ID: 960636484

View in Genome Browser
Species Human (GRCh38)
Location 3:119789729-119789751
Sequence CTCAGAGAGAAGGCAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960636484_960636489 1 Left 960636484 3:119789729-119789751 CCCTGTCCTGCCTTCTCTCTGAG 0: 1
1: 0
2: 5
3: 61
4: 545
Right 960636489 3:119789753-119789775 GCACTGTGGCTGCCATGCACAGG 0: 1
1: 1
2: 2
3: 32
4: 238
960636484_960636490 2 Left 960636484 3:119789729-119789751 CCCTGTCCTGCCTTCTCTCTGAG 0: 1
1: 0
2: 5
3: 61
4: 545
Right 960636490 3:119789754-119789776 CACTGTGGCTGCCATGCACAGGG 0: 1
1: 0
2: 3
3: 55
4: 290
960636484_960636493 13 Left 960636484 3:119789729-119789751 CCCTGTCCTGCCTTCTCTCTGAG 0: 1
1: 0
2: 5
3: 61
4: 545
Right 960636493 3:119789765-119789787 CCATGCACAGGGCAGGACTGAGG 0: 1
1: 0
2: 5
3: 39
4: 403
960636484_960636491 6 Left 960636484 3:119789729-119789751 CCCTGTCCTGCCTTCTCTCTGAG 0: 1
1: 0
2: 5
3: 61
4: 545
Right 960636491 3:119789758-119789780 GTGGCTGCCATGCACAGGGCAGG 0: 1
1: 0
2: 5
3: 40
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960636484 Original CRISPR CTCAGAGAGAAGGCAGGACA GGG (reversed) Intronic
900652682 1:3738039-3738061 CTCAGGAAGAGGGCAGGTCAGGG - Intergenic
901454938 1:9357836-9357858 CTCTGAGAGAGGGCCGTACACGG - Intronic
901841647 1:11957655-11957677 CTCTGAGAGAGGGCAGGGGAGGG - Intronic
902878827 1:19357474-19357496 CTCATAAAGAAGGCTGGAGATGG - Exonic
903239654 1:21974363-21974385 CCCAGAGAAAAGCCAGGACTTGG - Intergenic
903243461 1:21999291-21999313 CCCAGAGAAAAGCCAGGACTTGG - Intergenic
903853357 1:26321209-26321231 GTCTTAGAGAAGCCAGGACAGGG - Intergenic
904165970 1:28555412-28555434 CTCAAAGAGAAAGAAGAACATGG - Intronic
904799133 1:33080869-33080891 CTTAGAGAGTGGGCAGGACCAGG - Intronic
904890227 1:33774068-33774090 TGCTGAGAGCAGGCAGGACAAGG + Intronic
905022006 1:34824422-34824444 CTCAGAGAGATGGTATCACATGG - Intronic
905174512 1:36127291-36127313 CTCAGAGGGCAGGCAGCAGAAGG - Intergenic
905438458 1:37976304-37976326 CTCAGAGAGAAAGCAGGGAGAGG - Intronic
905642025 1:39596654-39596676 CTCAAAGAAAAGCCAGCACAAGG - Intergenic
905800281 1:40838531-40838553 CTCAGAGGCAGGGCAGCACACGG + Exonic
906579781 1:46927111-46927133 CTCTGAGAACAGGCAGGAAAGGG - Intergenic
906746088 1:48223130-48223152 CTCAGAGAGGAGTCAGGAGTCGG - Intronic
906860489 1:49353823-49353845 GTCAGAGAGAAGACTGGCCATGG + Intronic
908551370 1:65212104-65212126 GTGAGAGAGGTGGCAGGACAGGG + Intronic
909575149 1:77167049-77167071 CTAACAAAGAAGGCAGGCCATGG + Intronic
910521615 1:88128273-88128295 ATCAGATAGCAGGCTGGACAAGG - Intergenic
910839366 1:91546735-91546757 CTGAGAGAGAGGGAAGGGCAGGG - Intergenic
910875629 1:91875287-91875309 CCCATAGAGAAGGAGGGACATGG + Intronic
912411423 1:109483352-109483374 CCCACAGAGGAGGCACGACACGG + Intergenic
912741993 1:112206782-112206804 CTGAGAGAGATGCCAGGGCATGG + Intergenic
912865535 1:113252881-113252903 CTCAGAGAGGAGGAAGGTGAAGG + Intergenic
913451610 1:118996615-118996637 CCCAGAGAGAAGGCTGACCAAGG - Intergenic
914222938 1:145696567-145696589 CACAGGGAGAAGACAGGAGAGGG + Intronic
915129219 1:153685697-153685719 CACAAAGATAAGGCAGGATAAGG + Intronic
915344559 1:155191356-155191378 CTCGGAGAGAAGGACGGACCCGG - Intronic
915344575 1:155191417-155191439 CTCGGAGAGCAGGCCGGACCCGG - Intronic
916948443 1:169755085-169755107 CCCAAAGAGAAGGGAGGAAAGGG + Intronic
917048949 1:170896271-170896293 CTCAAAGAGAAGGAATGCCAGGG + Intergenic
917123495 1:171665065-171665087 CTGAGAGGGAAAGCAGGGCATGG - Intergenic
917491784 1:175504496-175504518 CTCACAGCGGAGGCAGGACAGGG - Intronic
917742523 1:177974867-177974889 CTCAGAGAAAATGCATCACATGG + Intronic
918592284 1:186253501-186253523 CTATGAGAGAAGGAAGCACAGGG - Intergenic
919536923 1:198798541-198798563 ATGAGAGAGCAGGCAAGACAAGG - Intergenic
919808946 1:201397230-201397252 CTCAGCGGGCAGGCAGGAAAGGG - Intronic
919946159 1:202320305-202320327 CCCAAAGAGTAGGCAGGACCTGG - Intergenic
920297678 1:204969031-204969053 CTCAGAGGGAAGGGTGGGCATGG - Intronic
920373061 1:205491903-205491925 CTCAGAAAGGAGTCAGGCCACGG - Intergenic
920692183 1:208155346-208155368 CACAGAGAGAAGGCAGCTCGGGG + Intronic
921321191 1:213941222-213941244 CACAGAGAGAAGAAAGGTCATGG - Intergenic
921959304 1:221017856-221017878 CTTAGTGGGAAGACAGGACATGG - Intergenic
922075441 1:222239011-222239033 CTCCTAGATAATGCAGGACATGG - Intergenic
922098256 1:222460836-222460858 CTCAGAGGGAAGAGAGGACTGGG + Intergenic
922349440 1:224723353-224723375 CACTGAGAGAAGGCAGCACAGGG - Intronic
922700569 1:227757405-227757427 CTTAGAGATAAGTCAGGGCAAGG + Intronic
923434853 1:233958090-233958112 CTTAGAGACGAGGCAGGACATGG + Intronic
924934868 1:248759154-248759176 CACAGAGAGAAGGCGGGTCAGGG - Intergenic
1062879330 10:965326-965348 CTCAGAGTCCAGGCAGGACCTGG - Intergenic
1063905356 10:10775325-10775347 TACAGAGAGAAAGCAGGAGATGG + Intergenic
1064622962 10:17233556-17233578 AACAGAGAAAAGACAGGACATGG - Intronic
1064752346 10:18544097-18544119 GACAGAGAAACGGCAGGACAGGG + Intergenic
1065367626 10:24951713-24951735 CTCAGGGAGCAGGGAGGACGTGG + Intronic
1066680873 10:37936245-37936267 CTGACAGAAAAGGCAGGACTGGG - Intergenic
1067165483 10:43863562-43863584 CACAGAGAGGAGGCAGCAGAGGG - Intergenic
1067453325 10:46395968-46395990 CTGGGAGAGAAGGCACAACATGG + Intergenic
1067583909 10:47463798-47463820 CTGGGAGAGAAGGCACAACATGG - Intronic
1067658591 10:48216761-48216783 CTCAGAGAGAAAACATGCCAAGG + Intronic
1067828626 10:49597348-49597370 CCCAGAGGGAGGGCAGGAAAGGG - Intergenic
1069627990 10:69880205-69880227 GTCAGTGAGAACACAGGACATGG - Intronic
