ID: 960634014

View in Genome Browser
Species Human (GRCh38)
Location 3:119765704-119765726
Sequence ATGCTTGTCAATACACAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960634014_960634021 23 Left 960634014 3:119765704-119765726 CCATCCTGTGTATTGACAAGCAT 0: 1
1: 0
2: 2
3: 17
4: 119
Right 960634021 3:119765750-119765772 TGATTCAAAGACTGTCAAATAGG 0: 1
1: 0
2: 2
3: 17
4: 259
960634014_960634018 -8 Left 960634014 3:119765704-119765726 CCATCCTGTGTATTGACAAGCAT 0: 1
1: 0
2: 2
3: 17
4: 119
Right 960634018 3:119765719-119765741 ACAAGCATCAGGATTCCAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960634014 Original CRISPR ATGCTTGTCAATACACAGGA TGG (reversed) Exonic
906762224 1:48386615-48386637 ATACTTCTCAATACACAGAAAGG + Intronic
909239012 1:73188736-73188758 ATGCTTGTAAATACACATAAAGG - Intergenic
909588710 1:77320717-77320739 TTGCTTGTCAACACCCAGGCTGG - Intronic
910147333 1:84097417-84097439 ATACCTGTCAATACCAAGGATGG - Intronic
910748907 1:90606030-90606052 ATCCTTGTCAACACTCAGAATGG - Intergenic
910900728 1:92117786-92117808 TTTCTAGTCAATGCACAGGAAGG - Intronic
916745686 1:167683290-167683312 ATCCTTGTCAAGGCACAGAAAGG + Intronic
917129852 1:171729998-171730020 ATGGTTTTGAAGACACAGGAAGG + Intronic
919854761 1:201697683-201697705 ATACTGGTCCATACACAGGCTGG + Intronic
920708192 1:208270584-208270606 ATGCTTGCCAGTAGCCAGGATGG - Intergenic
1063036352 10:2290289-2290311 AAGCTGGTGAAGACACAGGATGG + Intergenic
1063637946 10:7802420-7802442 ATGCTTGTAAGTACACAGTATGG + Exonic
1065745169 10:28833896-28833918 TTGTTTGTCAATAGACAGGCTGG + Intergenic
1066611417 10:37252044-37252066 ATGCTTGACAGGACACATGATGG - Intronic
1068635231 10:59341045-59341067 GTGCTTGTGGATCCACAGGAGGG - Intronic
1068930790 10:62587672-62587694 ATGTTTGTCAAAACTCAGAATGG - Intronic
1070286398 10:75086964-75086986 ATGCTTGTTAAAGCACAGAAAGG - Intergenic
1070405231 10:76088475-76088497 TTGGTTGCCAATAAACAGGAAGG + Intronic
1073790148 10:106931807-106931829 ATGATAGTTAATACACAGCATGG - Intronic
1074848013 10:117415899-117415921 ATACTTGTCAAAACACACTAAGG + Intergenic
1075429410 10:122367972-122367994 ATAATTGTCATTACACAGTATGG - Intergenic
1078820522 11:14876208-14876230 ATGTTTGTCAAGATTCAGGAAGG + Intergenic
1079661506 11:23042666-23042688 ATATTTGTCACAACACAGGAAGG + Intergenic
1080961094 11:37161138-37161160 ATGCTGGGAAATCCACAGGATGG + Intergenic
1082013415 11:47466784-47466806 CTGCTTCTCAATACACAGGAAGG + Intronic
1086303246 11:85452635-85452657 GTGGTTGGCAATACACAGTATGG - Intronic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1088117569 11:106329854-106329876 ATGCCTATCAACACAGAGGAGGG + Intergenic
1088378931 11:109172124-109172146 AGGCAAGTCCATACACAGGATGG - Intergenic
1090576083 11:128105519-128105541 ATACTTGTTAAAGCACAGGAAGG + Intergenic
1090619013 11:128544832-128544854 CTGCTTTTCAGCACACAGGATGG - Intronic
1091701766 12:2668061-2668083 ATATTTGTCAATACACAGAGAGG + Intronic
1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG + Intergenic
1094062493 12:26329141-26329163 ATGCTTGTGAATACAGAGTTCGG + Intergenic
1094351741 12:29533751-29533773 ATGGTAGTCAATACACTGTACGG + Intronic
1097345674 12:58489201-58489223 ATAGCTGTCAATACACAGGATGG - Intergenic
1098308127 12:69121631-69121653 ATTGTTGACAATATACAGGATGG - Intergenic
1098878449 12:75891577-75891599 ATACTTGTTAAAACACAGGAAGG - Intergenic
1099086305 12:78250728-78250750 ATGCTGGTCAAAATAGAGGAAGG + Intergenic
1100084393 12:90891104-90891126 ATGATTGTCAATATACAGATGGG - Intergenic
