ID: 960639098

View in Genome Browser
Species Human (GRCh38)
Location 3:119810032-119810054
Sequence GAGAATGGGGAGCAGAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1134
Summary {0: 1, 1: 0, 2: 15, 3: 115, 4: 1003}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960639098_960639111 14 Left 960639098 3:119810032-119810054 CCCCCCTTCTGCTCCCCATTCTC 0: 1
1: 0
2: 15
3: 115
4: 1003
Right 960639111 3:119810069-119810091 TGAAACGCAACGCCCGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
960639098_960639115 30 Left 960639098 3:119810032-119810054 CCCCCCTTCTGCTCCCCATTCTC 0: 1
1: 0
2: 15
3: 115
4: 1003
Right 960639115 3:119810085-119810107 GCTGAGGTGCCCCTTCCGGAAGG 0: 1
1: 0
2: 1
3: 4
4: 107
960639098_960639109 8 Left 960639098 3:119810032-119810054 CCCCCCTTCTGCTCCCCATTCTC 0: 1
1: 0
2: 15
3: 115
4: 1003
Right 960639109 3:119810063-119810085 GGGCCATGAAACGCAACGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 37
960639098_960639113 26 Left 960639098 3:119810032-119810054 CCCCCCTTCTGCTCCCCATTCTC 0: 1
1: 0
2: 15
3: 115
4: 1003
Right 960639113 3:119810081-119810103 CCCGGCTGAGGTGCCCCTTCCGG 0: 1
1: 0
2: 1
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960639098 Original CRISPR GAGAATGGGGAGCAGAAGGG GGG (reversed) Intronic
900628816 1:3623139-3623161 GAGAATGGGGGGGAGAAAGAGGG - Intergenic
900720174 1:4170873-4170895 GAGAAGGGTGAGAAGAAGAGGGG - Intergenic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
901428260 1:9197339-9197361 GAAGAGAGGGAGCAGAAGGGAGG - Intergenic
901751693 1:11413915-11413937 GAGAAGGGGGAGAAGGAGGGAGG - Intergenic
901877594 1:12175677-12175699 GAGAATGGGATGCAGGAGTGGGG - Intronic
902432120 1:16371411-16371433 GAGAGGGGGGAGCAGAGGGATGG - Intronic
902490849 1:16779403-16779425 GAGGAAGGGGAGGAGGAGGGGGG + Intronic
902852407 1:19170411-19170433 GAGAGTGGGGAGGGGAGGGGAGG + Intronic
903294045 1:22332446-22332468 GAGACTTGGGAGGAGAAGGCTGG - Intergenic
903609200 1:24597539-24597561 GGGGAGGGGGAGGAGAAGGGGGG + Intronic
903746949 1:25593424-25593446 GAGAATGGGGAGAACAGGGTGGG + Intergenic
903929082 1:26851915-26851937 GAGGATGGGGAGGAGAAGTCAGG - Intronic
904009388 1:27381161-27381183 GGGGATGAGGAGCAGAAGAGGGG + Intronic
904009994 1:27383862-27383884 GCGGATGAGGGGCAGAAGGGAGG - Intergenic
904349983 1:29898899-29898921 GGGCAAGGGGAGAAGAAGGGAGG + Intergenic
904409391 1:30315921-30315943 CAGAAGGGGGAGGAGAAGGGAGG - Intergenic
904706496 1:32394748-32394770 GAGAGCTGGGAGCAGAGGGGAGG + Intergenic
904848766 1:33441122-33441144 GAGGACGTGGAGCAGGAGGGAGG + Intergenic
904974087 1:34442685-34442707 GAGGGTGGGGAGGAGAAGGCAGG - Intergenic
905256405 1:36688367-36688389 GAAAAAGGGGAGGGGAAGGGAGG + Intergenic
905531400 1:38681826-38681848 GAGATTGGGGAGCAGGACAGAGG - Intergenic
905655467 1:39683827-39683849 CAGGCTGGGGAGCAGCAGGGAGG + Intronic
905889298 1:41509622-41509644 CAGGGTGGGGTGCAGAAGGGAGG + Exonic
906180853 1:43817622-43817644 GAGAAGGAGGAGGAGAAGGGAGG - Intronic