1069786335 10:70990521-70990543 CTCTGTGAGAAGGCAGCTCAGGG + Intergenic
1069989878 10:72308655-72308677 CACAGAGGGAAGGGAGGCCAAGG + Intergenic
1070723517 10:78772779-78772801 CTGGGAGAGAGGGCAGGGCAGGG - Intergenic
1070984373 10:80675499-80675521 CTCAGAGAAAAGGGAGGACTAGG - Intergenic
1071433665 10:85626505-85626527 CTCTGGAAGAAGGGAGGACATGG + Intronic
1073029006 10:100509672-100509694 TTCAGAGAAAGGGCAGGACTGGG - Intronic
1073215694 10:101834743-101834765 CTTAGGGAGAAGGCAGGGAAGGG + Intronic
1073522664 10:104148632-104148654 GTCAGAGAGGAGGCAAGAGAGGG - Intronic
1073558824 10:104480077-104480099 CTCAGAGACCAGGCTAGACAGGG - Intergenic
1073582198 10:104678884-104678906 CACTGAGGGAAAGCAGGACAGGG + Intronic
1073877196 10:107938549-107938571 CTCAGGGAGAAGGGAGGGAAGGG - Intergenic
1074279709 10:112039308-112039330 CTGAATGAGAAGGCAGTACAAGG + Intergenic
1075077089 10:119358890-119358912 CTCAGAGGAAAGGCCGGGCAAGG - Intronic
1075229889 10:120666960-120666982 CTCAGAAAGAATGTAGGAGAAGG + Intergenic
1075238730 10:120757965-120757987 ATCAGAGAGAAGGAAAGAAAGGG + Intergenic
1075700819 10:124468550-124468572 CTCGTGGACAAGGCAGGACATGG - Intronic
1076144405 10:128105733-128105755 CACAGAGAGACAGCAGGAGATGG - Exonic
1076214774 10:128684661-128684683 CTTTTAGAGAAGGCAGGAGATGG - Intergenic
1076344187 10:129769152-129769174 CTCGGAGAGGAAGCAGAACATGG - Intergenic
1076364181 10:129911397-129911419 GTGAGAGAGGAGCCAGGACAGGG - Intronic
1076604453 10:131680422-131680444 CTCAGAGTGAAGGGAAGCCATGG + Intergenic
1076698332 10:132257634-132257656 GGCAGAGAGAGGGCAGGGCAGGG - Intronic
1077508664 11:2943860-2943882 CCCAGAGAGAAGGCAGCCCACGG + Intergenic
1077826174 11:5810256-5810278 ATCAGAGGCAAGGCAGAACAAGG + Intronic
1077920090 11:6635521-6635543 CTTAGAGAGAAAGCTGGCCAAGG + Intronic
1078371166 11:10746670-10746692 CTCAGAGAGAGTGAAGAACATGG + Intergenic
1079104770 11:17563507-17563529 CTCAGAGAGCAGCCAAGCCAGGG - Intronic
1079364266 11:19795631-19795653 ATCAGAGAGAAAGGAAGACAGGG + Intronic
1079735265 11:23989881-23989903 CCCAGAAAGAAGGCAGAAAAGGG + Intergenic
1079786105 11:24674769-24674791 CGCAGGGAGCAGGCAGGAGAGGG - Intronic
1080448874 11:32362389-32362411 CTCAAAGAGAGGGCCGGGCACGG + Intergenic
1080503643 11:32892760-32892782 CTCAGAGGGGAGGCGGGGCAAGG + Intergenic
1080942166 11:36931292-36931314 GTCAGAGAGAAGGCAGAGGAAGG - Intergenic
1081044899 11:38261139-38261161 ATCAGAATGAAGGCTGGACACGG - Intergenic
1081412360 11:42774755-42774777 CTCAGAGAGCAGGTTGGAAAAGG - Intergenic
1081620091 11:44614333-44614355 TTCAGGGAGAAGGAGGGACAGGG - Intronic
1081652770 11:44835458-44835480 CTCTCAGGGAAGGCAGGAGAAGG - Intronic
1081687267 11:45051773-45051795 ATCAGAGGAATGGCAGGACAGGG + Intergenic
1081713847 11:45234619-45234641 CTCAGAGAGAGAGCACGCCAGGG + Intronic
1083159354 11:60845243-60845265 GTCAGAGAGACAGCAGGACCTGG + Intronic
1083288525 11:61676637-61676659 CTCAGAGAGAAGGCCAGGCATGG + Intergenic
1083481534 11:62950819-62950841 GTTAGAGAGAAGTCAGGACCAGG + Intronic
1083590289 11:63889648-63889670 GGAAGAGAGAAGGCAGGACATGG - Intronic
1083711964 11:64555073-64555095 TTCAAAGAGAAGCCAGGAAATGG + Intergenic
1084364118 11:68686403-68686425 CTCTGGCAGAAGGCAGTACAGGG - Intronic
1085023744 11:73224674-73224696 CTCAGGGGGAAGGCAGTCCAGGG - Intronic
1085085374 11:73663099-73663121 CTCAGAAAGCAGGCAGGACCTGG - Intergenic
1085388816 11:76171902-76171924 CCCACAGACAAGCCAGGACAGGG + Intergenic
1085874379 11:80388242-80388264 ATTAGAGAGAAGAGAGGACATGG + Intergenic
1086909101 11:92451351-92451373 ATCAGAGACAAGACAGGTCATGG - Intronic
1087200693 11:95341601-95341623 CTAAGAGGGAAAACAGGACAAGG - Intergenic
1087239349 11:95757655-95757677 CTCAGAGGGAAGGGAACACATGG - Intergenic
1087558837 11:99758129-99758151 CTCAGAAAGATGGCTGGACTTGG - Intronic
1087848071 11:102995831-102995853 CTCAGAGTGAATCCATGACATGG + Intergenic
1088895042 11:114072144-114072166 CTCAGGGAGAAAGCAGGATCTGG - Intronic
1088970938 11:114774234-114774256 GGCAGAGAGAAGGCACAACATGG + Intergenic
1089060737 11:115624081-115624103 CTCAGAAAGAAGGCAGTGTAGGG - Intergenic
1089650960 11:119912582-119912604 CTCAGAAAGAAGTCAGGTAAGGG + Intergenic
1090465364 11:126928580-126928602 ATCAGGGAAAAGGCAGGACTGGG + Intronic
1090522701 11:127496174-127496196 ATCAGAGAGAAGGAGAGACAGGG + Intergenic
1090610479 11:128466588-128466610 CACAGAGAAAGGGCAGGGCAGGG - Intronic
1091946726 12:4551606-4551628 GTCAGACACAAGGGAGGACAGGG + Intronic
1091953190 12:4612666-4612688 CTCTGAGACAAGGAAGGACAAGG + Exonic
1092524687 12:9302480-9302502 CCCAGAGAGCAGGCTGGCCACGG - Intergenic
1092542576 12:9429332-9429354 CCCAGAGAGCAGGCTGGCCACGG + Intergenic
1092616686 12:10222211-10222233 CCCAAAGAGAAGGGAGCACAGGG - Exonic
1094178177 12:27563486-27563508 CTCAGAGATGAGGCAGAAGAGGG + Intronic
1094510439 12:31093102-31093124 CCCAGAGAGCAGGCTGGCCACGG - Intronic
1095374677 12:41512460-41512482 TTCAGAAAGAAGGAAGGGCAGGG + Intronic
1095724913 12:45441208-45441230 GCCAGAGAGAAGGTAGGGCAAGG - Intergenic
1095938339 12:47709214-47709236 CTCTGGGAAAGGGCAGGACAAGG + Intergenic
1097234642 12:57530850-57530872 CTGAGAGAGAAGACAAGAAATGG + Intronic
1097592229 12:61588076-61588098 CCCAGAGAAAAGAGAGGACATGG - Intergenic
1097703144 12:62840608-62840630 CTCAGAGAAAAGGTAAGAAAAGG + Intronic
1099798849 12:87432125-87432147 TTCAGAAATACGGCAGGACATGG + Intergenic
1100738159 12:97561359-97561381 AACAGAGAGAAGACAGAACAAGG - Intergenic
1100774661 12:97960919-97960941 TGCAGAGAGAAGCCAGGAGAGGG + Intergenic