1100695409 12:97087408-97087430 ATGCTTGGCAACAAACAGGAAGG - Intergenic
1105717333 13:23080608-23080630 ATGCTTTTGAATACACATTATGG + Intergenic
1113465509 13:110510025-110510047 ATGCTTGTCACCACACAGAAGGG - Intronic
1113873169 13:113576484-113576506 ATGATTTAAAATACACAGGAGGG - Intergenic
1114130646 14:19788028-19788050 ATGCATGTCATTACTCAGCAGGG + Intronic
1116756470 14:48954916-48954938 ATGCTTGTCATACAACAGGATGG + Intergenic
1117414546 14:55481601-55481623 ATGCATGTAAATACACAGGTTGG + Intergenic
1117545688 14:56793461-56793483 ATTCTTATCAATACATATGAAGG + Intergenic
1127626363 15:60784021-60784043 ATGCTGGTCAGTAAACAGTATGG + Intronic
1135700826 16:24630992-24631014 ATGCTTGTACATACAGATGAAGG + Intergenic
1136504053 16:30691324-30691346 ATTCATGTAAATACACAGGTTGG + Intergenic
1136746542 16:32596428-32596450 ATGGTTGTCAATACCTGGGATGG - Intergenic
1137713549 16:50583836-50583858 ATTCTTGACAATACCCATGAAGG - Intronic
1137897353 16:52228512-52228534 ATTCTTGTCAATCCAAAGGATGG - Intergenic
1141473360 16:84254416-84254438 ATGCCTGTGAATACTCAGGATGG + Intergenic
1203048671 16_KI270728v1_random:855632-855654 ATGGTTGTCAATACCTGGGATGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153571879 18:6481829-6481851 AAGGTTGTCACTACACAGAAAGG + Intergenic
1155581491 18:27313138-27313160 ATTCTTGTCCATTCAAAGGATGG - Intergenic
1159074413 18:63664332-63664354 ATCCTTCTCCATATACAGGAAGG - Intronic
1159507502 18:69356142-69356164 ATACTTGTTAATGCACAGTAAGG - Intergenic
1162220955 19:9175854-9175876 TTGCTTCTTAATACAAAGGATGG - Intergenic
1163373896 19:16918294-16918316 ATGCTTTAAAGTACACAGGAGGG - Intronic
928865282 2:35910372-35910394 ATGCTTTTCATTACTCAGTAAGG - Intergenic
929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG + Intergenic
929347259 2:40899845-40899867 ATGCTTGTTAAAGCACAGTAAGG - Intergenic
932525010 2:72456360-72456382 ATGATTGTCAATGCCCAGGCAGG + Intronic
935621086 2:105130197-105130219 ATGCTTGTCAAAAGACAGCATGG + Intergenic
938412647 2:131077621-131077643 GTGCTTGTCAATTCTCAGCATGG + Intronic
939311007 2:140476606-140476628 ATGATTGTCAAAACACAATATGG - Intronic
939870372 2:147519991-147520013 ATGGTTGTCCATACAAAGGAAGG + Intergenic
940399554 2:153232029-153232051 ACCCTTGTCAATGCTCAGGAAGG + Intergenic
941008599 2:160271752-160271774 TTGCTTGTCAATGCTCAGCAAGG - Intronic
941695386 2:168545713-168545735 ATGCCTGTGCATACACAGGAGGG - Intronic
946238632 2:218340762-218340784 GTGCTTGTGAGTACACAGAATGG - Exonic
948932990 2:241144247-241144269 GTGCTTGCCAATATGCAGGATGG - Intronic
1170040073 20:12030762-12030784 AGGCTTGTAAATACACTTGAAGG + Intergenic
1171198580 20:23223154-23223176 AAGCTTGTGAATATACAGGCTGG + Intergenic
1177095576 21:16827681-16827703 ATGTTTGTCAATACAAGGCACGG - Intergenic
1178611751 21:34088529-34088551 GTGCTTGAAAATACACAAGATGG - Intronic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1203295590 22_KI270736v1_random:40301-40323 ATGCCTGTCTATATGCAGGACGG + Intergenic
952235787 3:31478683-31478705 ATGCTTGGCAATATACATTAGGG + Intergenic
952946624 3:38482262-38482284 ATACATGTCAATGCGCAGGAAGG - Exonic
954865862 3:53728897-53728919 ATGCCTCTCAATACAGATGATGG + Intronic
955692025 3:61600280-61600302 ATGCTTTTCAGTACCCAGAAAGG - Intronic
955991959 3:64637480-64637502 ATGCCTGTTAATACATAGAAAGG + Intronic
957168699 3:76709564-76709586 ATTATTGTCAGAACACAGGAAGG + Intronic
957222150 3:77397578-77397600 ATGCTAGTAAATACACAGGAGGG - Intronic
