ID: 960638263

View in Genome Browser
Species Human (GRCh38)
Location 3:119804907-119804929
Sequence GTGTGCTTGTTGAAATGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960638263 Original CRISPR GTGTGCTTGTTGAAATGTCT AGG (reversed) Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900480708 1:2897742-2897764 CTGTGCTGGTTTAGATGTCTTGG - Intergenic
903152708 1:21423525-21423547 GTGTTCTTGATGAAACGTTTAGG + Intergenic
903160421 1:21484460-21484482 GTGTTCTTGATGAAACGTTTAGG - Exonic
904893251 1:33795004-33795026 GTGGGCCTGTAGCAATGTCTAGG + Intronic
905360453 1:37415876-37415898 GTGTGCTTGCTTATATGTGTTGG - Intergenic
907591490 1:55676486-55676508 TTTTGCTTGTTGAATTGTTTAGG + Intergenic
910694694 1:89999562-89999584 GGGTGATTGTTGGAATCTCTTGG + Intronic
910745910 1:90574856-90574878 CTGGGCTTGCTGACATGTCTGGG + Intergenic
912848517 1:113100567-113100589 GTGTGCTTTTGGAAATAACTTGG - Intronic
913221598 1:116664969-116664991 GTGTGCATGTTGGAATCACTGGG - Intronic
916578484 1:166087782-166087804 GTGTGATGTTTGAAATGTGTAGG + Intronic
918918709 1:190676428-190676450 GTGAGCATGTGGAAATGTTTAGG + Intergenic
921487566 1:215733222-215733244 ATCTGGTTGTTTAAATGTCTAGG - Intronic
1063335957 10:5213553-5213575 GAGTGCCTGTTGAAATCTTTGGG + Intronic
1063394093 10:5670418-5670440 GTTTGCTTGTTCAAATGGCTAGG + Intergenic
1064189302 10:13191757-13191779 GTATGCTTTTTAAAATTTCTTGG + Intronic
1064813393 10:19228678-19228700 GTGTTCTAATTGAAATGTGTTGG - Intronic
1067081495 10:43215061-43215083 GTGTGCTTGTCCACATGTCCAGG - Intronic
1067509724 10:46884897-46884919 GTGTTTTTGTTGAAATATCTAGG + Intergenic
1067652530 10:48166961-48166983 GTGTTTTTGTTGAAATATCTAGG - Intronic
1068450524 10:57180739-57180761 CACTGTTTGTTGAAATGTCTTGG + Intergenic
1069197229 10:65567895-65567917 GTGTGTTTGTTGGGATGTGTGGG + Intergenic
1070458097 10:76637879-76637901 ATGGGCTTGTTGAACAGTCTAGG + Intergenic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1073827150 10:107336972-107336994 GGGTGTTTCTAGAAATGTCTGGG + Intergenic
1076079542 10:127566275-127566297 GTGTGCTTTCTCCAATGTCTTGG + Intergenic
1077142935 11:1032627-1032649 GTGTGCATGTTTGCATGTCTGGG + Intronic
1079130942 11:17746579-17746601 CTGTGCTTGTGGAAAGTTCTAGG + Intronic
1079778941 11:24573771-24573793 GTGTGCTTTTTAAAGTTTCTAGG - Intronic
1081451718 11:43177278-43177300 GTGAGCTTAATGAAAAGTCTGGG - Intergenic
1083556736 11:63635282-63635304 GTGTGTTTGGTGAAAAGACTAGG + Intronic
1089042933 11:115470981-115471003 GTGTCCTGGTTAAAAAGTCTGGG - Intronic
1089920868 11:122208288-122208310 GTGAGTTTGTTGAAAAGTCATGG - Intergenic
1090171127 11:124605449-124605471 ATGTGCATGCTGAAATGTTTAGG + Intergenic
1090516287 11:127431273-127431295 TTTTGCTTGTTGAATTGTGTAGG + Intergenic
