ID: 960637828

View in Genome Browser
Species Human (GRCh38)
Location 3:119801539-119801561
Sequence GGGAGCAGGACTGCAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 425}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960637819_960637828 28 Left 960637819 3:119801488-119801510 CCTGCCCAGAGGGCAACATTCTG 0: 1
1: 0
2: 3
3: 15
4: 177
Right 960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG 0: 1
1: 0
2: 2
3: 45
4: 425
960637820_960637828 24 Left 960637820 3:119801492-119801514 CCCAGAGGGCAACATTCTGTAAA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG 0: 1
1: 0
2: 2
3: 45
4: 425
960637821_960637828 23 Left 960637821 3:119801493-119801515 CCAGAGGGCAACATTCTGTAAAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG 0: 1
1: 0
2: 2
3: 45
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960637828 Original CRISPR GGGAGCAGGACTGCAGCTGC TGG Intronic
900334383 1:2154283-2154305 GGGGGCAGGTCTGCAGCTCAGGG + Intronic
900362048 1:2293833-2293855 GTGAGCAGGCCTGTGGCTGCAGG + Intronic
901628069 1:10634840-10634862 GGGAGGGGGCCTGCAGCTGCGGG - Intergenic
901737343 1:11320693-11320715 AGGAGCAGGAAGCCAGCTGCCGG - Intergenic
901836287 1:11926078-11926100 GGGACCAGGGCAGCAGGTGCAGG + Exonic
901876458 1:12169538-12169560 GGGAGCATGAGTGCAGATACGGG - Intronic
902322383 1:15677223-15677245 GGGGGGATGCCTGCAGCTGCAGG + Intergenic
902581765 1:17412224-17412246 GGGTGCAGGTCTGGGGCTGCTGG - Intronic
902597816 1:17521034-17521056 GGGAGGAGGAATGCAGCTGGTGG + Intergenic
903049325 1:20589174-20589196 GGGAGCAAACCAGCAGCTGCTGG - Exonic
903178638 1:21594709-21594731 GGGAGCAGGGGTGCGGCTGATGG + Intergenic
903279098 1:22239892-22239914 GGGAGTAGGCCTTCAGCTGGGGG - Intergenic
904043629 1:27598133-27598155 GGGTGCAGAGCTGCAGCTTCTGG + Intronic
904495479 1:30884160-30884182 GGCACGAGGACTGCACCTGCTGG + Intronic
907307895 1:53523692-53523714 AGGGACAGGACTGCAGCTGGGGG - Intronic
907420479 1:54343534-54343556 GGGAGCAGGTCTGCCTCTGAAGG + Intronic
908751935 1:67431920-67431942 GGGTGCAGGACTGAGGCAGCAGG - Intergenic
908840534 1:68275968-68275990 GGGAGCAAAACTGTAGCTCCAGG + Intergenic
911006311 1:93228305-93228327 AGGAGGAGCACTGCAGCTACTGG + Intronic
911054445 1:93698256-93698278 TGGCGCAGGACTGCATTTGCTGG + Intronic
911104462 1:94118906-94118928 GATAACAGGACTGTAGCTGCTGG - Intronic
913154714 1:116084663-116084685 GGGTGCAGGGCTGAGGCTGCAGG + Intergenic
915213337 1:154325579-154325601 GGGAGCGGGGCCGCAGCTGGGGG + Intronic
915511979 1:156391473-156391495 GAGAGCAGGGCTGCTGGTGCAGG - Intergenic
915723411 1:158000736-158000758 GGGATGAGGACTGCAGCCCCTGG - Intronic
915932618 1:160069730-160069752 AGGAGCAGGGATGCAACTGCTGG + Intronic
917345156 1:174022047-174022069 GGGAGCGGGGCTGCCGCGGCCGG - Intronic
918416962 1:184320033-184320055 GGGAGCAGGACTGGAGGGGTGGG - Intergenic
919739568 1:200973718-200973740 GGGAGGTGGACTGCAGGTGGTGG + Intronic
921317412 1:213905415-213905437 GGAAGCAGGGCTGGAGCTGCTGG + Intergenic
922718551 1:227888980-227889002 GAGAGCAAGACTGCAGCTGGCGG + Intergenic
923056499 1:230430003-230430025 GGGAGAAAGAGTGCAGCTGCTGG + Intergenic
923701190 1:236301826-236301848 AGGAACTGGAGTGCAGCTGCTGG - Intergenic
923750775 1:236744488-236744510 AGGGGCAGGACTGAAGATGCAGG - Intronic
924173380 1:241364641-241364663 GGGAGCAGAGCTCCAGCAGCTGG + Intergenic
924362283 1:243254767-243254789 GGCCGCAGGACTGGAGCTCCGGG + Intronic
924438558 1:244067581-244067603 GTGAGCAGGGCTCCCGCTGCAGG + Intergenic
924948064 1:248858977-248858999 GCGAGCAGGCCCGGAGCTGCTGG + Intronic
1063127578 10:3149225-3149247 GGGAGGACGACAGCAACTGCAGG + Intronic
1063298584 10:4831280-4831302 GGAAGCAGCACGGCAGGTGCAGG + Intronic
1063871471 10:10422015-10422037 GTGAGCAAGACTGGAGCAGCGGG - Intergenic
1064346513 10:14537418-14537440 GGAAGCTGGAATGCAGATGCGGG - Intronic
1064557259 10:16559715-16559737 AGGAGGTGGACTGCTGCTGCAGG - Intergenic
1066402547 10:35090137-35090159 GGGAGCCGGGCTGCAGGCGCCGG - Intronic
1067003012 10:42635383-42635405 GGGGACAAGACGGCAGCTGCAGG + Intronic
1067763462 10:49068364-49068386 GGGAACAGTAGAGCAGCTGCAGG + Intronic
1067941293 10:50659321-50659343 GTGAGCAGGACAGCTGCTACGGG + Intergenic
1069650384 10:70042858-70042880 GAGAGCAGCACTCCAGATGCAGG + Intergenic