1100817972 12:98404196-98404218 CACAGGGAGGAGGCAGGAAAAGG + Intergenic
1101007250 12:100412929-100412951 CCCAGGAAGAAGGAAGGACAAGG + Intronic
1101333528 12:103776737-103776759 ATCTAAGAGAAGGCTGGACATGG + Exonic
1101771862 12:107759673-107759695 CACAGAGAGAAGGCAGATGAAGG + Intronic
1102494104 12:113307420-113307442 CCCAGAGTTCAGGCAGGACATGG - Intronic
1102788623 12:115624655-115624677 CTGAGAAAAAAGGCAGAACATGG + Intergenic
1102870416 12:116409833-116409855 AGGAGAGAGGAGGCAGGACAGGG + Intergenic
1103142350 12:118559748-118559770 CTCAGGGTAAAGGAAGGACATGG + Intergenic
1103518597 12:121523287-121523309 CGCAGAGAGAAATAAGGACAAGG + Intronic
1104707448 12:130958096-130958118 GTGAGAGAGAAGGCAGGAGAAGG - Intronic
1104713604 12:131002880-131002902 TTCAGGGAGGAGGCAGGACCAGG + Intronic
1105438398 13:20396402-20396424 GACAGAGAGAAGGCTGGAGAGGG - Intergenic
1105773041 13:23630734-23630756 ATCAGACTGAAGGCAGGATATGG - Intronic
1106457745 13:29942321-29942343 GGGAGAAAGAAGGCAGGACATGG - Intergenic
1106818233 13:33433758-33433780 CTCAGAGGGTGGGCATGACAGGG - Intergenic
1111600083 13:90461738-90461760 GGCAGAGAGAAGGCTGGAAAGGG - Intergenic
1112308186 13:98294174-98294196 CTCAGTGAGAAGGAGGGCCAAGG - Intronic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113286236 13:108852015-108852037 CTCTGGGAGAGGGAAGGACATGG - Intronic
1113362847 13:109647104-109647126 TTCACAGGGAAGGCAGGAAAAGG + Intergenic
1113899157 13:113786760-113786782 GTCAGAGAGCAGGCAGGAAAAGG + Intronic
1114179254 14:20351466-20351488 TTCTTAGAGAAGGCAGGGCACGG - Intronic
1115437130 14:33387613-33387635 CCCACAGAGAGGGCAGGAGAAGG + Intronic
1115528322 14:34302976-34302998 CTCTGTGAGAAAGCAGCACATGG - Intronic
1117225416 14:53653591-53653613 CCCAGAAGGAAGGCAGGAAAAGG + Intergenic
1117803963 14:59470856-59470878 CACAGAGGGAAGGAGGGACAGGG + Intronic
1118438365 14:65791366-65791388 CTCATAGTGAAGGCAGTAGATGG + Intergenic
1118926295 14:70192752-70192774 CACAGCGAGAAGGCAAGCCAAGG + Intergenic
1119427590 14:74545863-74545885 CTCAGAGTGAAGGGAGCAGAGGG + Intronic
1119510886 14:75210226-75210248 CTCAGAGGCAAGGCAGACCACGG - Intergenic
1120227144 14:81803485-81803507 CTCAGAGAGATGGAAGGTCAAGG + Intergenic
1121107878 14:91292955-91292977 CCCAGAGAGAAGGCTGGAAAAGG - Intronic
1122543714 14:102511013-102511035 CACACAGAGAAGCCAGGACAGGG - Intergenic
1122584699 14:102797121-102797143 CACAGAGAGGAGACAGGCCAAGG - Intronic
1122821830 14:104350642-104350664 CTCAGAGAGAAGGAAGGGGGTGG - Intergenic
1123410367 15:20054007-20054029 CTCAGAGAGAGGCAAGGAGAAGG + Intergenic
1123421307 15:20139552-20139574 CACAGGGCCAAGGCAGGACAGGG + Intergenic
1123519700 15:21060714-21060736 CTCAGAGAGAGGCAAGGAGAAGG + Intergenic
1123530533 15:21146092-21146114 CACAGGGCCAAGGCAGGACAGGG + Intergenic
1124140282 15:27071306-27071328 CTCAGAGGGAAGAGAGGAGAAGG - Intronic
1125310538 15:38373800-38373822 TTCTGAGAGAAGGCAGTTCAGGG + Intergenic
1125398089 15:39271445-39271467 CTCAGGGAGAATGCCTGACAAGG - Intergenic
1126182069 15:45795053-45795075 TTCAGAGAGCAGGCAAGCCATGG - Intergenic
1126688015 15:51265249-51265271 CTCAGAGGGAAGGGAGGACATGG - Intronic
1126731253 15:51685526-51685548 ATCACAGAGAAGACAGGCCAAGG + Intronic
1127258567 15:57311078-57311100 CTCAGTGAGATAGCAGGACACGG - Intergenic
1127367134 15:58301575-58301597 CTCAGAGAGAATGCTGAACACGG + Intronic
1127367623 15:58306279-58306301 CCCAGAGAGAAGGAAGAACTGGG - Intronic
1128300563 15:66564185-66564207 GTCAAAGAAAACGCAGGACAGGG + Intronic
1128502104 15:68233804-68233826 CACAGTGAGAAGGCTGCACAAGG + Intronic
1129117054 15:73370131-73370153 CTCAGAGAGATGGCAGAGCCAGG - Intergenic
1129231374 15:74198971-74198993 CTGGGAGAGTAGGCAGGACTGGG + Intronic
1129350741 15:74954813-74954835 CTCAGAGAGAGGGCAGTGAAGGG + Exonic
1129615581 15:77096880-77096902 CATAGAGGGAAGGCAGGAGAGGG - Intergenic
1130673085 15:85930408-85930430 GGTAGAGAGAAGGCAGGAGAGGG - Intergenic
1130673107 15:85930480-85930502 GGTAGAGAGAAGGCAGGAGAGGG - Intergenic
1130673134 15:85930600-85930622 GGAAGAGAGAAGGCAGGAGAGGG - Intergenic
1130673148 15:85930648-85930670 GGTAGAGAGAAGGCAGGAGATGG - Intergenic
1130673154 15:85930672-85930694 GGTAGAGAGAAGGCAGGAGAGGG - Intergenic
1130673215 15:85930871-85930893 GGTAGAGAGAAGGCAGGAGAGGG - Intergenic
1130868843 15:87954174-87954196 CTCGGAGAGCTGGCAGGAGAGGG - Intronic
1130980198 15:88807218-88807240 GTCAGAGAGGAAGCAGGGCATGG + Intronic
1131194976 15:90348459-90348481 CCCAAAGAGAAGGGAGCACAGGG + Intergenic
1131873085 15:96780313-96780335 GTCAGAGTGAGGTCAGGACAAGG - Intergenic
1132020079 15:98353421-98353443 CTGAGGGCAAAGGCAGGACAGGG - Intergenic
1132134518 15:99322116-99322138 GCCAGACAGAAGGAAGGACAAGG + Intronic
1132658226 16:1050074-1050096 CTCAGAGGGAGTGCAGGACAGGG + Intergenic
1132882845 16:2170095-2170117 CTCAGAGGGAAGGCAGGGCCAGG - Intronic
1133429354 16:5723205-5723227 CTCACAGAGGAGGCAGTAGATGG + Intergenic
1133757742 16:8775266-8775288 CACAGAGAGAAAACAGGAAAAGG - Intronic
1133779160 16:8923741-8923763 CTTGGAGAGAAGGAACGACATGG + Intronic
1134073787 16:11276551-11276573 CTCACAGAGGAGGCTGGGCAGGG - Intronic
1134563153 16:15228087-15228109 CACAGACAGACAGCAGGACAGGG - Intergenic
1134638566 16:15811141-15811163 CACAGCGAGAAGGCAGCACTAGG + Intronic
1134923685 16:18139716-18139738 CACAGACAGACAGCAGGACAGGG - Intergenic
1135265396 16:21021317-21021339 ATCAGAGAGGAGGTAAGACAGGG + Intronic
1137006125 16:35275631-35275653 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1137482950 16:48867497-48867519 CAGAGAGAGAAGGGAGGACAGGG - Intergenic