1090632595 11:128663106-128663128 ATGTGCTTGTAAAAAGGTCTGGG - Intergenic
1092916491 12:13194261-13194283 GTGTGCTTTTGGAGATGTCTAGG - Intergenic
1097529753 12:60783388-60783410 GTATGCCTGTTGAAATCTCATGG - Intergenic
1099450855 12:82804730-82804752 GAGTGCTACTTGAAATTTCTGGG - Intronic
1102913875 12:116738345-116738367 CTGTGATTGCTGAATTGTCTGGG + Exonic
1104183336 12:126404019-126404041 GTCTGGTTGTTTAAAAGTCTGGG - Intergenic
1105567135 13:21560749-21560771 TTATGCTTGTAGAAATGTCTAGG + Intronic
1105653194 13:22403074-22403096 TTGTTTTTGTTGGAATGTCTGGG + Intergenic
1105802493 13:23920253-23920275 TTTTGCTTGTTGAATTGTTTAGG - Intergenic
1106719640 13:32425329-32425351 GTGTGTTTATAGAAAAGTCTGGG - Intronic
1106948973 13:34861494-34861516 CTGTGGTTGTTTAAAAGTCTAGG + Intergenic
1107296795 13:38917576-38917598 TTTTGCTTGTTGAATTGTTTAGG + Intergenic
1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG + Intronic
1108729442 13:53218853-53218875 GTGTGCATGCTGTAATCTCTAGG - Intergenic
1110262618 13:73502431-73502453 GTGTGTGTGTTCAAATGCCTAGG - Intergenic
1110964225 13:81671450-81671472 GTGTGTTGGTTTAGATGTCTAGG - Intergenic
1112486928 13:99828277-99828299 GTGTGTGTGTTGAAATATATGGG - Intronic
1113323272 13:109258267-109258289 GTGGGTTTGTAGAAATGTCAGGG + Intergenic
1114238575 14:20844764-20844786 GTATGCATGCTGAAATTTCTAGG + Intergenic
1116946810 14:50843076-50843098 GTGTGCTGCTTAAAATGTCAAGG - Intergenic
1117819799 14:59636317-59636339 GTGTGGTTGTTTAAGAGTCTGGG + Intronic
1120150084 14:81023015-81023037 GTGTGCATGTGGAGATCTCTTGG + Intronic
1122664386 14:103318509-103318531 CTGTGCTTGTTGTATTGGCTTGG - Intergenic
1124122300 15:26898364-26898386 GGGTGCTTGTTGAAGCGTGTGGG - Intronic
1126687543 15:51261547-51261569 GTGTGTTTCTTCAAATGTATGGG + Intronic
1126944175 15:53800194-53800216 GTTTCCTTGTTGTAATGTCTTGG - Intergenic
1128706394 15:69840232-69840254 GTGTGTGTGTGTAAATGTCTGGG - Intergenic
1133403549 16:5505871-5505893 GTTTGCTGGTAGAAATGTCATGG - Intergenic
1133648149 16:7783885-7783907 GTGAACTTGCTGAACTGTCTTGG + Intergenic
1133985298 16:10663766-10663788 TTTTGGTTGTTGAAATGGCTGGG - Intronic
1140165847 16:72549934-72549956 TAGTGTTTGATGAAATGTCTAGG - Intergenic
1140230992 16:73116951-73116973 ATGTGCTTTGTGAAGTGTCTGGG + Intergenic
1140318863 16:73928195-73928217 GTGTGCTCATTGAAATTTCCAGG + Intergenic
1140424510 16:74849576-74849598 GTGTGCTTGTTGATATGGTTTGG + Intergenic
1142056642 16:88001275-88001297 GCGTGCATGTTGACGTGTCTGGG - Intronic
1143625482 17:8108213-8108235 GTGGGCTTGTGGAAAGGTCAAGG + Intronic
1148225928 17:45897584-45897606 GTGCGCCTCTGGAAATGTCTGGG + Intronic
1155276395 18:24192107-24192129 TTGTGTGTGTTCAAATGTCTTGG - Intronic