1069863655 10:71486850-71486872 TGGAGCTGCAATGCAGCTGCTGG + Intronic
1070581026 10:77719660-77719682 GGGAGCAGGACTGAAGAAGAAGG - Intergenic
1070862513 10:79684192-79684214 GCGAGCAGGACAGCTGCTACGGG + Intergenic
1071015912 10:80997077-80997099 AGGAGGTGGACTGCTGCTGCAGG - Intergenic
1072470316 10:95707148-95707170 GGGACCTGGTCTGCAGCTGTTGG + Intergenic
1072483226 10:95829458-95829480 GGCAGCAGGAGAGAAGCTGCTGG + Intronic
1072566030 10:96617448-96617470 GGGGGTTGGTCTGCAGCTGCAGG + Intronic
1073465605 10:103693102-103693124 GAGCGCGGGGCTGCAGCTGCAGG + Intronic
1074096626 10:110318922-110318944 GGAAGCAAGGCTGAAGCTGCAGG - Intergenic
1074493016 10:113955744-113955766 GGGAGCAGGAAGGCAGCTGTAGG - Intergenic
1075247080 10:120832260-120832282 GGGAGGTGGAATGCTGCTGCAGG + Intergenic
1075645149 10:124092256-124092278 GGGAGCCGGATGGCAGCGGCCGG - Intronic
1076140133 10:128071700-128071722 GGGAGCAGGCCTGCTGCAGCAGG + Intronic
1076252038 10:128992883-128992905 AGGAGCATGACTGCAGTTGGAGG - Intergenic
1076687774 10:132205854-132205876 GGGAGAAGAGCTGCGGCTGCAGG - Intergenic
1076924588 10:133475942-133475964 GGGCTGAGGACTGCAGCTGAAGG + Intergenic
1077138535 11:1013350-1013372 GTGACCAGGAAAGCAGCTGCTGG + Exonic
1077499411 11:2902462-2902484 GGGAGCAGGGCAGCCGCAGCAGG - Exonic
1077500306 11:2907046-2907068 GGGAGCAGGGATGGAGCTGAAGG + Intronic
1078143692 11:8709091-8709113 GGGAGCAGAGCAGCAGGTGCTGG + Intronic
1078578213 11:12518755-12518777 CCGAGCAGAACTGCTGCTGCAGG + Intronic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1078909815 11:15720487-15720509 TGGAGCCAGACTGCATCTGCGGG - Intergenic
1081622170 11:44625036-44625058 ATGAGCAGGACTGCAGCTGGGGG + Intergenic
1081867978 11:46370039-46370061 GGGCTCAGGACCGCAGGTGCAGG - Intronic
1081906879 11:46675803-46675825 GGGAGCAGGGCCAGAGCTGCAGG - Intergenic
1081937813 11:46917498-46917520 GGGAGCTGGACGGCTGCAGCAGG - Intronic
1082732333 11:56815316-56815338 GGGAACAGGACTACTTCTGCAGG - Intergenic
1083383910 11:62293248-62293270 GGGAGGAGGAATGTAACTGCAGG - Intergenic
1083609206 11:63997238-63997260 GGGAGGGGGACGGCACCTGCTGG - Exonic
1083775027 11:64890430-64890452 GGGCCCAGGACCCCAGCTGCTGG - Intergenic
1083813254 11:65117233-65117255 CGGAGCCGGACCGCAGCTTCTGG - Exonic
1084747635 11:71183405-71183427 GGCCACAGGGCTGCAGCTGCTGG + Intronic
1085038648 11:73314201-73314223 GGGAGCATGACTGGAGCCTCAGG - Intronic
1085217210 11:74843438-74843460 TGGTGCAGGACAGCACCTGCAGG + Exonic
1085369465 11:75986470-75986492 CACAGCAAGACTGCAGCTGCAGG - Intronic
1085768163 11:79301892-79301914 GGAAGCATGACAGCATCTGCTGG - Intronic
1085989573 11:81825509-81825531 GGGAGCAGGATTGCAAGTGATGG + Intergenic
1088735309 11:112723689-112723711 GGGAGCAGGGCTTCAGATGCAGG - Intergenic
1088752225 11:112853803-112853825 TGGGACAGGACTGCAGCTCCTGG - Intergenic
1088853711 11:113727233-113727255 AAAAGCAGAACTGCAGCTGCAGG + Intergenic
1090066738 11:123510194-123510216 GGGAGAAGGTCAGCAGCTGGTGG - Intergenic
1090135200 11:124190632-124190654 GGGGGTAAGCCTGCAGCTGCAGG + Intergenic
1090136321 11:124203168-124203190 GACAGCAGGACAGCAGCTGTGGG - Intergenic
1091488995 12:916638-916660 CGGACCAGGACTGCAGCTCCCGG - Exonic
1092633154 12:10407286-10407308 AGGAGCAGGACTGCTGGGGCTGG + Intronic
1093074473 12:14743468-14743490 GGGGGTATGCCTGCAGCTGCAGG - Intergenic
1093435552 12:19130497-19130519 GGGGGCAAGACGGCAGCTGGGGG - Intronic
1095402633 12:41832746-41832768 TGGAACTGGACTGCATCTGCTGG - Intergenic
1098106060 12:67069602-67069624 GGCGGCAGGACTGAGGCTGCGGG + Intergenic
1099721533 12:86367379-86367401 GGGAGTATGCCAGCAGCTGCAGG + Intronic
1100190531 12:92186363-92186385 AGGAGCTGCACCGCAGCTGCTGG - Intergenic
1100315933 12:93444231-93444253 GGGGGAAGGGCTCCAGCTGCAGG - Intergenic
1102111853 12:110371083-110371105 GGGGTCAGGCCTGCAGCTGTTGG + Intergenic
1102156518 12:110734198-110734220 CAGAGCAGGACTGCTGCTGTGGG - Intronic
1103587011 12:121963513-121963535 GGGAGCAGGGCGTCCGCTGCTGG + Intronic
1103907827 12:124336301-124336323 GGGAGCAGGGATGGGGCTGCGGG - Intronic
1104964602 12:132503236-132503258 GGGAGCTGGGCTGCCCCTGCAGG - Intronic
1107453676 13:40535491-40535513 GGGAGATGGAGTGGAGCTGCTGG - Intergenic
1108679175 13:52764661-52764683 GGGAGAGGGGCGGCAGCTGCTGG + Intergenic