1137729929 16:50681724-50681746 CTCAGAGAAAAGGCACCAGATGG - Intergenic
1138410936 16:56839750-56839772 CTCACAGAAAAGCCAGGCCAAGG - Intronic
1138417477 16:56879612-56879634 AGCAGAGACAAGGCAGGCCAGGG - Exonic
1138567193 16:57842003-57842025 CGCAGGGAGAAGGCAGGAGATGG - Intronic
1139550440 16:67669852-67669874 CACAGAGTGAAGGGAGGAAAAGG - Intergenic
1139577177 16:67849046-67849068 TCCAGAGAGAAGGCAGGGCTTGG - Intronic
1139737588 16:69005325-69005347 GTCAGAGAGAAGGGGTGACAGGG + Intronic
1140024095 16:71267843-71267865 CCCAGAGAGAAGCAAGGACATGG + Intergenic
1140292456 16:73673411-73673433 CACAGAGAGAAGATAGGAAAAGG + Intergenic
1140298962 16:73737828-73737850 CCCAGAGAGTGGGCAGGAGAAGG + Intergenic
1140347087 16:74223793-74223815 CACTGAGAGAAGGCAGGAGCAGG + Intergenic
1140600963 16:76474364-76474386 CTCTAAGATAAGGCAGGTCAAGG + Intronic
1140863272 16:79037842-79037864 CCCAGAGAGCAGGCAGGAGCTGG - Intronic
1141051784 16:80772246-80772268 TTCAGGTAGAAGGCTGGACATGG + Intronic
1141607880 16:85165602-85165624 CTTAGAGGGAAGCCAGGAGATGG + Intergenic
1142280320 16:89144606-89144628 CTGAGAGAAATGGCAGGACAGGG + Intronic
1142297315 16:89233990-89234012 TTCACAGGAAAGGCAGGACAGGG - Exonic
1142424107 16:89991741-89991763 CTCTGAGAGGAGGCAGGCCTGGG - Intergenic
1142530049 17:573373-573395 CTCAGGGAGGAGGCAGGAAGTGG - Intronic
1142977466 17:3654327-3654349 CTCAGAGATAAGCCAGGGGAGGG + Intronic
1143378973 17:6483978-6484000 TTCAGAGTGAGGGAAGGACATGG + Intronic
1144750758 17:17646816-17646838 GCAAGAGAGAAGGCTGGACACGG + Intergenic
1144875476 17:18394938-18394960 GTCACAGGGAAGGGAGGACAAGG - Intergenic
1145156749 17:20549483-20549505 GTCACAGGGAAGGGAGGACAAGG + Intergenic
1145265029 17:21375771-21375793 AGCACAGAGAAGGCAGGAGATGG + Intergenic
1146401948 17:32506532-32506554 ATCAGATAGAAGGCAGGAAAGGG + Intronic
1147160814 17:38568556-38568578 GTCAGAGAAATGGCAGGCCAGGG + Intronic
1147187034 17:38718521-38718543 CCCAGCGAGAAGGCAGGGCAGGG + Intronic
1147550211 17:41436426-41436448 CCCAGAGAGAAGGAAGAGCAGGG + Exonic
1147644407 17:42025254-42025276 CTCATGGTGAAGGCTGGACAAGG + Exonic
1147768685 17:42853183-42853205 CTCAGGGAGGAGGCAGGATTTGG + Intronic
1148177368 17:45578906-45578928 CTCAAAGAGAAGGAAGAACAAGG + Intergenic
1148368451 17:47074291-47074313 CTCAGAAAGTAGTCAGGAGAAGG + Intergenic
1148883335 17:50750317-50750339 ATGAGAGAGAAGGCAGGAAGGGG - Intronic
1149229796 17:54519498-54519520 CACGGAGAGAAGGAAGAACACGG - Intergenic
1149531279 17:57397296-57397318 TACAGTGAGAAGGCTGGACAAGG - Intronic
1149657134 17:58316184-58316206 GGGAGAGAGAAGACAGGACATGG - Intronic
1149682984 17:58518419-58518441 CTAAGAGAGAAGGGAGGGCTGGG + Intergenic
1149734017 17:58975359-58975381 CTCAGAGAAAAGGCTGGGTATGG + Intronic
1150290632 17:63979541-63979563 CCCAGAGATAAGGCAGGTGATGG + Intergenic
1150747985 17:67831809-67831831 CTCAAAGAGAAGGAAGACCAAGG - Intronic
1151625534 17:75273248-75273270 ATCAGAGGGAATGCAGGACGTGG - Exonic
1152411270 17:80124537-80124559 CTCAGAGAGGAGCTAGGACAAGG + Intergenic
1152941707 17:83176202-83176224 CTCAGAGAAAAGGCTGGGCAAGG + Intergenic
1153444783 18:5158746-5158768 CTCAGAGTGTTGGCAGGACTTGG - Intronic
1153560081 18:6362875-6362897 TTCGGAGAGAAGGCTGGAGAAGG + Intronic
1153784481 18:8522642-8522664 CACAGAGAGAAGGGGGGTCAAGG - Intergenic
1153985343 18:10345906-10345928 ATCAGAGAGGAGGCAGGACTGGG + Intergenic
1154176508 18:12089366-12089388 CACAGGGCGAAGGCAGGGCAGGG - Intergenic
1154267662 18:12893227-12893249 CCCAGAGAGAGGGCAGGAGAGGG + Intronic
1154274392 18:12947335-12947357 CTAAGAGCGAAGGCTGGACGGGG - Intronic
1155433580 18:25787553-25787575 GGCAGAGCGAAGGCAGGACAGGG + Intergenic
1155847212 18:30723100-30723122 CTCAGAGAGAAGCCAAGAGCTGG + Intergenic
1156458459 18:37307812-37307834 CTCAGACAGAGGGCAGGGAAAGG + Intronic
1156840281 18:41602942-41602964 TTCAGAGTGAAGGCAGGAAATGG + Intergenic
1157582133 18:48779777-48779799 CCCAGTGGGAAGGAAGGACATGG - Intronic
1157648440 18:49301919-49301941 GTGAGAGAGAAGGAAGGAGAGGG - Intronic
1157901487 18:51522566-51522588 CTCAGCGACAGGGCAGCACATGG - Intergenic
1158471127 18:57737909-57737931 CTCAGTGAGAAAGCAGGAGCAGG + Intronic
1160307230 18:77751345-77751367 CTCAGAGTGAACACAGGACAAGG + Intergenic
1160349343 18:78161053-78161075 CTCAGAGAAATGGCATGTCACGG + Intergenic
1160878839 19:1310549-1310571 CCCAGAGACCCGGCAGGACAGGG - Intergenic
1161486243 19:4537356-4537378 CTCAGCTGGAAGGAAGGACAAGG + Exonic
1161560856 19:4971732-4971754 CTCAGGGAGCAGGCAGGAGGAGG + Intronic
1161636527 19:5392764-5392786 CGCAGACAGATGGCAGGACCAGG - Intergenic
1162444825 19:10716397-10716419 CCCAGTGAGAAGGCAGGAGCAGG - Intergenic
1162461313 19:10815874-10815896 CTTAGAGAGAAGGCAGGCTGGGG + Intronic
1163678082 19:18665541-18665563 CTCAGACAGAGCCCAGGACATGG - Intronic
1164063759 19:21696471-21696493 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1164998997 19:32745134-32745156 CTCTGAAAGAGGGCAGTACAGGG - Intronic
1165253707 19:34559770-34559792 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1165272549 19:34723459-34723481 CTGACAGAAAAGGCAGGACTGGG - Intergenic
1166077524 19:40422477-40422499 CCCAGAGACAAAGCAGCACACGG + Exonic
1166113875 19:40640852-40640874 CCCAGAGAGAAGGCAGGCTGTGG + Intergenic
1166494782 19:43291891-43291913 CTGAGAAAGAATTCAGGACATGG + Intergenic
1167041897 19:47027520-47027542 GGCAGAGAGAAGGGAGAACAGGG - Intronic
1167295053 19:48645070-48645092 CTGCAAGAGAAGGCTGGACAAGG + Intronic
1167315586 19:48761166-48761188 TCCAGAGAGAAGGGGGGACAGGG + Intergenic