1155640818 18:28011940-28011962 CTGTGCTTACTGAATTGTCTTGG + Exonic
1156318092 18:35989820-35989842 ATGTTCTTTTTGAAATGTGTAGG - Exonic
1157015354 18:43705918-43705940 ATCTGCTTGTTCAAAGGTCTTGG + Intergenic
1157831769 18:50862598-50862620 GGCTGCTTGTGGAAATGGCTTGG + Intergenic
1157872895 18:51246733-51246755 GTGTGCTAGTTCAGATCTCTTGG - Intergenic
1157976270 18:52330688-52330710 GCAAACTTGTTGAAATGTCTGGG - Intergenic
1158123200 18:54073084-54073106 GTTTGATACTTGAAATGTCTCGG - Intergenic
1163066978 19:14804320-14804342 GTGTGGTTGCTGAAGTCTCTAGG - Intronic
1164923907 19:32110896-32110918 GTTTTGTAGTTGAAATGTCTCGG - Intergenic
1168174685 19:54616857-54616879 GGGTGCTTGTGGGAATGTCTGGG + Intronic
927210504 2:20636210-20636232 GTGGGCTTGTTGATCTCTCTTGG - Intronic
927282684 2:21324133-21324155 ATATGCTTGTTAAAATTTCTAGG - Intergenic
928494642 2:31819580-31819602 GTGTCCTTGTCCAAATTTCTTGG - Intergenic
928762587 2:34602463-34602485 GTGTGCAATTTGAGATGTCTGGG - Intergenic
931343577 2:61425997-61426019 GGGTGTGTGTAGAAATGTCTGGG - Intronic
931590961 2:63882858-63882880 CTGTGGTTGTTGAAATCTCTGGG + Intronic
933654150 2:84873802-84873824 GTCTGGTTCATGAAATGTCTGGG + Intronic
933802284 2:85971544-85971566 TTATGCTTTTTGAAATGTATTGG + Intergenic
935131729 2:100265646-100265668 CTCTGCAGGTTGAAATGTCTGGG - Intergenic
935499890 2:103826081-103826103 TTGTGCTTGTTGATTTGTTTAGG + Intergenic
936919012 2:117668956-117668978 GTTGGCTTTTTGAAATGTCTGGG + Intergenic
937085052 2:119166034-119166056 GTGAGCTTGTTGCAGTGTCTGGG + Intergenic
937221996 2:120347036-120347058 GTGTGCTTGTTGATATACGTGGG + Intronic
939257258 2:139759893-139759915 GTGTGCATCTAGAAATGTCTGGG + Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
940797213 2:158092835-158092857 GTATGCTTGTTGAAATGTAAGGG + Intronic
944620675 2:201512385-201512407 AGGTCCTTGTGGAAATGTCTAGG - Intronic
944912298 2:204322605-204322627 GTGTGCTTGTGGAAGAGTTTTGG - Intergenic
946580292 2:221121075-221121097 GTGTGCTTCTTAGAATGTCCTGG + Intergenic
948082053 2:235214522-235214544 CAATGCTTGTTGAAATGTCATGG - Intergenic
948156174 2:235783893-235783915 ACGTGCATGTTGAAATGTGTGGG + Intronic
948688531 2:239687504-239687526 GTTTTCTTCTGGAAATGTCTCGG + Intergenic
948705855 2:239792126-239792148 GTGGGCATGCTGAAAGGTCTGGG - Intronic
1171073580 20:22099908-22099930 GTGTGAATGTGGAAAAGTCTGGG + Intergenic
1175089470 20:56489922-56489944 GTTTGCCTGTAGAAATGTGTGGG + Intronic
1176256279 20:64154764-64154786 GTGTGCTTGTTGGAATGATGGGG + Intronic
1178229915 21:30770488-30770510 GTGTAATTGGTTAAATGTCTGGG + Intergenic
1180657126 22:17431912-17431934 GTGTGCCTGCTGAAAGGTTTGGG - Intronic
1183527908 22:38334924-38334946 GTGTGTTTGTAGAAAGGACTTGG - Intronic