906192080 1:43905154-43905176 GAGGAGGGGGAGGAGAAGAGTGG - Intronic
906300528 1:44678260-44678282 GAGTCTGGGGAGAAGAAGAGTGG + Intronic
906303787 1:44703345-44703367 GTGAATGGGGAGAGGGAGGGAGG - Intronic
906603947 1:47151792-47151814 GAGAATGGGCAGGAAAGGGGAGG + Intergenic
906860004 1:49349417-49349439 GAGAAGGAGGAGAACAAGGGAGG - Intronic
907214129 1:52847957-52847979 GAGAATGGCGTGAACAAGGGAGG - Intronic
907305013 1:53508516-53508538 GAGCAGGGGCATCAGAAGGGAGG - Intronic
907328789 1:53658068-53658090 GGGAATGGTGAGCATAGGGGTGG - Intronic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908659826 1:66424016-66424038 TAGGATGGGGAGCTGTAGGGAGG + Intergenic
909254653 1:73404516-73404538 GAGAATGGGGAGCTGGATGAAGG - Intergenic
909562979 1:77025778-77025800 GAGGAGGGGCAGCAGGAGGGAGG - Intronic
910171908 1:84386834-84386856 AGGAATGGGGATAAGAAGGGTGG - Intronic
910180916 1:84481565-84481587 GAGAATGGGGAGTGGGAGGACGG + Intronic
910285793 1:85552685-85552707 AAGAAGGGAGACCAGAAGGGAGG + Intronic
910333012 1:86097553-86097575 GAGGAGGGGGAGGAGAAGGGAGG - Intronic
911098918 1:94078554-94078576 GAGGATGGGGAGGGGAGGGGAGG - Intronic
911131525 1:94393283-94393305 GAGAAAGAGGAGGAGAAAGGGGG + Intergenic
911178351 1:94839987-94840009 GAAAATGTGAACCAGAAGGGTGG - Exonic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911350220 1:96745250-96745272 GAGAATGGGGTGAACCAGGGAGG - Intronic
911599050 1:99828064-99828086 GAGAAAGGAGAGCAGCAGTGGGG - Intergenic
911820314 1:102411262-102411284 GAGAAGGAGAAGGAGAAGGGGGG + Intergenic
912199999 1:107446063-107446085 AAGAATGTGAAGCAGAAGGCAGG + Intronic
912321328 1:108716299-108716321 TAGCTTGGGGAGCAGAAGAGAGG + Intronic
912496570 1:110095534-110095556 TAGAATGGGGAGGGGAGGGGAGG - Intergenic
912554194 1:110504301-110504323 TAGAGTGGGGAGCAGAAGCCGGG - Intergenic
912949853 1:114113130-114113152 GAGTGTGGGGAGCAGGAGGTGGG - Intronic
913320127 1:117582265-117582287 GGAAATGGGGAGCAGAAGGGAGG - Intergenic
913466406 1:119147788-119147810 CAGAAGGGGAAGCAGAACGGAGG - Intergenic
913471954 1:119196921-119196943 GAGAATGGAGAGTGGAAGGGAGG - Intergenic
913540905 1:119819993-119820015 GAGAAAGAGAAGAAGAAGGGAGG - Intergenic
913566555 1:120078508-120078530 GAAAATGGGGAACAGAAAGAAGG - Intergenic
913631576 1:120715036-120715058 GAAAATGGGGAACAGAAAGAAGG + Intergenic
914287313 1:146239220-146239242 GAAAATGGGGAACAGAAAGAAGG - Intergenic
914548345 1:148689962-148689984 GAAAATGGGGAACAGAAAGAAGG - Intergenic
914618336 1:149381746-149381768 GAAAATGGGGAACAGAAAGAAGG + Intergenic
914861508 1:151390079-151390101 GAGAATGGCGAGAACACGGGAGG - Intergenic
914920553 1:151844499-151844521 GAGCCTGGGGAGGAGAAGGGTGG - Intergenic
915426754 1:155833721-155833743 GAGAGTGGGGAGGAGAGGGGAGG + Intronic
915552875 1:156645334-156645356 GAGGCTGGGAAGAAGAAGGGAGG + Intronic
915715870 1:157944242-157944264 GAGGATGGGGAGCAAATGTGAGG - Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916079580 1:161224061-161224083 GATATTGGGGAGCAGAAGAAAGG + Intergenic