960634014 3:119765704-119765726 ATGCTTGTCAATACACAGGATGG - Exonic
961041043 3:123678497-123678519 ATGCTTGTCAGTGCTCAGCAGGG + Intronic
962160062 3:132989628-132989650 CTCCTTGTCAATAGACGGGATGG - Intergenic
974230229 4:59103325-59103347 ATACTTGTCAACATACTGGAAGG - Intergenic
974613150 4:64242625-64242647 TTGCTTGTCAATATACAGGGAGG - Intergenic
984542747 4:181060688-181060710 AAGCTTGTCTAGACACTGGAAGG - Intergenic
988514090 5:31890094-31890116 AGCCTTGTCAATGCTCAGGAGGG - Intronic
989215768 5:38902841-38902863 ATGCATCTGAATACCCAGGAAGG + Intronic
990768686 5:59217821-59217843 AACCTTGTCAATTCCCAGGAAGG + Intronic
998397205 5:141826372-141826394 TTGCTTGCAAATAAACAGGAGGG - Intergenic
999131846 5:149289629-149289651 GTGCTTGTAAATTCAGAGGAAGG + Intronic
1003784018 6:9463209-9463231 CTACTTGTCAATACAAAGAATGG + Intergenic
1004400188 6:15281513-15281535 ATGCAGGTAAATACACAGAAAGG - Intronic
1007180542 6:39926304-39926326 ATGCTTGTAGCTACAGAGGACGG - Intronic
1007509615 6:42365007-42365029 ATGCAGGTCAGCACACAGGAGGG + Intronic
1011626638 6:89288443-89288465 ATGCTTGTGAAAACACTCGAAGG - Intronic
1012976825 6:105788792-105788814 ATTCATGTCCATAGACAGGAAGG - Intergenic
1016685444 6:146876743-146876765 ATTCTTCTCTATTCACAGGATGG - Intergenic
1017960975 6:159220262-159220284 ATGCTTGTAAAGACAAAAGAGGG + Intronic
1018278665 6:162161006-162161028 ATCCTTGCCTATAGACAGGAAGG - Intronic
1018279557 6:162171130-162171152 AGGCTGGTAAATACACAGGCAGG + Intronic
1020242150 7:6404071-6404093 ATGCGTGTCTCCACACAGGAGGG + Intergenic
1021089542 7:16466940-16466962 ATGCTGATAAACACACAGGATGG - Intronic
1022122267 7:27320779-27320801 ATGTTTGTCAGTATAAAGGAGGG + Intergenic
1022609795 7:31858363-31858385 ATGCCTGACAACACTCAGGAGGG + Intronic
1024944783 7:54797794-54797816 ATGCCAGTCAAGACACAAGAAGG + Intergenic
1026368321 7:69672424-69672446 ATACTTATCAATACACACAACGG + Intronic
1027161657 7:75807058-75807080 ATGCTAAACAATACACAGCAGGG - Intergenic
1031991744 7:128203129-128203151 ATGCTTGCCAAGTCCCAGGAGGG + Intergenic
1032420952 7:131778650-131778672 ATGGTTCTAAATACACAGGATGG - Intergenic
1033458085 7:141520422-141520444 ATCCTTTTCAATCCATAGGATGG - Intergenic
1035242015 7:157538343-157538365 ATATTTGTTAATGCACAGGAAGG - Intergenic
1035343189 7:158178008-158178030 CTCCTTGCCAATACATAGGATGG + Intronic
1039364311 8:36914383-36914405 ACGTCTTTCAATACACAGGACGG + Intronic
1039943468 8:42110603-42110625 CTACTTGTCAATACAGAGGGCGG + Intergenic
1040551114 8:48438417-48438439 TTGCTTTTCAAAACACAGCACGG + Intergenic
1048441784 8:134464869-134464891 GTGCTCGTCAATACACTGCAGGG - Intergenic
1052245913 9:26334634-26334656 CTACGTGTCAACACACAGGAAGG - Intergenic
1053891620 9:42698768-42698790 CAGCTTGTAAAGACACAGGAGGG + Intergenic
1054824867 9:69563473-69563495 ATGCTTTTGAATTCAAAGGAAGG - Intronic
1055943741 9:81674282-81674304 GTGCGTGTCAATACACTGGCTGG + Intronic
1061213314 9:129206041-129206063 ATGCCTCTCAATACACAGTATGG + Intergenic
1185809831 X:3097219-3097241 ATGCTTTTCCATACACATTAAGG + Intronic
1186675955 X:11817575-11817597 ATACTTGTGCACACACAGGAGGG - Intergenic
1186714405 X:12235045-12235067 AGGCTTATTAACACACAGGATGG + Intronic
1195793249 X:108613829-108613851 TTGCTAGTTAATACACAGAATGG + Intronic
1195859602 X:109368932-109368954 ATGCTTGTACATACACAGTTAGG + Intergenic
1197353676 X:125407271-125407293 ATGCTTGTCTGTACAGAGGTAGG - Intergenic
1198154401 X:133944760-133944782 ATGCTTATAAATGCACAAGAGGG + Intronic
1200148105 X:153937312-153937334 CTGCTTGACATGACACAGGAAGG + Intronic