1185230226 22:49676198-49676220 GCGACCTTGTTGAAATGTCCAGG - Intergenic
949818915 3:8093894-8093916 GTGTGTTTGTTTAAGTGTGTGGG - Intergenic
950462196 3:13131442-13131464 ATGTGGTTATTGAAATGTTTAGG + Intergenic
951802211 3:26608341-26608363 GTGTGCTGTTGGAAATGTGTGGG - Intergenic
952580055 3:34822973-34822995 CTGGGCTTGTTGGCATGTCTCGG + Intergenic
953637383 3:44674660-44674682 GTGAGCTTCCTGAAATATCTGGG - Intergenic
955461873 3:59192147-59192169 TTGTGCTGGGGGAAATGTCTGGG - Intergenic
955815287 3:62836085-62836107 ATGTGCATGTTGAAATCACTTGG + Intronic
957035180 3:75287811-75287833 GTGTTCTTGCTGAAATGCCTGGG + Intergenic
957766038 3:84625171-84625193 GTGTTCTTGTCAAAGTGTCTAGG - Intergenic
958033661 3:88146338-88146360 GGGGACTTGTTTAAATGTCTTGG - Intronic
958132096 3:89440473-89440495 GTGTAATTGCTGAAATTTCTGGG - Intronic
958728457 3:97934593-97934615 CTGTGCTGGTTTAAATATCTGGG + Intronic
959544609 3:107579418-107579440 GTGTGTTTGCTTAAGTGTCTGGG - Intronic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
960991570 3:123314936-123314958 TTTTGCTTGTTGAACTGGCTAGG - Intronic
961079066 3:124009411-124009433 GTGTTCTTGCTGAAATGCCTGGG + Intergenic
961206892 3:125090917-125090939 GTGTGATTATTGATATGGCTGGG + Intronic
961304413 3:125947061-125947083 GTGTTCTTGCTGAAATGCCTGGG - Intergenic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962782763 3:138736551-138736573 ATGTTTTTGTTGAAATATCTTGG - Intronic
962975166 3:140439886-140439908 GTGTGCATGTTTATATGTCTGGG + Intronic
964342794 3:155725989-155726011 GTATGCATGTTAAAATGTCTAGG - Intronic
965453840 3:168872997-168873019 GTGTACTTGTAGTAATTTCTGGG + Intergenic
966576084 3:181504244-181504266 GTGTGCTTGTTTGCATGTATAGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
971570885 4:28209564-28209586 ATCTGGTTGTTGAAAAGTCTGGG + Intergenic
972114779 4:35617960-35617982 TTTCGCTTGTTGAATTGTCTAGG - Intergenic
972250969 4:37300721-37300743 GTGTACTTATTAAAATTTCTAGG - Intronic
973906440 4:55536483-55536505 ATCTGGTTGTTGAAAAGTCTGGG + Intronic
976281610 4:83332386-83332408 GTGTGCTTGTCGATGCGTCTGGG + Intronic
976612795 4:87047193-87047215 GTTTGCTGGTTGGAATGTATAGG - Exonic
977608386 4:99006483-99006505 GTGTATTTGTTGAAATATTTTGG + Intronic
979418403 4:120472567-120472589 ATGTGCATGTTGAAATATGTAGG + Intergenic
981782040 4:148442016-148442038 GTGTGCTTGTTGTTTTGTTTTGG - Intronic
983267026 4:165518041-165518063 CTGATCTTGTTGAAATGGCTAGG + Intergenic
984311488 4:178066061-178066083 CAGTGCTAGTTGAAATGACTAGG - Intergenic
985074024 4:186195105-186195127 TTTTACTTGTTGAAAGGTCTGGG + Intronic
987230499 5:15889009-15889031 GTGTCCCTGTAGAAATATCTGGG + Intronic
989333918 5:40292004-40292026 TGGAGCTTGTTGAAAAGTCTAGG - Intergenic