1167383895 19:49153158-49153180 CTCAGAGCAAGGGCAGGCCAGGG - Intronic
1167559829 19:50219653-50219675 CTTAGACAGATGGCAGGTCAAGG + Intronic
1167609923 19:50502072-50502094 CCCAGAGACAAGGCTGGCCACGG - Intergenic
1167685726 19:50954853-50954875 CCCAGAGTGAAGGCAAGAGAAGG - Intergenic
1167975881 19:53225651-53225673 CTGAGAGAGGAGGCAGGGCTTGG + Intergenic
1168059889 19:53885002-53885024 CTCAGAGATAAAGCAGAAAAGGG - Intronic
1168268556 19:55236971-55236993 CTAGGAGAGAAGGCAAGGCATGG + Intronic
1168308647 19:55450195-55450217 CTCAGAGAGACAGGGGGACAGGG + Intergenic
1168308675 19:55450305-55450327 CTCAGAGAGACAGGGGGACAGGG + Intergenic
1168308703 19:55450415-55450437 CTCAGAGAGACAGGGGGACAGGG + Intergenic
1168312749 19:55469278-55469300 TTCTGAGAGAAGGCAGGCCTTGG + Intergenic
925407121 2:3613087-3613109 CTAAGAGAGAAGGTAGGGCAGGG + Intronic
925447947 2:3943518-3943540 CTCAGAGGGTAGTGAGGACAAGG - Intergenic
926113468 2:10196825-10196847 CTCAGAGTGAAGACAGGGCTGGG + Intronic
926180062 2:10634546-10634568 CTCAGAGGGAAGGCTGGAGAGGG + Intronic
927502885 2:23593963-23593985 CTCACAGAGAAGACATGGCAGGG - Intronic
927599012 2:24423945-24423967 GAGAGAGAGAAGGCAGGAAAGGG - Intergenic
927784676 2:25965444-25965466 CTCTGAGAGAAAGGAGGAGATGG - Intronic
927992774 2:27459877-27459899 CTCAGGAAAAAGGTAGGACAGGG + Intronic
930463984 2:51721322-51721344 ATCAGAGGAAAGGAAGGACAGGG + Intergenic
931459465 2:62437612-62437634 CTCTTAGAGAAGGCAGGTTATGG + Intergenic
932549519 2:72753706-72753728 TTCAGAGATAATGCTGGACATGG - Intronic
933678162 2:85076369-85076391 CTCAGACAGAAAGCATCACAAGG + Intergenic
933731032 2:85456420-85456442 GTGAGAGAGAAGGCAGGAGGAGG - Intergenic
934041161 2:88128825-88128847 CCCACTGAGAAGACAGGACAAGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934600920 2:95657724-95657746 TTCAGAGAGAAGACAGAAGATGG - Intergenic
935086499 2:99851072-99851094 CTCAGAGAGAAGGGTTCACACGG + Intronic
935144366 2:100384940-100384962 CTAAGGGAGAAGGCAAGAGATGG + Intergenic
935289929 2:101601485-101601507 CTAAGAGAGAATGCAATACAGGG + Intergenic
935981989 2:108636464-108636486 CCCAGGGAGCAGGCAGGACTGGG + Intronic
938093322 2:128447215-128447237 CTCAGGGTGAAGGCAGGAGATGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940958511 2:159755999-159756021 CTCAGAGAAAAGGCAGTTCCAGG - Intronic
941013989 2:160333583-160333605 CTCAGAAGGAAGGCAGGGAATGG + Intronic
942218300 2:173744344-173744366 TGCAGAGAGAAGGGAGGAGACGG - Intergenic
942291672 2:174478508-174478530 CTAAAAAAGAAGGCTGGACATGG - Intronic
942595602 2:177589285-177589307 CTCAGAGAGATGGAAGGAAGAGG - Intergenic
942694363 2:178623440-178623462 CTCTGAAAGAAGGAAGGGCAAGG - Intronic
943444068 2:187961396-187961418 ATCAGAGAGAAGGGAGTACATGG + Intergenic
943650985 2:190457266-190457288 CACAGAGACAAGGAAGGAGAGGG - Intronic
943807369 2:192138684-192138706 CTCAGATTGAAGACAGAACAAGG + Intronic
944332864 2:198492768-198492790 CTCATTGAGAAGGCAAGATATGG - Intronic
944952207 2:204764524-204764546 CTGAGAGAGGAGGAAGGAAATGG - Intronic
945423113 2:209663387-209663409 CACAGTGAGCCGGCAGGACACGG - Intronic
945796610 2:214372034-214372056 CCCAAAGAGAAGACAGGAGAAGG - Intronic
946176756 2:217927078-217927100 CCCCGAGAGCAGGCAGCACATGG + Intronic
946211408 2:218150206-218150228 CTCTGGGAGAATGCAGGAAAGGG - Intergenic
947129348 2:226905326-226905348 CTCTGAGGGGAGGCAGGAGAAGG + Intronic
947752150 2:232538781-232538803 CTCAGAGAGGAGGAAGCTCAGGG + Intergenic
948498066 2:238367596-238367618 CTCAGAGAGACTGTGGGACACGG + Intronic
948745516 2:240089986-240090008 CACAAACAGAAGGCAGGAAAAGG + Intergenic
948861078 2:240752821-240752843 CTCGGAGAGGGGGCAGGACCTGG + Intronic
1169277213 20:4241866-4241888 GTGAGAGAGAAGGCAGGAGGAGG - Intronic
1170993601 20:21329299-21329321 CTCAGAGAAAAGGAAGATCAGGG + Intronic
1171036327 20:21715129-21715151 CAGAGAGAGAAGGAACGACAGGG - Exonic
1171221728 20:23404302-23404324 CTCAGAGACAGGACAGGTCAAGG + Intronic
1172202091 20:33133619-33133641 CTCTGAGAGCAGGGAGGGCAGGG - Intergenic
1172517385 20:35544404-35544426 TTCAGAGAGAGGGCAGGACAGGG + Intronic
1173015625 20:39222914-39222936 CTCAGAGAGAAACCAGGAAAGGG - Intergenic
1173249836 20:41358586-41358608 CCCAGGGAGAAGCCAGGGCAGGG - Intronic
1173866901 20:46318013-46318035 CTCAGACAGAAGGAAGGGAAGGG - Intergenic
1174385512 20:50186568-50186590 CTCAGAGAGGAGGCATGATGGGG + Intergenic
1174479631 20:50821673-50821695 GTCCGAGAGAAGGCAGGCCCTGG + Intronic
1175005056 20:55673050-55673072 CTTAGAGAAAAGGCAGGGAAAGG - Intergenic
1175911975 20:62409308-62409330 ATCACAGGGATGGCAGGACACGG - Intergenic
1175949156 20:62573579-62573601 CTGAGAGAGCACGCAGGACGTGG - Intergenic
1176866382 21:14057038-14057060 CACAGGGTGAAGGCAGGGCATGG + Intergenic
1176995320 21:15548671-15548693 CTCAGAGAGACCCCAGGGCAGGG + Intergenic
1177273375 21:18876740-18876762 CTCAGTGAGAAGTGAGGACCAGG + Intergenic
1177483109 21:21719648-21719670 CACAGCGAGAAGGCAGGACAAGG + Intergenic
1178494241 21:33073230-33073252 CTTAAGGAGAAGTCAGGACAGGG + Intergenic
1178583449 21:33854645-33854667 CTCAGGAAGGAGGCAGGCCACGG - Intronic
1179236143 21:39548127-39548149 CTCAGAGGCAAGACAGAACATGG - Intergenic
1181306348 22:21919393-21919415 GTCAGGAAGAAGGCAGGACTCGG + Intergenic
1181477828 22:23179815-23179837 CTCACAGAGAGGCCAGGACCAGG - Intronic
1182900913 22:33897491-33897513 ATCAGGCAGAAGTCAGGACAGGG + Intronic
1182995422 22:34807835-34807857 GTCAGAGAGGTGGCAGGTCAAGG - Intergenic
1183064890 22:35356013-35356035 AAGAGAGAGAAGGCAGGAGAGGG + Intergenic
1183612548 22:38920000-38920022 CTCAGAGAATAGGGAGGCCAGGG + Intergenic