1109198874 13:59409338-59409360 GGGATCAGGACTGCAGCAGCTGG + Intergenic
1112692984 13:101916926-101916948 GAGAGCGGGACCGCGGCTGCGGG + Intronic
1114696657 14:24632538-24632560 TGGGGCAGGGCTGCAGCTGAGGG + Intronic
1117499850 14:56340693-56340715 AGGAGCTGGATTGCAGCTGGTGG - Intergenic
1118723161 14:68608537-68608559 TGGAGGAGGAGAGCAGCTGCAGG + Intronic
1118957734 14:70498023-70498045 GGGAACATGACTGCAACTGCAGG + Intergenic
1119620079 14:76125406-76125428 GGCAGCAGGACCACAGATGCTGG - Intergenic
1119707209 14:76790517-76790539 GGTAGCATGTCTTCAGCTGCTGG - Intronic
1120745398 14:88147079-88147101 AGGCCCAGGTCTGCAGCTGCTGG - Intergenic
1121558002 14:94852781-94852803 GGGTGCTGGACTGCAGCTCCGGG - Intergenic
1121973965 14:98385529-98385551 AGGCCCAGGTCTGCAGCTGCGGG - Intergenic
1122293543 14:100692639-100692661 GGCTGCAGGACAGCAGCCGCAGG - Intergenic
1122480227 14:102042453-102042475 GGAAGCAGGCATGCGGCTGCAGG - Exonic
1122586069 14:102807378-102807400 GGCAACAGGACTCCAGGTGCAGG - Intronic
1122953482 14:105059096-105059118 GGGAGACTGACTGCACCTGCTGG - Intronic
1122994673 14:105256621-105256643 GACCGCAGGACTGCACCTGCAGG + Intronic
1123409143 15:20044125-20044147 GGGAGCAGGACAACTGCTACCGG - Intergenic
1123518474 15:21050833-21050855 GGGAGCAGGACAACTGCTACCGG - Intergenic
1126150872 15:45522726-45522748 GGGAGCCGGCCTCCAGCAGCGGG - Exonic
1127122404 15:55782987-55783009 GAGAACAGGACTGTAGCTGGAGG + Intergenic
1128150119 15:65357844-65357866 GGGAGTAGTTCGGCAGCTGCAGG - Intronic
1128226332 15:66003880-66003902 TGGAGCAGGACTGTGGGTGCAGG - Intronic
1129081819 15:73048040-73048062 GGGAGCATGGATGGAGCTGCAGG - Intergenic
1129140957 15:73597381-73597403 GGGAGCAGGAATGCAGTGACAGG + Intronic
1129552815 15:76472048-76472070 GGATGCAGGAATGCAGCAGCAGG - Intronic
1129872280 15:78948162-78948184 AGGCTGAGGACTGCAGCTGCTGG + Intronic
1131173060 15:90192005-90192027 GGGTGGAGAGCTGCAGCTGCAGG + Intronic
1131270220 15:90942687-90942709 GGGACCAGACTTGCAGCTGCAGG + Intronic
1131830692 15:96352892-96352914 GGGTGGAGGGCTGCAGCTCCAGG - Intergenic
1132628960 16:907453-907475 CGGAGCTGGACGTCAGCTGCAGG - Intronic
1132696277 16:1203466-1203488 GTGAGCAGGAATGCGGCTGTGGG + Intronic
1132708118 16:1255110-1255132 GGGAGCTGGACTGGGGCTGTGGG + Intergenic
1132777900 16:1606057-1606079 AGGAGCAGGACAGCAGCTCGGGG + Intronic
1133009704 16:2904426-2904448 CGGAGCGGGACTGAGGCTGCGGG - Intergenic
1133221382 16:4320551-4320573 GGGGGCAGGAGTGGAGCTGGGGG - Intronic
1133233297 16:4376426-4376448 GGGTGCAGGACAGGCGCTGCAGG - Intronic
1135134327 16:19876457-19876479 GGGTGCAGGCCTGCTGCTGAGGG - Intronic
1136630248 16:31485701-31485723 GGGGGCAGTACTGCCGCTGAGGG - Intronic
1136933444 16:34437644-34437666 GGGAGCGGGGCTGCGGCTCCCGG + Intergenic
1136971128 16:34974170-34974192 GGGAGCGGGGCTGCGGCTCCCGG - Intergenic
1136996704 16:35195638-35195660 AGGAGGAGGAGTGGAGCTGCAGG - Intergenic
1137300444 16:47143721-47143743 GGGAGCGGGGAGGCAGCTGCTGG - Exonic
1138459141 16:57137823-57137845 GGGAGCCAGCCTGCAGCTGGGGG - Intronic
1138906277 16:61338933-61338955 GGGAGCATGGATGCAGCTGGAGG + Intergenic
1139427892 16:66894500-66894522 GGGACCAGGACTGTAGCCACAGG - Intronic
1139477584 16:67210385-67210407 GGTAGCTGGGCTGCAGCTTCAGG - Exonic
1139582179 16:67880247-67880269 GGGAGCAGGTGGGCAGCAGCAGG + Intronic
1140512196 16:75516785-75516807 AGGAGCCGGGCTGCAGCTCCCGG + Intergenic
1140666029 16:77228382-77228404 GCTAGCAGTACTGCTGCTGCTGG + Intergenic
1140933823 16:79652589-79652611 GAGTGCAGGACTGAAGCTGGTGG + Intergenic
1141285383 16:82667154-82667176 TGGAGCAGGAATGCAGCAGTAGG + Intronic
1141506762 16:84483171-84483193 GGGGACAGCTCTGCAGCTGCAGG - Intronic
1141620867 16:85235935-85235957 GGGAGCGAGGCTGCAGCAGCCGG + Intergenic
1141699846 16:85637387-85637409 CGGAGCAGAAAGGCAGCTGCGGG - Intronic
1141955056 16:87365201-87365223 GGGGTCAGGACTTCTGCTGCAGG + Intronic
1142131631 16:88433956-88433978 GAGAACAGGCCAGCAGCTGCTGG - Exonic
1142312356 16:89321373-89321395 CGGGGCAGGACTGGGGCTGCAGG + Intronic
1142344487 16:89545329-89545351 GGGAGCAGGAGTTCAGCTCATGG + Intronic
1142387504 16:89775283-89775305 GGGAGCAGTGGTGCAGCTGTCGG - Intronic
1142805703 17:2370066-2370088 GGGAGCTGGACTCCAGCTCTGGG - Intronic