916407868 1:164515317-164515339 GAGAATGGGCAGCAGAGTGAAGG + Intergenic
916669495 1:167001248-167001270 GGGACTTGGGGGCAGAAGGGTGG + Intronic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917502564 1:175599165-175599187 GAGGAAGGAGAGCAGGAGGGAGG + Intronic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
917737626 1:177934971-177934993 GAGAGTGGGGAGCAGTAGGGAGG - Intronic
918072604 1:181143980-181144002 GGGAATGGGGTGAAGGAGGGTGG - Intergenic
918618061 1:186570896-186570918 AGGAAAGGGGAGAAGAAGGGAGG + Intergenic
919221450 1:194634687-194634709 GTGAATGGATAGCAGAAGGCTGG - Intergenic
919288506 1:195598320-195598342 GAGAAAGAGGAGGAGAGGGGAGG - Intergenic
919522174 1:198601764-198601786 GAAAATTGGTAACAGAAGGGTGG - Intergenic
920061918 1:203232871-203232893 GAGACCTGGGAGCAGAAGGCAGG + Intronic
920073988 1:203323794-203323816 GAGGATGGGAAGCACAGGGGAGG - Intergenic
920109648 1:203578326-203578348 GAGAATAGTTAGCAGGAGGGAGG + Intergenic
920271950 1:204772072-204772094 GAGCAGGGGGAACAGCAGGGGGG - Intergenic
920344028 1:205294410-205294432 GAGAATGGTGAGGAGGATGGAGG + Intergenic
920737942 1:208552241-208552263 GAGAAAAGGAAGCAGAAGGAAGG - Intergenic
920774206 1:208920461-208920483 GAGAATGGCGTGAAGCAGGGAGG - Intergenic
921396850 1:214677785-214677807 GAGAAGGGGGAGGAGAAGGGAGG - Intergenic
921397085 1:214679862-214679884 GAGGAGGAGGAGGAGAAGGGGGG - Intergenic
921773293 1:219068974-219068996 GAAAATGGCAAGGAGAAGGGAGG - Intergenic
921835442 1:219773376-219773398 GGGAATGGGAAGCAGAAGGCTGG + Intronic
922296609 1:224255277-224255299 GAGAATGGCGAGAACCAGGGAGG - Intronic
922574897 1:226654982-226655004 GAGAAGGGAGAGCAGGAGGAGGG + Intronic
922589577 1:226764492-226764514 GAGAATGGGGCAGAGAAGTGAGG - Intergenic
922603763 1:226876016-226876038 GAGAATGGGGTGCAGGGGGTGGG + Intronic
922949849 1:229549563-229549585 GAGATCGAGGAGCAAAAGGGAGG - Intronic
923039571 1:230309962-230309984 GGGAGTGGGGAGCAGCAGGCTGG - Intergenic
923051375 1:230393257-230393279 GAAAAGGGGGAGGAGGAGGGAGG + Intronic
923529595 1:234803132-234803154 GAGGAAGGGGAGGAGGAGGGGGG - Intergenic
923638392 1:235724677-235724699 GAGATTGGGGAGAGGAAAGGAGG - Intronic
923924414 1:238608412-238608434 CAGAAGGGGGACAAGAAGGGAGG + Intergenic
924012997 1:239686482-239686504 GGGAAGGGTGAGCAGAAGGAGGG - Intronic
924448774 1:244159015-244159037 GAGAAGGAGAAGAAGAAGGGTGG - Intergenic
924676786 1:246186816-246186838 GAGACTGGGAAGCAGAAGACCGG - Intronic
924708286 1:246515378-246515400 GGGAATGGGGAGAGGATGGGTGG - Intergenic
924852574 1:247845155-247845177 GAGGACGAGGAGCAGCAGGGAGG - Intergenic
1063197830 10:3759643-3759665 AAGCATGGAGAGCAGAAGGAGGG + Intergenic
1063235601 10:4112325-4112347 GAAAATGAGGATAAGAAGGGGGG + Intergenic
1063281676 10:4636488-4636510 GAGAAAGAGGAGCAGAAGCAAGG - Intergenic
1063976681 10:11423375-11423397 GAGAAGGGGGAGAGGAAGGCTGG - Intergenic