990249757 5:53901644-53901666 GTGTGCATATTGAAATGGCTAGG + Intronic
990290007 5:54340452-54340474 GTGTCCTTATTAAAATGTCAGGG - Intergenic
990478238 5:56182963-56182985 CTGTGCCTGTTGACATTTCTGGG + Intronic
993556602 5:89347363-89347385 GTGTGCTTATTCCAATATCTGGG + Intergenic
995368325 5:111388964-111388986 ATGTTCTTGTGGGAATGTCTAGG - Intronic
995702085 5:114947555-114947577 GTTTACTTGTTGACATGTCTGGG + Intergenic
997620282 5:135284754-135284776 ATCTGGTTGTTTAAATGTCTGGG + Intronic
997741247 5:136256888-136256910 GTGTGCTTGGGTTAATGTCTGGG - Intronic
1000503096 5:162077485-162077507 TTATTCTTGATGAAATGTCTAGG + Intronic
1000839579 5:166200922-166200944 GTGTGATTATTGAAATGGTTAGG + Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1003855822 6:10273634-10273656 CTGTGCTTGTTGGAATTTCTGGG - Intergenic
1003933310 6:10950024-10950046 GTGTGTGTGTTAAAATTTCTAGG - Intronic
1005289860 6:24369272-24369294 GTATGCATGTTAAAATGTATAGG + Intergenic
1005420710 6:25646516-25646538 GTATGCATGTTGATATCTCTAGG + Intergenic
1008446943 6:51603500-51603522 ATCTGCTTTTTGAAATGACTGGG + Intergenic
1010166901 6:72925683-72925705 GTGGGCTTGTTGAAATCTAAAGG + Intronic
1010303457 6:74288334-74288356 GTGTTCTTGTCTAAATCTCTTGG - Intergenic
1010714189 6:79209328-79209350 GTGTTATTGCTGAAATGCCTAGG - Intronic
1011276500 6:85636687-85636709 GTGTGTTTGTTTAAATTTATAGG - Intronic
1012215980 6:96584479-96584501 GTGTGTGTGTTGGAAAGTCTGGG + Intronic
1012475937 6:99614472-99614494 ATGTGCTTGTTGAGATTGCTGGG - Exonic
1013262249 6:108456425-108456447 ATGTGATTGTTGATATGGCTGGG + Intronic
1013751520 6:113412380-113412402 GTGTCCTTGTTAACAGGTCTTGG - Intergenic
1014326901 6:120009052-120009074 TTTTGCTTGTTGAATTGTTTAGG - Intergenic
1014433179 6:121392844-121392866 ATGTGCTTCTTGATATCTCTAGG - Intergenic
1014882357 6:126738958-126738980 CTGTGCATGTGGAAATCTCTTGG + Intergenic
1014888564 6:126813391-126813413 GTGGGCTTGTTGAAATGAAGTGG + Intergenic
1015748376 6:136535217-136535239 GTCTGGTTGTTTAAAAGTCTGGG + Intronic
1017979052 6:159382824-159382846 GTGTGTGTGTTTAAAGGTCTTGG - Intergenic
1021286251 7:18784547-18784569 CTGTGCTTCTGCAAATGTCTGGG - Intronic
1027641110 7:80734962-80734984 ATTTGCTTGTTGAATTGTTTGGG - Intergenic
1027944953 7:84732862-84732884 ATGTGGTTGTTTAAAAGTCTGGG - Intergenic
1031684725 7:124719001-124719023 GTGAGCTTTTTGAAATATGTTGG + Intergenic
1032016458 7:128383182-128383204 GTGGCCTTGTTGCAATCTCTAGG - Intergenic
1036037638 8:5037148-5037170 GTATTCTTGTTGACATGTCTTGG + Intergenic
1037074673 8:14699753-14699775 TTTTGCTTGTTGAAATTTTTAGG - Intronic
1037414432 8:18634121-18634143 TTTTGCTTGTTGAATTGTTTAGG + Intronic
1041146127 8:54877781-54877803 GTATGCTTGTTTGAATTTCTAGG + Intergenic