1143272624 17:5687074-5687096 GGAACCAGGACTGAAGCTGAAGG + Intergenic
1143288895 17:5813696-5813718 GGAAGCAGGAAAGCAGCTGGAGG - Intronic
1144442602 17:15297374-15297396 GGCAGCTGAACTTCAGCTGCTGG - Intergenic
1144506877 17:15839267-15839289 GCGAGTAGGACTGCAGATTCTGG + Intergenic
1144520680 17:15950609-15950631 GGGAGCAGGAGTCCAGCTGGGGG - Intronic
1144686510 17:17229514-17229536 GAGAGCAGAATGGCAGCTGCCGG + Intronic
1145990403 17:29075882-29075904 GGAGGCAGGGCTGCAGCTCCAGG - Exonic
1146285006 17:31568434-31568456 GGTGGCAGGGCTGCAGATGCTGG + Intergenic
1146507040 17:33414424-33414446 GGGAGGAGGACTGGAGCAGTGGG + Intronic
1146581644 17:34043880-34043902 GGGAGGGAGACTGCAGCTGAAGG - Intronic
1147453165 17:40518887-40518909 GGGCGCAGGCCTGCAGGTGGAGG - Intergenic
1148052835 17:44777586-44777608 AGGAGCTGGACTGCAGGTGCTGG + Exonic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148774454 17:50087821-50087843 GGGTGCAGGGCTGCTGCTGCTGG + Exonic
1150007090 17:61476664-61476686 GGCAGCAGGTCCCCAGCTGCAGG + Intronic
1150141738 17:62736000-62736022 GGGAGCAGGATGGCAGCCTCTGG - Exonic
1150288279 17:63966276-63966298 GGGAGGAGCACTCCAGCTGGGGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151318071 17:73336240-73336262 GGCAGCACATCTGCAGCTGCCGG - Exonic
1151658150 17:75505139-75505161 GGTTGCCGGACCGCAGCTGCAGG - Intronic
1151757106 17:76081372-76081394 GGAAGCAGGGCACCAGCTGCTGG - Exonic
1151981856 17:77516498-77516520 GGGAGCATGAATGGAGCTGGAGG - Intergenic
1152382451 17:79949116-79949138 GGGAGCTGGGCGGCTGCTGCCGG + Intronic
1152388429 17:79988940-79988962 GGCAGGAGGACTGAAGGTGCTGG - Intronic
1152437817 17:80286868-80286890 GGAACCAGGACTGCGGCTGGTGG - Intronic
1152844900 17:82593661-82593683 GGGAGCCGGGCTGAGGCTGCGGG + Intronic
1152855500 17:82663062-82663084 GGGAGCAGGACAGGGGCTGACGG + Intronic
1203192808 17_KI270729v1_random:205333-205355 GGGAATAGGCCTGCAGCTGAAGG + Intergenic
1203202172 17_KI270730v1_random:4768-4790 GGGAATAGGCCTGCAGCTGAAGG + Intergenic
1153614979 18:6925917-6925939 GGGGGTATGCCTGCAGCTGCAGG + Intergenic
1154316050 18:13304099-13304121 GAGTCCAGGACTGCAGCAGCAGG - Intronic
1156368700 18:36453418-36453440 AGTTGCAGGACTCCAGCTGCTGG - Intronic
1157232790 18:45934842-45934864 GGGAGGAGGAGAGCTGCTGCAGG + Exonic
1157422843 18:47560534-47560556 GGACTCAGGACAGCAGCTGCAGG + Intergenic
1157744066 18:50119391-50119413 GGGAGATGGAATGCAGCTGTTGG - Intronic
1158312816 18:56177130-56177152 CTGAGCAGGACGGCAGGTGCGGG + Intergenic
1160308588 18:77766672-77766694 GGGAGCAAGAGGGCTGCTGCCGG - Intergenic
1160574304 18:79842048-79842070 GGTGCCAGGACTGCAGCTACAGG + Intergenic
1160879720 19:1313871-1313893 GGGGGCTAGACTGCAGCAGCTGG - Intergenic
1161173319 19:2824261-2824283 AGGCCCAGGTCTGCAGCTGCGGG + Intronic
1161234298 19:3190273-3190295 GGGAGCAGGGGTGAGGCTGCTGG + Intronic
1161951403 19:7470000-7470022 GGGCGCAGGACTGTGTCTGCCGG - Exonic
1162001565 19:7747475-7747497 GGAACCAAGACTGCAGCAGCTGG - Exonic
1162478663 19:10915599-10915621 AGCTGCAGGGCTGCAGCTGCTGG - Intronic
1163154600 19:15432891-15432913 GGGCGGACGGCTGCAGCTGCTGG + Intronic
1163384251 19:16989654-16989676 GGGAGGGTGGCTGCAGCTGCAGG + Exonic
1163685408 19:18709371-18709393 GGGAGAAGGGCTGCAGCAGGGGG + Intronic
1164649071 19:29879183-29879205 GGGCACAGAAGTGCAGCTGCAGG + Intergenic
1166645028 19:44525199-44525221 GTGAGCTGGGCTGCAGCTGGAGG + Exonic
1166744999 19:45137484-45137506 GGGACCGGGGCTGCAGCTGTTGG + Intronic
1167351022 19:48974718-48974740 GGGGGAAAGACTGCCGCTGCAGG + Exonic
1167513270 19:49908254-49908276 AGGAGCAGGAGCGCAGCTTCCGG - Exonic
1167774838 19:51548101-51548123 GGGGGTATGCCTGCAGCTGCAGG + Intergenic
1168281246 19:55306519-55306541 GGGCCCAGGAGTGCAGCAGCAGG + Intronic
925597375 2:5569015-5569037 CAGAGCAGCACTGCAGCTGAGGG - Intergenic
927055899 2:19365343-19365365 AGGAGCAGGAGTGCCACTGCAGG + Intergenic
927291273 2:21407341-21407363 GGGGGCAGGACTGGGGCTGGAGG + Intergenic
927930292 2:27039529-27039551 GTGTGCAGGAATGCAGCTGCCGG - Intronic
928361083 2:30662872-30662894 GGGACCAGGGCTTCAGGTGCAGG + Intergenic
929709933 2:44256430-44256452 GTGTGCAGGGCTGCAACTGCTGG - Intergenic
932437702 2:71712382-71712404 GGGGGCAGGATTTTAGCTGCAGG + Intergenic