1064305130 10:14158642-14158664 GAGAAGGAGGAGGAGAAGGGGGG + Intronic
1064609043 10:17078055-17078077 GATGATGGGGAGGAGAAGAGAGG - Intronic
1065788872 10:29241856-29241878 AAGAAAGGGGGGCAGAAGGAAGG + Intergenic
1066058985 10:31705968-31705990 TGGAATGGGGAGCAGAGGGATGG - Intergenic
1066564568 10:36707558-36707580 GAGAATGGGGTGAAGCCGGGAGG + Intergenic
1067189902 10:44060392-44060414 GAGAATGGGAAGCTGAGGGGTGG + Intergenic
1067558167 10:47286648-47286670 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1067741171 10:48897077-48897099 GAGAGTGGGGGCCAGCAGGGAGG - Intronic
1067844694 10:49710465-49710487 GAGAGTGGGGAGAGGCAGGGAGG - Intergenic
1069248465 10:66239374-66239396 CAGACTGGGGAGCAGAAGATTGG - Intronic
1069620519 10:69834714-69834736 GACAAGGCAGAGCAGAAGGGGGG + Intronic
1069718533 10:70535651-70535673 GAGAAGGAGGAGGAGAAGGAAGG - Intronic
1070586559 10:77771106-77771128 GAGAGTGGGGAGGAGAGGGGTGG + Intergenic
1071015043 10:80987086-80987108 GAGAAAGGCAAGCAGAAGGAAGG - Intergenic
1071329916 10:84549032-84549054 GAGACTGGGGAGCTGGAGGATGG - Intergenic
1071913158 10:90258519-90258541 TGGAATGGGAAGGAGAAGGGTGG + Intergenic
1072454983 10:95567650-95567672 GGGAGGGGGGAGCAGAGGGGAGG + Intergenic
1072887199 10:99288484-99288506 GAGAAGGAGGAGGAGAAGGATGG + Intergenic
1073216639 10:101840200-101840222 GAGAAAGGGGGGCTGAAAGGGGG - Intronic
1073547393 10:104362577-104362599 GAGATGGGGGAGCAGGAGGAGGG - Intronic
1074216822 10:111393520-111393542 GGCAGTGGGGAGCAGAAGGGAGG - Intergenic
1074284702 10:112087313-112087335 GGGAATGAGGATCAGAAGTGGGG + Intergenic
1074421281 10:113310784-113310806 GAAGAAGGGGAGCAGAATGGAGG - Intergenic
1075084748 10:119407136-119407158 GGGAAGGGGAAGCGGAAGGGAGG - Intronic
1075193341 10:120331573-120331595 GGGAATAGGGAGAAGAAGAGAGG - Intergenic
1075212404 10:120502342-120502364 GAGAAGGGGGAAGAGAAGGAGGG + Intronic
1076001681 10:126917779-126917801 GAGAGTGGGGAGGAGATGTGAGG + Intronic
1076071277 10:127491867-127491889 GAGAGAGGGGAGGAGAAGGGGGG - Intergenic
1076426178 10:130369256-130369278 GGGAAGAGGGAGCAGGAGGGAGG + Intergenic
1076467921 10:130697734-130697756 TAGAATGAAGAGCAGAAGGTGGG + Intergenic
1076825590 10:132965766-132965788 GAGAATTGGGAACAGCAGGAAGG - Intergenic
1076917879 10:133433424-133433446 CAGGATGGGGAGCAGATAGGGGG - Intergenic
1076937877 10:133577501-133577523 CAGGATGGGGAGCAGATAGGGGG - Intergenic
1076981213 11:205887-205909 GGGAATGGGGATCAGAGGGAAGG - Intronic
1077160563 11:1110666-1110688 GAGAATGGGGAGCGGAGGGCAGG - Intergenic
1077408307 11:2392323-2392345 GAGAGTGGGGCGCAGGAAGGAGG - Intronic
1077457447 11:2689403-2689425 GGAAATGGGGAGCATAGGGGAGG + Intronic
1077458169 11:2693438-2693460 GAGAATGGGGACTCGATGGGGGG - Intronic
1077521735 11:3040061-3040083 TAGACTGAGGAGGAGAAGGGGGG - Intronic
1077557251 11:3231612-3231634 GAGGAGGGGGAGGAGAAGGAGGG + Intronic
1078020855 11:7654962-7654984 GAGAAGGAGGGGCAGGAGGGAGG + Intronic
1078062994 11:8060337-8060359 GAGAGTGGGCAGGAGAAGGTTGG + Intronic
