ID: 960636923

View in Genome Browser
Species Human (GRCh38)
Location 3:119793423-119793445
Sequence TGGGATCGCTTGGCCCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960636923_960636935 20 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636935 3:119793466-119793488 GCTGCCTTCTGGAGGCTGTAGGG 0: 1
1: 1
2: 12
3: 148
4: 819
960636923_960636929 -2 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636929 3:119793444-119793466 CAACTCTGCCCAATCAGTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 108
960636923_960636926 -5 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636926 3:119793441-119793463 TCCCAACTCTGCCCAATCAGTGG 0: 1
1: 0
2: 1
3: 12
4: 203
960636923_960636933 12 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636933 3:119793458-119793480 CAGTGGAGGCTGCCTTCTGGAGG 0: 1
1: 0
2: 5
3: 29
4: 281
960636923_960636934 19 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636934 3:119793465-119793487 GGCTGCCTTCTGGAGGCTGTAGG 0: 1
1: 0
2: 4
3: 91
4: 715
960636923_960636938 24 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636938 3:119793470-119793492 CCTTCTGGAGGCTGTAGGGGAGG 0: 3
1: 17
2: 71
3: 218
4: 797
960636923_960636932 9 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636932 3:119793455-119793477 AATCAGTGGAGGCTGCCTTCTGG 0: 1
1: 0
2: 0
3: 18
4: 159
960636923_960636936 21 Left 960636923 3:119793423-119793445 CCACCGTGGGCCAAGCGATCCCA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 960636936 3:119793467-119793489 CTGCCTTCTGGAGGCTGTAGGGG 0: 1
1: 0
2: 36
3: 240
4: 916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960636923 Original CRISPR TGGGATCGCTTGGCCCACGG TGG (reversed) Intronic