933588602 2:84207097-84207119 GTGGGCAGGCCTGCATCTGCAGG - Intergenic
935145998 2:100395864-100395886 GGGAGCAGGAGTGGAAATGCTGG + Intronic
935431366 2:102979612-102979634 GGAAACAGGCCTGCAGGTGCAGG - Intergenic
936177112 2:110233368-110233390 GGGAGCAGGAGGGCAGCGGTGGG + Intergenic
936204273 2:110436063-110436085 GGGAGCAGGAGGGCAGCGGTGGG - Intronic
937033844 2:118764173-118764195 GGGAGCAGCACTTCACCGGCTGG + Intergenic
941542663 2:166805962-166805984 GGGAGCAGGAGCCCAGCTGGAGG - Intergenic
941592647 2:167438854-167438876 GGGAGAAAGACAGCAGCTTCAGG + Intergenic
946302829 2:218834723-218834745 TGGAGGAGGACTCCAGCTGGGGG + Intergenic
946373495 2:219294734-219294756 GGGAGCAGAGCAGCAGCGGCCGG + Intronic
946374464 2:219299752-219299774 GGCTGCAGGAGTGAAGCTGCTGG - Exonic
947258941 2:228198978-228199000 GGGATCAGGACTACAGCTAGGGG - Intergenic
948227396 2:236321980-236322002 GGGGGTATGCCTGCAGCTGCAGG + Intergenic
948375095 2:237516004-237516026 GGAAGCAGGACTGCGGGTGCAGG - Intronic
948619777 2:239227158-239227180 GGGACCAGGACTGGAGGTGAAGG + Intronic
948899521 2:240949352-240949374 GGGTACAGGGCTGCAGCTGGAGG - Intronic
1168999388 20:2156117-2156139 TGGAGCTGGCCTGGAGCTGCTGG - Intronic
1169142520 20:3234390-3234412 GGGGGCTGGACTGCTGCGGCTGG - Intronic
1169197738 20:3692534-3692556 GGCAGCAGGACGGGAGCTGCGGG + Exonic
1169825849 20:9767952-9767974 AGCAGCATGAATGCAGCTGCAGG + Intronic
1170041251 20:12041976-12041998 AGGAGCAGGAATGGAGCTGGAGG - Intergenic
1170300604 20:14880661-14880683 GGGAGGCTGACTGCAGCTGAAGG - Intronic
1171023411 20:21607626-21607648 GGGTGCTGGACAGCAGCAGCTGG + Intergenic
1171029622 20:21665611-21665633 GGGGTCAGGATTGCAGCTGCAGG + Intergenic
1171032718 20:21691692-21691714 TGGGGCAGGAGTGCAGCTGGTGG + Intergenic
1171306799 20:24113548-24113570 TGGAGCTGGACAGCAGCAGCAGG + Intergenic
1171332740 20:24356033-24356055 GGGAGCAGGACCCCAGCAGCAGG - Intergenic
1172773481 20:37394662-37394684 GGGACCAGGACTGCAGTTGGGGG - Intronic
1172883805 20:38218203-38218225 AGGAGCAGGACTGGAGCAGATGG - Intronic
1173788516 20:45812641-45812663 GAGAACACGACTGCAACTGCAGG - Exonic
1174515086 20:51085846-51085868 GGGGGTAGGACTGGAGCTTCTGG - Intergenic
1175783807 20:61699734-61699756 GGGAGCAGGCCTGCTGCTGGGGG + Intronic
1175839973 20:62020423-62020445 TGGAGCTGGACAGCAGCTGAGGG - Intronic
1176010456 20:62890902-62890924 GGGAGGAGGGGTGCAGGTGCAGG + Intronic
1176099508 20:63358561-63358583 GGCAGCAGGGCTGGAGCTGGCGG + Intronic
1176260968 20:64179640-64179662 GGGAGCTGGACCGAGGCTGCAGG - Intronic
1178076657 21:29019032-29019054 TGGAGCAGGGCTGCAGAAGCCGG + Intronic
1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG + Intronic
1179420285 21:41230236-41230258 GGTAGCAGGGATGCAGCTGAAGG - Intronic
1179561065 21:42216554-42216576 AGGAGCAAGCCTGCAGCTGCTGG + Intronic
1179929755 21:44559378-44559400 GGGAGCAGGGAGGCAGCTGCAGG + Intronic
1180183134 21:46126847-46126869 GGGAGCTGGGCGGCAGCTGAGGG - Intronic
1180592541 22:16953544-16953566 TGGACCAGGGCTGTAGCTGCTGG + Intergenic
1180773417 22:18404823-18404845 GGGAGCGGGGCAGCTGCTGCGGG - Intergenic
1180804768 22:18654372-18654394 GGGAGCGGGGCAGCTGCTGCGGG - Intergenic
1181567121 22:23745826-23745848 AGGAGCAAGACTCCAGCTACTGG + Intronic
1181616107 22:24055387-24055409 GGGATCAGGGATGCAGCTCCTGG + Intronic
1182369064 22:29798276-29798298 GGGTGCAGGCCTGGAGCTCCAGG - Intronic
1182642972 22:31783224-31783246 GGGACCTGGGCTGCCGCTGCTGG - Intronic
1183079679 22:35448418-35448440 GGGAAGATGACTCCAGCTGCTGG - Intergenic
1183539767 22:38423266-38423288 GGGAGCCTCCCTGCAGCTGCGGG + Intergenic
1184408346 22:44312805-44312827 GGGAAGAGGCCAGCAGCTGCAGG - Exonic
1184454390 22:44600919-44600941 GGGAGAAGGACTGGAGCGTCCGG + Intergenic
1184574851 22:45355252-45355274 TGCAGCAGGACTGCACCTCCAGG - Intronic
1184599438 22:45533839-45533861 GCCAGCGGGACAGCAGCTGCGGG + Exonic
1184642044 22:45877908-45877930 GGGAGCTGGACTCCAGCTCGCGG + Intergenic
1184677211 22:46050271-46050293 GGGATCAGGTCTGCAGCCCCAGG + Exonic
1184710139 22:46244954-46244976 GGGAGCAGCACTGCAGCCCAGGG - Exonic
1184710729 22:46247916-46247938 GGGAGCAGCTCAGCAGCTGGGGG - Intronic
1184920949 22:47605580-47605602 GGATGCAGGGCTGCAGCAGCCGG - Intergenic
1185018523 22:48359562-48359584 GGAAGGAACACTGCAGCTGCTGG - Intergenic
