ID: 960631568 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:119737182-119737204 |
Sequence | TGACCTAGATCTGGTAATGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 88 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 85} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
960631566_960631568 | 17 | Left | 960631566 | 3:119737142-119737164 | CCATAGAGAATATTAATATTCTG | 0: 1 1: 0 2: 5 3: 25 4: 336 |
||
Right | 960631568 | 3:119737182-119737204 | TGACCTAGATCTGGTAATGAAGG | 0: 1 1: 0 2: 0 3: 2 4: 85 |
||||
960631565_960631568 | 27 | Left | 960631565 | 3:119737132-119737154 | CCTAGCATCACCATAGAGAATAT | 0: 1 1: 0 2: 0 3: 10 4: 137 |
||
Right | 960631568 | 3:119737182-119737204 | TGACCTAGATCTGGTAATGAAGG | 0: 1 1: 0 2: 0 3: 2 4: 85 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
960631568 | Original CRISPR | TGACCTAGATCTGGTAATGA AGG | Intronic | ||