGACCTAGATCTGGTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960631566_960631568 17 Left 960631566 3:119737142-119737164 CCATAGAGAATATTAATATTCTG 0: 1
1: 0
2: 5
3: 25
4: 336
Right 960631568 3:119737182-119737204 TGACCTAGATCTGGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 85
960631565_960631568 27 Left 960631565 3:119737132-119737154 CCTAGCATCACCATAGAGAATAT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 960631568 3:119737182-119737204 TGACCTAGATCTGGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960631568 Original CRISPR TGACCTAGATCTGGTAATGA AGG Intronic