1185064060 22:48621861-48621883 CGGAGCAGGGCTGCATCTGCAGG + Intronic
1185278434 22:49959920-49959942 TGGAGGTGGACAGCAGCTGCTGG + Intergenic
1185330500 22:50250109-50250131 AGGGGCTGGACTGCAGCTGGTGG - Exonic
950088734 3:10279778-10279800 GGCAGAAGGACTTCAGCTGCTGG + Exonic
950142544 3:10625373-10625395 GGGAGGAGTCTTGCAGCTGCAGG + Intronic
950423636 3:12913070-12913092 AGGATCAGGTCTGGAGCTGCTGG + Intronic
950450125 3:13060698-13060720 GGGGGCAGGGCTGATGCTGCTGG - Intronic
950766555 3:15277470-15277492 GGGAGAAGGCCTGCTGCTGTAGG + Intronic
950811362 3:15652494-15652516 GGAAGCTTGACTGCAGCTGGAGG - Intergenic
952991876 3:38837386-38837408 GGGAGCAGGAAAGTAGCTTCAGG + Intergenic
953023492 3:39130900-39130922 GGGATCAGGACTTCAGCTAATGG - Intronic
953541796 3:43826200-43826222 GGGAGCTTGACTGTAGCTGAGGG + Intergenic
953844550 3:46417021-46417043 GTGAGCAGGCCTACAGGTGCTGG - Intergenic
953875305 3:46663289-46663311 GGCTACATGACTGCAGCTGCTGG - Intergenic
954317631 3:49809915-49809937 GAGAACAGGTCTGCAGCTGAGGG + Intronic
954440142 3:50517269-50517291 GGAAGCAGGACTCAAGCTGTCGG + Intergenic
954672916 3:52300076-52300098 GGCAGCAGGAGGGCAGCAGCAGG - Intergenic
956264092 3:67378335-67378357 GGGAGCAAGACTGAAGCCACAGG - Intronic
956534011 3:70255542-70255564 GGCAGGAGGACTGAGGCTGCAGG - Intergenic
956756074 3:72388283-72388305 GTGAGCACCACGGCAGCTGCTGG + Intronic
957846458 3:85743074-85743096 GGGAACAGGGATGCAGCTTCAGG - Intronic
958636508 3:96753382-96753404 GGGATCAGGCATGCAGCAGCAGG + Intergenic
959090628 3:101899048-101899070 GGAAGCAGAACTGCTGTTGCTGG + Intergenic
960637828 3:119801539-119801561 GGGAGCAGGACTGCAGCTGCTGG + Intronic
960991472 3:123314361-123314383 GGTGGCAGGGCTGCAGCTTCTGG + Intronic
961292813 3:125861359-125861381 GAGAGCAGGATGGCAGCTGATGG - Intergenic
963361014 3:144271830-144271852 GGGAGCAGGGCTGTAGGGGCAGG + Intergenic
964791928 3:160460635-160460657 AGGCCCAGGTCTGCAGCTGCAGG + Intronic
965132849 3:164723656-164723678 GGGAGCAGGCCTGTGACTGCTGG - Intergenic
966427307 3:179793028-179793050 GAGACCAGGAGTGCAGCTGCTGG + Intergenic
968581436 4:1397147-1397169 GGCTGCAGGACTGCACCTGAGGG - Intergenic
968805874 4:2772087-2772109 GGGAGCAGGGTTGCTGCTGGGGG + Intergenic
969053532 4:4388051-4388073 GGGAGGAGCAGGGCAGCTGCGGG - Intronic
969329185 4:6463332-6463354 AGGACCAGGACTGTTGCTGCTGG - Intronic
969527788 4:7712813-7712835 GCGAGGAGGACTACAGCTCCTGG + Exonic
969713003 4:8855103-8855125 GGGAGAGGGACTGCAGGCGCTGG - Intronic
969982070 4:11167986-11168008 GGGAACATGACTGTGGCTGCAGG - Intergenic
972806409 4:42533161-42533183 AGGAGGAAGACTGCTGCTGCAGG + Intronic
977714371 4:100165530-100165552 GGGAGGGGCATTGCAGCTGCTGG + Intergenic
977800503 4:101224544-101224566 GGGAGAAAGACAGCAGCAGCAGG + Intronic
979516367 4:121614707-121614729 GGGAGAAGGAGTGCAGATGCAGG - Intergenic
981190791 4:141860315-141860337 GGGAGAAGGACTTCTGCTTCTGG + Intergenic
982678316 4:158400787-158400809 GGGAGGAGGACAGAAGCTGCTGG + Intronic
982772727 4:159412873-159412895 GGGAGAGGGACCTCAGCTGCTGG + Intergenic
985570973 5:644698-644720 GGTGTCAGGGCTGCAGCTGCTGG + Intronic
985644982 5:1080560-1080582 GGGACCAGAAGGGCAGCTGCAGG + Intronic
985750302 5:1669820-1669842 GGGAGCCGGTGTGCAGCTGCTGG - Intergenic
986384289 5:7216503-7216525 GGGAGCAAGCATGCAGATGCTGG + Intergenic
987110130 5:14678208-14678230 GGGAGCAGCTCTGCAGGTGCGGG + Intronic
987563522 5:19555284-19555306 AAGAGGTGGACTGCAGCTGCAGG + Intronic
987644348 5:20649056-20649078 GGGAGCAGGGCTGCAGCCCATGG - Intergenic
988373497 5:30403387-30403409 GGGCGCAGGACTGCAGAGTCAGG - Intergenic
991953237 5:71967083-71967105 GGCAGCAGTCCTGCAGCTGGGGG + Intergenic
992943228 5:81783523-81783545 GGGATCAGGTTAGCAGCTGCAGG + Intergenic
997364915 5:133319501-133319523 AGGAGCAGGACTGCGCGTGCAGG + Intronic
997660104 5:135582775-135582797 GGGAGGAGCACTGCAGGTGGAGG - Intergenic
998570436 5:143252045-143252067 GGGTGCAGGCCTGGAGCTGCTGG - Intergenic
999033445 5:148320110-148320132 GGGCGCAGGACAGTAGGTGCAGG + Intergenic
999799539 5:155019951-155019973 AGGCCCAGGTCTGCAGCTGCCGG + Intergenic
1000178506 5:158783581-158783603 GGGAGCAGAAGTGTTGCTGCCGG - Intronic
1000993179 5:167932089-167932111 GGGAGTCTGACTGCAGGTGCAGG + Intronic