1183736140 22:39645953-39645975 GTCAGAGAGAAGGCAGGGCTGGG + Intronic
1183856498 22:40638167-40638189 CTCAGAGGGAGGGTAGGAGAGGG + Intergenic
1184533539 22:45071571-45071593 CCAAGAGAGGAGGCAGGGCAGGG + Intergenic
1184863910 22:47192182-47192204 CTCAGAGAGACAGCAGAGCAGGG - Intergenic
949563944 3:5228160-5228182 GGCAGAGAGAAGGCAGGATTTGG + Intergenic
950021342 3:9789833-9789855 CTGGAAGGGAAGGCAGGACATGG - Exonic
950057549 3:10039015-10039037 TTTAGAGAGAAGGGATGACAGGG - Intronic
950152210 3:10696596-10696618 AGCAGAGGGAAGGCAGGGCAGGG - Intronic
950441550 3:13013754-13013776 CTCAGAGACAAGACAGTACTTGG + Intronic
950877007 3:16285002-16285024 CTGAGAGAGTAGGCAGGACTAGG + Intronic
951447105 3:22795547-22795569 GTCAGAGTGAATGCAGGACAGGG - Intergenic
952712032 3:36441232-36441254 CACAGGGAGAAGGGAGGATAGGG - Intronic
953386272 3:42507787-42507809 CTCAGAGTGATATCAGGACAAGG - Intronic
954147292 3:48640715-48640737 CCCAGAGAGGCAGCAGGACAGGG + Intronic
954801581 3:53190015-53190037 CTCAGCCTGAAGGCAGCACAGGG - Intronic
955658236 3:61267666-61267688 TTGAGAGAGAAGGCAGGAGATGG - Intergenic
955911068 3:63860949-63860971 CTGATAGAAAAGGCAGGAAAAGG + Intronic
956096182 3:65718935-65718957 AGCAGAGAGAGGGCAGGAAAAGG - Intronic
956135040 3:66089923-66089945 GAGAGAGAGAAGGCAGAACAAGG + Intergenic
956159482 3:66334148-66334170 CTCAGAGAGAAAGAAGCAAAAGG - Intronic
956858375 3:73298226-73298248 CATAGAGAGAGAGCAGGACAGGG - Intergenic
958450427 3:94266426-94266448 CAAAGAGAGAAGGCAGGGCAAGG + Intergenic
959921383 3:111872121-111872143 CTGAGAGAAAAGGCAACACAGGG - Intronic
960217866 3:115064741-115064763 TTCAGAGAGAAGGCCGGGCACGG - Intronic
960636484 3:119789729-119789751 CTCAGAGAGAAGGCAGGACAGGG - Intronic
961473378 3:127132392-127132414 CATGGAGAGAAGGCAGGAGAAGG - Intergenic
961704086 3:128770686-128770708 CACAGAGACAATGCAGGAGATGG - Intronic
961719225 3:128881319-128881341 CTGAGAGTAAAGGCAGGGCAGGG - Intronic
961728175 3:128946464-128946486 CTCAGAGAGCACGGAGAACAGGG + Intronic
962187872 3:133279292-133279314 CCCAGACAGAAAGCAGGACTTGG - Intronic
963065254 3:141258561-141258583 CTCAGAGAGATTGAAGGAGAGGG + Intronic
963247009 3:143072944-143072966 CACAGAGAAAAGGAAAGACATGG - Intergenic
963720378 3:148855088-148855110 CTGAGAGACAAGGCCGGACCTGG + Intronic
964635024 3:158848983-158849005 CTCAGAGAGAAGGCAGAGTCAGG - Intergenic
965795898 3:172438285-172438307 CTCAGAGTTAGGGCTGGACATGG + Intergenic
966187104 3:177237388-177237410 CTCACAGAGAAGGCTGTGCAGGG + Intergenic
966521790 3:180881555-180881577 CTGAGAAAGAATTCAGGACATGG - Intronic
966524733 3:180908343-180908365 CTCACAAAGAAGGCAGGGCATGG + Intronic
966823207 3:183941438-183941460 CTCAAACAGAAAGCAGGAAATGG + Intronic
967427519 3:189344478-189344500 CTCAGAGATGAGGAAGAACATGG - Intergenic
967697798 3:192553736-192553758 CCCAGAGAGAAGCCAGGAAATGG - Intronic
967826707 3:193882898-193882920 CTAAGAGAGATGGAAGGAAAAGG - Intergenic
968423189 4:502424-502446 CTCAGACTGGAGGCAGGGCAGGG - Intronic
969464311 4:7345844-7345866 CTCAGAGAAAAGAGAGGACAGGG - Intronic
969571415 4:8010891-8010913 CCCAGGGAGAAGGCAGGCTAGGG + Intronic
969707852 4:8821472-8821494 CTCAGAGGGAAGGCTGGATGGGG + Intergenic
970025774 4:11622611-11622633 CCCAGAAATGAGGCAGGACATGG - Intergenic
970287637 4:14535894-14535916 TTCAGTGAGAGGGCAGGATAAGG + Intergenic
970530272 4:16974694-16974716 CTAAAACAGAAAGCAGGACATGG - Intergenic
970545586 4:17127064-17127086 CACAGAGAGTAAGCTGGACAGGG - Intergenic
971197921 4:24487062-24487084 CCCAGAGTCCAGGCAGGACAGGG + Intergenic
972189214 4:36569442-36569464 GGCAGAGAGGAGGCAGGGCAAGG - Intergenic
973082858 4:46015853-46015875 CTTAGAGAGAATGCTGGACAAGG + Intergenic
975933206 4:79552379-79552401 CTCAAAGAAAAGGGAGGTCAAGG - Intergenic
976471930 4:85438954-85438976 CTAAGAGAGAAGGGAGGATTAGG - Intergenic
977700117 4:100012352-100012374 CTCAGACAGAAGGAAGGTGAAGG - Intergenic
978766935 4:112414036-112414058 CTCAGAGAGAGAGAAGGACTGGG + Intronic
980394652 4:132195058-132195080 CACAGAAATGAGGCAGGACAAGG - Intergenic
980971937 4:139575138-139575160 CTCAGAGAGAAGAAATGACCTGG - Intronic
981382596 4:144090561-144090583 GTCAGAGAGAAGATAGGCCATGG + Intergenic
983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG + Intergenic
983697881 4:170554699-170554721 TTCAGAGACATGGCTGGACAAGG - Intergenic
984018948 4:174461137-174461159 CTGAGACTGAAGGCAGGGCATGG + Intergenic
985032654 4:185806230-185806252 CTCAGCGAGAAGTAAGTACAGGG + Intronic
985986241 5:3518870-3518892 CCCATAGAAAAGGCATGACACGG + Intergenic
986168957 5:5300058-5300080 CTAAGAGAGAAGGCAGAGAATGG + Intronic
986255172 5:6096306-6096328 ATCAGAATGAAGGCAGAACAGGG + Intergenic
986620268 5:9665540-9665562 CCTAGAGAGGAAGCAGGACATGG - Intronic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
987360451 5:17101839-17101861 CTAAAAGATGAGGCAGGACAGGG - Intronic
987402416 5:17491778-17491800 CTCAGAGAGGAGAGAGCACAAGG - Intergenic
987418362 5:17689184-17689206 CTCAGGGGGAAGGATGGACAGGG - Intergenic
988184671 5:27845295-27845317 CTCTAAGAAAAGGCAGGTCAGGG + Intergenic
988618984 5:32803155-32803177 CTGAGAAAGAATTCAGGACATGG - Intergenic
989591236 5:43114917-43114939 CTGGGAAAGAAGGCAGGACAGGG - Intronic
990049602 5:51481246-51481268 CTGAGAGAGCAGGCAGGATGAGG + Intergenic
990187167 5:53221446-53221468 CTCAGGGAGAACAAAGGACAGGG - Intergenic
990873084 5:60454968-60454990 CCCAGAGACAAGGCAGGGAAAGG + Intronic
991277437 5:64866145-64866167 CTCAGAGAGTGGGCAGGTCATGG - Intronic
991942389 5:71865180-71865202 CTCAGAGAGGAGTGAGTACAAGG - Intergenic