1041697414 8:60750613-60750635 GACTACATGTTGAAATGTCTTGG - Intronic
1042750580 8:72153613-72153635 GTTTGCTTAAGGAAATGTCTAGG + Intergenic
1043075701 8:75696063-75696085 GTGAGGTTGTTGAAAAGTCTTGG + Intergenic
1043424739 8:80137529-80137551 GTGTCCTTCCAGAAATGTCTAGG - Intronic
1043700248 8:83278053-83278075 TTTTGCTTATTGAATTGTCTTGG + Intergenic
1044152048 8:88792219-88792241 GTGTGTTTATTGATATGTCAGGG - Intergenic
1044235847 8:89829219-89829241 GTGAGCTTGTCGAAATTTTTTGG - Intergenic
1044894423 8:96875555-96875577 CTATTCTTGTTGAACTGTCTGGG + Intronic
1045823334 8:106367901-106367923 GTATGCTTGGGGAACTGTCTAGG + Intronic
1046107876 8:109688671-109688693 GTCTGCTTGGTGATATCTCTGGG + Intronic
1046891792 8:119430235-119430257 GTGTGCTTCTGGAATTGTCCAGG - Intergenic
1046988805 8:120425012-120425034 ATGAGTTTGCTGAAATGTCTTGG - Intronic
1047363219 8:124188538-124188560 TTTTGCTTGTTGAATTGTTTAGG + Intergenic
1047612539 8:126535143-126535165 GTGTGCTTGTTGCAAAGATTGGG - Intergenic
1047932833 8:129748166-129748188 GTGTGCATTTTGAATTGTTTTGG - Intergenic
1048058434 8:130892178-130892200 GTAGGCTTATAGAAATGTCTAGG - Intronic
1048126569 8:131642083-131642105 GTGTACATGTTGAATTTTCTTGG - Intergenic
1048839884 8:138556333-138556355 CTGTGCTTGCTGATATGGCTGGG - Intergenic
1050198484 9:3113629-3113651 GTATACATGTTGAAGTGTCTAGG + Intergenic
1054747720 9:68871714-68871736 GTGTGCTTGCTTAATTGTTTAGG + Intronic
1056300957 9:85240953-85240975 GTGAGCATGTTGTAATGTCTAGG + Intergenic
1058641320 9:107088483-107088505 TTGTGCTTATTGACATTTCTGGG - Intergenic
1059237387 9:112772507-112772529 GTGTGCGTGTGGAGATATCTAGG + Intronic
1060890153 9:127183057-127183079 GTCTGGTTGTTTAAAAGTCTGGG - Intronic
1061829165 9:133279821-133279843 GTCTGGTTGTTGAAATGCCAAGG + Intergenic
1186109907 X:6244792-6244814 GTTTGCTTGTCAAAATGACTGGG - Intergenic
1187887281 X:23901404-23901426 TTGGGCTTGCTGAAATATCTGGG - Intronic
1187905036 X:24057808-24057830 TTGTGCTTTTTGAAATATCGAGG + Intronic
1189772586 X:44441259-44441281 GTGTGATTTTTCAAATGTCCAGG + Intergenic
1189772904 X:44443941-44443963 GTGTGATTTTTCAAATGTCCAGG + Intergenic
1194024590 X:88736039-88736061 GAGTGCTTGGAGATATGTCTGGG + Intergenic
1194340689 X:92701219-92701241 GTGTGTTTCTAGAAATGTCCAGG + Intergenic
1195706704 X:107742767-107742789 GTGGGCTGGTTAAACTGTCTGGG - Intronic
1197779123 X:130142134-130142156 TAGTGCTTGTTAAATTGTCTTGG - Intronic
1198676080 X:139132354-139132376 TTTTGCTTTTTAAAATGTCTAGG + Intronic
1199467176 X:148151600-148151622 GTGTGCTAGGTCAAATCTCTTGG + Intergenic
1200406359 Y:2815479-2815501 GTATGCTTGTTGATTTGTTTGGG + Intergenic
1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG + Intergenic