1002092759 5:176814543-176814565 AGGGGCTGGACTGAAGCTGCGGG - Intronic
1002260524 5:177990911-177990933 GGGAGCAGGGCTGCAGGCACAGG + Intergenic
1002409064 5:179060184-179060206 GGCAGGAGGTCTCCAGCTGCTGG - Intergenic
1002428190 5:179187977-179187999 GGGAGGTGGCCTGCGGCTGCTGG + Intronic
1002521706 5:179796085-179796107 GGGAGCGGGACCGAAGCTGGGGG + Intronic
1002887864 6:1312145-1312167 GGGAGCGGGAAGGCGGCTGCGGG + Intergenic
1004428367 6:15522127-15522149 GGGAGCAGGACTGCAGTGTGGGG - Intergenic
1004959960 6:20776905-20776927 GGGAGCAGCAAAGAAGCTGCTGG - Intronic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006084451 6:31586498-31586520 GGGAGCAGAAGTGCAGGTGGAGG - Intronic
1006290140 6:33128578-33128600 ATGAGCAGGGGTGCAGCTGCTGG + Intergenic
1006378372 6:33684193-33684215 GGCAGCAGGGGTGCAGCGGCAGG + Intronic
1006399258 6:33806939-33806961 GGGAGGAGGACTGCAGATGGCGG + Intergenic
1006431079 6:33996252-33996274 GGGGGTAGGACTGCGGCTGGGGG + Intergenic
1006741052 6:36309263-36309285 GGGTGCAGGACGGCAGCTCGAGG + Intergenic
1007828004 6:44615996-44616018 TGGAGCAGGGCTACACCTGCAGG + Intergenic
1008039153 6:46777413-46777435 GAGAGATGGACTGCAGCAGCAGG + Intergenic
1008142934 6:47852963-47852985 GGTCGCAGAACTTCAGCTGCAGG - Intergenic
1008482227 6:51997730-51997752 GGCATCAGGACTGCAGATGAGGG + Intronic
1009436054 6:63619723-63619745 GGGAGAAGGAGTCTAGCTGCTGG - Intergenic
1010083163 6:71886942-71886964 GGAAGCAGGGGCGCAGCTGCTGG + Intronic
1011063251 6:83295034-83295056 GGGAGCATGGCTGCAACTGTGGG + Intronic
1012171701 6:96024479-96024501 GGGAGCAGGACTCCTGTGGCTGG + Intronic
1013228156 6:108136001-108136023 GGCAGGAGGATTGCAGCTGAAGG - Intronic
1015279541 6:131418726-131418748 GGGTTCAGGAATGCAGCTGCAGG + Intergenic
1015662611 6:135592055-135592077 GGCAACATGAATGCAGCTGCAGG - Intergenic
1018074412 6:160198796-160198818 AGGAGCAGGACTGCAGCTGGTGG + Intronic
1018383729 6:163284285-163284307 GGGGCCAGGCCAGCAGCTGCTGG + Intronic
1018596681 6:165488607-165488629 AGGAGGTGGATTGCAGCTGCAGG + Intronic
1018699695 6:166416624-166416646 GGGAGCAGGGATGGAGCTGATGG - Intronic
1018699704 6:166416660-166416682 GGGAGCAGGGATGGAGCTGATGG - Intronic
1018963599 6:168466388-168466410 GAGAGCAGGACTCCAGCTGTGGG - Intronic
1019158941 6:170056895-170056917 GGGGGCAGGACTGTAGGTGTGGG - Intergenic
1019164665 6:170090109-170090131 GGGAGCAAGGCTGCAGCTGTGGG - Intergenic
1019204162 6:170344957-170344979 GGGCAGAGGACTGCTGCTGCAGG - Intronic
1019357389 7:587742-587764 TGGAGCGGGACTCCAGCTGCTGG + Intronic
1019736222 7:2651011-2651033 GGGAGCAGGTCTGGAGGTGGGGG + Intronic
1019985371 7:4651514-4651536 GGGACCAGGCCTGCTGCTCCTGG + Intergenic
1020056551 7:5121482-5121504 GGGAGAAGCCCTGCGGCTGCAGG - Intergenic
1020097256 7:5376123-5376145 GTGAGAAGAGCTGCAGCTGCTGG + Exonic
1020171351 7:5847491-5847513 GGGAGAAGCCCTGCGGCTGCAGG + Intergenic
1020560837 7:9727566-9727588 GGGAGAGTGGCTGCAGCTGCAGG - Intergenic
1020568146 7:9822893-9822915 AGGCCCAGGTCTGCAGCTGCGGG + Intergenic
1020582565 7:10023023-10023045 GGGACCAAGACTGAAGCTACAGG - Intergenic
1022348309 7:29539509-29539531 GTGAGCAGGACTGCATCTTGTGG + Intergenic
1022390551 7:29940047-29940069 GGCAGCAGGGGTGCAGCTGAGGG + Intronic
1022812810 7:33886121-33886143 GGTAGCATGACAGCAGCTGCTGG - Intergenic
1023864130 7:44230850-44230872 TGGAGCAGGATTACAGCTACAGG + Intronic
1023895686 7:44431182-44431204 GTGCCCAGGCCTGCAGCTGCAGG - Intronic
1023912443 7:44565571-44565593 GGCAGCAGGGCTGCAGGAGCTGG + Exonic
1024354710 7:48402801-48402823 GGCACCATGACTTCAGCTGCTGG + Intronic
1025244376 7:57305308-57305330 TGGCTCAGGACTGCAGCTGGAGG + Intergenic
1025994328 7:66518611-66518633 GGGAGCAGGACAGAGGCAGCAGG - Intergenic
1026985938 7:74555300-74555322 GGGAGCAGGACAGAGGCAGCAGG - Intronic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1029698006 7:102227385-102227407 AGGGGCAGGGCTGCAGCTGGCGG - Exonic
1029781954 7:102744089-102744111 AGGCCCAGGTCTGCAGCTGCTGG - Intergenic
1030455745 7:109772301-109772323 AGGAGGTGGACTGCTGCTGCAGG + Intergenic
1030972270 7:116075392-116075414 GGGAACTGGATTGCTGCTGCAGG + Intronic
1032457345 7:132083459-132083481 GGGAGCAGCATTGGGGCTGCTGG - Intergenic
1033596886 7:142865157-142865179 GGGAGAATGACTGCAGCAGCAGG + Intronic