993466107 5:88249162-88249184 CACAGAAAGAAAGCAGGAAATGG + Intronic
994057837 5:95439582-95439604 CTCAAAGAGAAAGTAAGACAGGG + Intronic
994229699 5:97299012-97299034 CTGAGAAAGAATTCAGGACACGG + Intergenic
994322916 5:98413982-98414004 CTGAGAGAGTAGGGAGTACAAGG - Intergenic
994945370 5:106381082-106381104 CTCAGACAGAAGTCAGGAAGAGG - Intergenic
995184089 5:109253655-109253677 CTGGGAGAGAAGGCAGGAGAGGG - Intergenic
996598525 5:125233221-125233243 GTCAGAGAGAAGGAAGAATAAGG + Intergenic
996636310 5:125693365-125693387 CTCAGTGAGAAGGCAGCAATTGG - Intergenic
997442496 5:133918744-133918766 CACAGAGATGAGCCAGGACAGGG - Intergenic
997775222 5:136598109-136598131 CCCAGTGGGAAGACAGGACAAGG - Intergenic
997841722 5:137247119-137247141 CACGGAGGGAAGGCAGAACATGG + Intronic
998281821 5:140817226-140817248 CTCAGGGAGAAGACAGGAGCTGG + Intronic
998792735 5:145782977-145782999 CTCAGAGAGCGGCCAAGACAGGG + Intronic
999505280 5:152188226-152188248 TTCATAGAGGAGGCAGGAAAGGG + Intergenic
999657937 5:153828861-153828883 CTCAGAGGGTAGGCAGGGCCAGG - Intergenic
999812818 5:155144029-155144051 CTCAGAAAGAAGGGAGGAAAAGG - Intergenic
999969524 5:156845295-156845317 CACAGCGAGAAGGCAGGCAAAGG + Intergenic
999990355 5:157044323-157044345 CTGAGAAAGAAGGAAGGAAAGGG + Intronic
1000014883 5:157267339-157267361 CACAGACAGGAGGCAGGAAATGG - Intronic
1000203281 5:159032891-159032913 CACAGAGAGAAGGGAGGGGAAGG + Intronic
1000251947 5:159503950-159503972 CTGAAAGAGAAGGCAAGAAAAGG - Intergenic
1001563049 5:172682718-172682740 CTCTGAAAGAAGGGAGGACCTGG - Intronic
1001944921 5:175770855-175770877 ATCAGGGAGCAGGGAGGACAAGG + Intergenic
1002293288 5:178214055-178214077 AGCAGAGAGAAGGCGGGACCAGG + Intronic
1003113001 6:3264546-3264568 CCCAGGGGGAAGGCAGGGCAGGG + Intronic
1003514962 6:6810241-6810263 CTCATAGGGAAGGAAGGGCAGGG + Intergenic
1003936063 6:10976567-10976589 CACGGAGAGAAGGCTGGACCAGG + Intronic
1004271422 6:14199528-14199550 CTCAGTGAGATGGCTGGACTAGG + Intergenic
1004616087 6:17290784-17290806 TTGAGGGAAAAGGCAGGACAGGG - Intronic
1005105650 6:22221742-22221764 GTCAAAGAGAGGGCAGGAAAGGG - Intergenic
1005687845 6:28272264-28272286 CCCAGAGAGCAGGGAGGACGTGG + Exonic
1005739178 6:28774840-28774862 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1006376364 6:33673727-33673749 CTCAGCCTGAAGGCAGGGCAGGG - Intronic
1006470673 6:34227027-34227049 CTCAGAGGGAAGGCAGGAGTTGG + Intergenic
1007077334 6:39076140-39076162 CTCAGAGAGAAGGGACAGCAGGG + Intronic
1007077495 6:39077247-39077269 CTCAGAGAGAAGGGACAGCAGGG - Intronic
1007630744 6:43271964-43271986 CTCAGGCAGTAGGCAGGAGAGGG + Intronic
1008133206 6:47741526-47741548 CCAAGAGAGAAGGCAGGACAGGG - Intergenic
1009787780 6:68360660-68360682 CTGAAAGAGAATGGAGGACACGG - Intergenic
1011104144 6:83760165-83760187 TCCAGTGAGAAGGCAGGAGAAGG - Intergenic
1011828717 6:91342291-91342313 CTCAGAGAAAGGACATGACAAGG - Intergenic
1012724648 6:102795037-102795059 CCCAGAGAGGAGGGGGGACAGGG + Intergenic
1012974715 6:105768134-105768156 CTGAGAGATAAGTCAGAACAAGG - Intergenic
1013249759 6:108322379-108322401 GTTAGAGAGAAGGGAGGAAAAGG + Intronic
1015782154 6:136879754-136879776 CTGAGAGAGAAGACAGGTAAAGG - Intronic
1017781720 6:157720627-157720649 CCATGAGAGAAGGCAGGCCAAGG + Intronic
1017869655 6:158476214-158476236 CTCTGGGAGAGGGCAGGGCACGG - Intronic
1018188409 6:161287773-161287795 GACAGAGAGCAGGCAGGGCAGGG + Intergenic
1018384752 6:163292081-163292103 GATAGAGAGAAGGCAGGAGAGGG + Intronic
1018536337 6:164824660-164824682 CTGAGGTAGAAGGCAGGACTCGG + Intergenic
1018708841 6:166483247-166483269 CCCAGAGAAAAGGAGGGACAGGG + Intronic
1019175574 6:170157711-170157733 CACAGAGAGATGGCGGGAGAGGG + Intergenic
1019175583 6:170157752-170157774 CACAGAGAGACGGCGGGAGAGGG + Intergenic
1019221982 6:170480153-170480175 GTCAGAGAGAGAGGAGGACAGGG + Intergenic
1020098696 7:5382483-5382505 CTCAGAGAGAGGCCAGGAAGGGG - Intronic
1020675973 7:11185564-11185586 CTCTAAGAGAAGGGAGGTCAGGG + Intergenic
1021819711 7:24484694-24484716 CTCAGAGAGGTGGGAGGACCAGG - Intergenic
1022359514 7:29644667-29644689 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1022498548 7:30868299-30868321 CACACAGAGTAGGCAGGACTAGG - Intronic
1022517984 7:30987843-30987865 CCCTGAGAGAAGGAAGGGCAGGG + Intronic
1024585123 7:50835524-50835546 CACAGACAGAAGGCAAGCCAAGG - Intergenic
1026850824 7:73722063-73722085 CTTAGGGAGAGGGCAGGAAAGGG + Intergenic
1027177894 7:75916014-75916036 CTCAGAGGCAAGGCAAGGCAAGG - Intronic
1027649636 7:80850597-80850619 TTCAGGGAGAAGGGAGGAGACGG + Intronic
1028194809 7:87893887-87893909 ATCTGAAAGAAGGCAGGAAAGGG - Intronic
1028634727 7:92975229-92975251 TTCACACAGAAGGCATGACATGG - Intergenic
1029625692 7:101718920-101718942 CCCAGGGAGAAGGAAGAACATGG + Intergenic
1029657717 7:101937984-101938006 CTCACAGAAAAGCCAGGAGAAGG + Intronic
1030836748 7:114297086-114297108 TTCAGGGAGAGGGCAGGGCAGGG + Intronic
1031317834 7:120278914-120278936 CTCAGAAAGAAGGGATGAAATGG - Intronic
1031837948 7:126701904-126701926 CTAAGACAGAAGGCATGACATGG - Intronic
1033272451 7:139944810-139944832 CACAGAGAGAGGGAAGGAGAGGG - Intronic
1033308592 7:140242469-140242491 CTAAGAGTGAAAGCAGGAAATGG + Intergenic
1033347378 7:140536060-140536082 TTCATAGAGAAGGCCGGGCATGG + Intronic
1033510964 7:142059886-142059908 CCCCGAGTGAAGGCAGGATAAGG - Exonic
1033513771 7:142086248-142086270 CCCCGAGTGAAGGCAGGATAGGG - Intronic
1033653790 7:143360818-143360840 GTCAGAGAGAAGACAGAAGATGG + Intronic
1034265332 7:149777877-149777899 CACAGGGAGGAGGCTGGACAGGG + Intergenic
1034733451 7:153408443-153408465 ATCAAATAGAAGGCAGGAAAAGG - Intergenic
1034893483 7:154860187-154860209 CTCAGGGAGAAGGTGGGGCAGGG - Intronic
1035813346 8:2512159-2512181 CTCTGAGATAAGGCAGTGCAGGG + Intergenic
1036519732 8:9479939-9479961 CTCAGGGAGAAGCCAGGAGTTGG - Intergenic
1036782510 8:11659312-11659334 CTCTGGAAGCAGGCAGGACAGGG - Intergenic
1037904514 8:22707775-22707797 TTCAGGGAGAAGGGAGGACAGGG - Intergenic
1037930702 8:22878406-22878428 CTCTGAGAGGTGGCAGGACCCGG + Intronic
1038262578 8:26009892-26009914 CAAGGAGAGAAGCCAGGACATGG + Intronic
1038453927 8:27659049-27659071 CTCAGAGAGCATGCACGACCTGG + Exonic
1038679434 8:29653182-29653204 CACACAGAGATGGCAGGACTTGG - Intergenic
1038815818 8:30902960-30902982 CTCAGGGAAAAGGCAAGAGAGGG + Intergenic
1039407820 8:37328046-37328068 CTCAGGGAGGAGGCATGAGAGGG - Intergenic
1039875835 8:41584900-41584922 CTCACAGAGAAGACAGAACATGG - Intronic
1040109311 8:43559621-43559643 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1041175572 8:55193286-55193308 CACAGAGAGAAGGCATGAAAGGG - Intronic
1042053943 8:64742680-64742702 CTCAGTGAGAAGACAAGCCAAGG - Intronic
1042054019 8:64743566-64743588 CTCAGTGAGAAGACAAGCCAAGG - Intronic
1042886153 8:73554379-73554401 CTCAGAGTGCTGACAGGACATGG - Intronic
1043988736 8:86725726-86725748 CTGAGAGAGAAGGCGGGGTAGGG + Intronic
1044396754 8:91721719-91721741 TTCAGAAAGTAGGCAGGAAAAGG + Intergenic
1044580302 8:93819718-93819740 CTCAGAGACAAAGCAGCACATGG + Intergenic
1045324601 8:101109021-101109043 CTCAGAAAACAGACAGGACAGGG + Intergenic
1045362222 8:101443327-101443349 GGCAAAGAGAAGGCAGGAGAGGG - Intergenic
1045830437 8:106453590-106453612 ATAGGAGAGAAGGCAGGAAAAGG - Intronic
1045868903 8:106902938-106902960 AGGAGAGAGAAGGCAGGAGAAGG - Intergenic
1047961310 8:130014055-130014077 CTTAGAGAGAGTGCAGGACTTGG - Intronic
1048236218 8:132693184-132693206 GACAGAGAGAAAGCAAGACATGG + Intronic
1048286027 8:133142454-133142476 TGCAGAGAGAAGGATGGACAGGG - Intergenic
1048747047 8:137625843-137625865 ATCACAGGGAAGGCAGGGCAAGG + Intergenic
1048925365 8:139266513-139266535 CTCTGCTAGAAGGCAGCACATGG + Intergenic
1049447858 8:142639686-142639708 AGCAGAGAAAAGGGAGGACAGGG + Intergenic
1049829948 8:144694089-144694111 TTCAGAGAGAAGGAAGGGGATGG + Intergenic
1050303016 9:4277947-4277969 CTGAGTAAGCAGGCAGGACAGGG - Intronic
1050306244 9:4308514-4308536 CTCAGGGAGGAGGGAGGAGAGGG - Intronic
1050971538 9:11882840-11882862 CAGAGAGAGAGGGCAGGGCAGGG - Intergenic
1051041660 9:12819662-12819684 ACCATAGAGAAGGCCGGACATGG + Intronic
1051413790 9:16817999-16818021 GTCATAGAAAAGGCAGGACTGGG + Intronic
1052575790 9:30289239-30289261 GTCAGAGACAAAGAAGGACATGG + Intergenic
1055815127 9:80195866-80195888 CTCAGTTGGAAGGCAGAACAAGG - Intergenic
1055857866 9:80713321-80713343 CTCAGAGGGAAAGAATGACATGG + Intergenic
1056487747 9:87075942-87075964 CACAGGGAGAAGGCATGCCAAGG + Intergenic
1056808506 9:89746351-89746373 CTCTGGGAGAAGGCAAGGCAGGG + Intergenic
1057290942 9:93807251-93807273 CTCAGGGATCAGGCAGGCCAAGG - Intergenic
1057361443 9:94376981-94377003 CTCAGAGAGGAGGAAAGACCAGG - Intronic
1057420369 9:94907441-94907463 CTCAGAGACCAGCCAGGAGAAGG + Intronic
1057443511 9:95098383-95098405 CTTAGACACCAGGCAGGACAGGG + Intergenic
1057606774 9:96504133-96504155 CTCAGAGGAAAGGAAGGACAAGG - Intronic
1057661918 9:97011189-97011211 CTCAGAGAGGAGGAAAGACCAGG + Intronic
1057706937 9:97401422-97401444 TTCAGAGAGCAGGCAAGGCAGGG + Intergenic
1059336346 9:113570935-113570957 CGATGAGAGAAGTCAGGACAAGG - Intronic
1060522277 9:124300613-124300635 CTCAGGGAGGAGGGAGGGCAAGG + Intronic
1060849958 9:126866404-126866426 CTCAGGGACAAGGAAGGCCATGG - Intronic
1061608711 9:131731533-131731555 AACTGAGAGAAGGAAGGACATGG - Intronic
1061699389 9:132404482-132404504 CTCTCTGAGAAGGCAGGAGAGGG - Intronic
1061909161 9:133713679-133713701 CTCAGACAGAGGCCAGGACACGG + Intronic
1061917584 9:133763310-133763332 CTCAGAGAGAGGGCAGGAAACGG + Exonic
1062188429 9:135231067-135231089 CCCAGAGAGCAGGCAGCAGACGG + Intergenic
1062728927 9:138097663-138097685 CAGAGAGAGAAGGCAGGCCTCGG - Intronic
1185763781 X:2708326-2708348 CACAGAGAGTAGGGAGGAAAGGG - Intronic
1186392974 X:9179931-9179953 CTGAGAGAGAAAGAAGGATAGGG - Intergenic
1187575248 X:20546983-20547005 CTCTGAGACAAGTTAGGACAAGG + Intergenic
1189204390 X:39225360-39225382 CCCAGAGAGAAATCAGGAAATGG + Intergenic
1190914067 X:54797097-54797119 CTGAGAGAGAAGACAGGAGGAGG + Intronic
1192183846 X:68932622-68932644 CTCAGAGAGAAGCAAGGGAAAGG - Intergenic
1192232508 X:69275479-69275501 CTCAGAGAGAAGGGAAGAGTAGG - Intergenic
1195618041 X:106928503-106928525 CACAGAGATAATGCAGGCCAGGG - Exonic
1195619483 X:106938688-106938710 CTAATAGGGAAGACAGGACAAGG + Intronic
1195728667 X:107943217-107943239 GTCAGAGAGCAGGCAGGAAAGGG - Intergenic
1196058124 X:111377971-111377993 AGCAGTGAGAAGGCAGGACCAGG + Intronic
1196390175 X:115198753-115198775 TTCAGGGAGAGGACAGGACAGGG - Intronic
1197756962 X:130002378-130002400 CTGAGAGAGAAGGTGGGGCAGGG + Intronic
1197858639 X:130946596-130946618 ATGAGAGAGATGGCAGGAAATGG - Intergenic
1199558682 X:149138484-149138506 CTCAGAGAGAAAGAAGAAAAAGG - Intergenic
1199601918 X:149546121-149546143 CTCAGTGAGAAGCCTGGTCAGGG + Intronic
1199648468 X:149933363-149933385 CTCAGTGAGAAGCCTGGTCAGGG - Intronic
1199947853 X:152682045-152682067 CTGACAGAAAAGGCAGGGCAGGG - Intergenic
1199961826 X:152786409-152786431 CTGACAGAAAAGGCAGGGCAGGG + Intergenic
1201294239 Y:12450122-12450144 CTGAGAAAGAATTCAGGACACGG - Intergenic