1034423448 7:151000993-151001015 GGGACCAGGCATGCAGATGCTGG + Intronic
1034901124 7:154908560-154908582 GGGAGTAGGACCTGAGCTGCAGG - Intergenic
1034912896 7:155012018-155012040 GGGAGCAGGGGTGCAGGTGCAGG - Intergenic
1034943132 7:155244886-155244908 TGGGGGAGGACTGCAGCCGCTGG - Intergenic
1034947159 7:155269876-155269898 GGCAGCAATACTGCAGCTCCAGG + Intergenic
1035108614 7:156462288-156462310 GAGAGCAGGACTACAGTTTCAGG + Intergenic
1036953911 8:13166810-13166832 GGGAGAAAGACTGCAGGTGCTGG + Intronic
1037392585 8:18409503-18409525 GGGTGTATGCCTGCAGCTGCAGG - Intergenic
1041282003 8:56219672-56219694 GGGGGCAGAACTAGAGCTGCAGG + Intergenic
1042216592 8:66434456-66434478 GGGAGCAGCACTGCCACAGCAGG + Intronic
1045002156 8:97887994-97888016 GGCAGCGGGCCTGCAGCTCCTGG + Intronic
1047361762 8:124175628-124175650 GGGAGCAGAACTGGGGCTGCTGG - Intergenic
1049176835 8:141197893-141197915 GGGAGCGGGGCTGAAGCTGGCGG + Intergenic
1049317525 8:141977255-141977277 GGGAGCAGGGCTGCAGGTCTGGG + Intergenic
1049419248 8:142509792-142509814 GGGTGCAGCTCTGCAGCTGCAGG - Intronic
1049427173 8:142542684-142542706 GAGGGCAGGGCTGCAGCAGCTGG + Intronic
1049475584 8:142795633-142795655 TGGAGCAGGAGTCCAGCGGCAGG + Intergenic
1049603285 8:143517935-143517957 GGGGCCAGGACAGCAGCTCCAGG + Intronic
1050153763 9:2643912-2643934 AGGAGCAGGACTGCAGGGACTGG + Exonic
1052240105 9:26261604-26261626 GGGGGTATGCCTGCAGCTGCAGG - Intergenic
1052603603 9:30671277-30671299 GGGAGCAGCATGGGAGCTGCTGG + Intergenic
1054754870 9:68947400-68947422 GGCAGGAGGACAGAAGCTGCTGG - Intronic
1055942958 9:81667698-81667720 GGGAGCAGGAATACAGCTCAAGG - Intronic
1057009761 9:91590768-91590790 GGGAGCAGGCATGGAGCTGTGGG - Intronic
1057092856 9:92275728-92275750 TGGAGCAGCACTGCTGCTCCTGG - Intronic
1057475688 9:95399333-95399355 GGGATGAGGCCTGCTGCTGCCGG + Intergenic
1057727075 9:97575269-97575291 TGGATCAGGAGTGAAGCTGCAGG - Intronic
1058785465 9:108382369-108382391 GGAAGCTTGACTGGAGCTGCAGG + Intergenic
1058923511 9:109640441-109640463 GGGAGCAGGGCGGCTGCGGCTGG - Intergenic
1059450471 9:114368408-114368430 GGGAGAAGAGCTGCAGCTGGAGG - Intronic
1060309568 9:122447168-122447190 GGGGGTATGCCTGCAGCTGCAGG + Intergenic
1060311243 9:122464439-122464461 GGGAGGTGGATTGCTGCTGCAGG - Intergenic
1060555427 9:124505135-124505157 GGGAGCCGGGCTGCGGCTGGGGG - Intronic
1061246135 9:129402074-129402096 AGGAGCAGGGCTGCAGGTTCAGG - Intergenic
1061277411 9:129577313-129577335 GGGAACAGCATTGCAGCTGGAGG + Intergenic
1061804587 9:133131014-133131036 GGGAGCAGAACAGCAGAGGCGGG + Intronic
1061959099 9:133979026-133979048 GAGAGCAGGTCTGCAGGTCCCGG + Intronic
1062039948 9:134399929-134399951 TGGAGCAGGCCTGAGGCTGCTGG + Intronic
1062074396 9:134576637-134576659 AGGAACAGGATTGCAGCTCCTGG + Intergenic
1062568497 9:137173747-137173769 GGGTGCTGGGCGGCAGCTGCAGG + Intergenic
1185841232 X:3393363-3393385 GGGAGCTGGACTCTAGATGCAGG - Intergenic
1186063716 X:5739060-5739082 GGGGGTATGCCTGCAGCTGCAGG + Intergenic
1190072954 X:47293807-47293829 GGGGGTATGCCTGCAGCTGCAGG - Intergenic
1190122776 X:47676214-47676236 GGGGGTATGCCTGCAGCTGCAGG + Intergenic
1190789537 X:53686308-53686330 GGGGGCAGCCCGGCAGCTGCCGG - Intronic
1191175928 X:57501882-57501904 GGGAGCAGGACAGTGGGTGCAGG + Intergenic
1191257705 X:58286853-58286875 GGGCCCAGGACAGGAGCTGCTGG - Intergenic
1192168695 X:68841474-68841496 GGGAACAGGAGAGCTGCTGCAGG + Exonic
1192174013 X:68874649-68874671 GGGAACAGGGCAGCAGCTGAAGG + Intergenic
1192592204 X:72369666-72369688 GGGAGCAGGAGACCAGCTGTTGG - Intronic
1198931590 X:141867372-141867394 GGGAGTATGCCTGCAGCTGCAGG + Intronic
1198932208 X:141873263-141873285 GGGAGTATGCCTGCAGCTGCAGG - Intronic
1199591309 X:149470633-149470655 GGCCGCAGGAATACAGCTGCTGG - Intergenic
1199745341 X:150768936-150768958 CAGAGCAGCACAGCAGCTGCGGG + Exonic
1200001777 X:153065799-153065821 GGGAGCTGGAAGGCAGCTGTGGG + Intergenic
1200068046 X:153514355-153514377 GGGAGCGGGACTGAAGGGGCTGG + Intergenic
1200822988 Y:7606936-7606958 GGGGGTATGCCTGCAGCTGCAGG - Intergenic
1200878145 Y:8181103-8181125 GGGGGTATGCCTGCAGCTGCAGG - Intergenic
1201070877 Y:10146413-10146435 GGGAGCAGGCCGTGAGCTGCTGG - Intergenic
1202237067 Y:22724159-22724181 GGGGGTATGCCTGCAGCTGCAGG + Intergenic