1078065589 11:8077162-8077184 AATAATTGGGAGCAGAATGGAGG - Intronic
1078159522 11:8828594-8828616 GAGAATGGGGACAAGCAGGGCGG + Intronic
1078746282 11:14118665-14118687 GATAATGGGGAGAAGTAGGATGG - Intronic
1079077156 11:17391052-17391074 CAGAAGGGTGAGCAGCAGGGAGG - Intergenic
1079105911 11:17572323-17572345 GAGAAGGAGGAGCAGCAGGGAGG + Intronic
1079378403 11:19914957-19914979 TAGAAAGGAGAGGAGAAGGGAGG - Intronic
1079703937 11:23589050-23589072 GAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1080478372 11:32619872-32619894 GAGGAGGGGGAGGGGAAGGGAGG + Intronic
1081369985 11:42288470-42288492 GAGACTGGGGAGAGGAAGGAGGG + Intergenic
1081687523 11:45053323-45053345 GAGACTGCGTAGCAGAGGGGAGG + Intergenic
1081730654 11:45369675-45369697 GGGATTGGGGAGCACAAGGCAGG + Intergenic
1081761499 11:45579599-45579621 GAGAAGGAGGAGAAGAAGGAAGG - Intergenic
1082091881 11:48097028-48097050 CTGAATGGGGAACAGGAGGGTGG - Intronic
1083155555 11:60820826-60820848 GGGACTGTGGAGCAGCAGGGAGG + Intergenic
1083270480 11:61569763-61569785 GAGAAGGGGGAGGAGAGCGGGGG + Intronic
1083630138 11:64091094-64091116 GAGAAGGGAGAGGAGAAGGAGGG + Intronic
1084085498 11:66853184-66853206 GAGATTGGAGAGCGGAGGGGAGG + Intronic
1084091680 11:66882920-66882942 GGGCAGGGGGGGCAGAAGGGAGG + Intronic
1084703276 11:70801449-70801471 GAGAATGGGGAGCAAGAGAGGGG + Intronic
1084944345 11:72630810-72630832 GAGGGTGGGGAGGACAAGGGAGG + Intronic
1085095919 11:73760708-73760730 GAAAAAGGCGAGCGGAAGGGCGG + Exonic
1085195653 11:74670179-74670201 GAGAGTGGGGAGCAGAGGGTTGG - Intergenic
1085271488 11:75272731-75272753 GAGAAAGAGGAACAGAAGGGAGG + Intronic
1085282587 11:75340825-75340847 GAGATTGGGGAGCAGGAAGCTGG - Intronic
1085786286 11:79453921-79453943 GAGAAAGGGAAGGGGAAGGGAGG - Intergenic
1085857135 11:80188031-80188053 GAGAAGGAGAAGCAGAAGCGGGG - Intergenic
1085859925 11:80221168-80221190 GGGAAGGGTGAGGAGAAGGGAGG + Intergenic
1086123014 11:83319796-83319818 AAGAATGGGGAGCATATGTGAGG + Intergenic
1087177603 11:95109752-95109774 GGTGATGGGGAGGAGAAGGGTGG - Intronic
1087241803 11:95789472-95789494 GAGACTGAGGAGCAGGATGGCGG - Exonic
1087726653 11:101725846-101725868 GAGAGTAGGGAGGAGAGGGGAGG + Intronic
1088137060 11:106568484-106568506 CTGAATGGGAAGCTGAAGGGGGG - Intergenic
1088326505 11:108606350-108606372 GAGATTGGGGAGCAGAAGGTGGG - Intergenic
1088491536 11:110393135-110393157 GGTACTGGGGAGCAGAGGGGAGG - Intergenic
1088826208 11:113496407-113496429 AAGAGTGAGGAGCAGAAGGCAGG + Intergenic
1088828579 11:113516141-113516163 GAGAAGAGAGAGCAGGAGGGAGG - Intergenic
1088919662 11:114251750-114251772 GAGGAGGAGGAGCAGAAGGAGGG + Intergenic
1089073003 11:115715905-115715927 GAGAATGGGGAGCAGTGAGCAGG + Intergenic
1089100089 11:115955711-115955733 GAGAAGGAGGAGGGGAAGGGTGG - Intergenic
1089240221 11:117071575-117071597 AAGAAGGGGAAGAAGAAGGGAGG + Intronic
1089277885 11:117351662-117351684 GAGAGTGGGGTGGAAAAGGGAGG - Intronic
1089305401 11:117523296-117523318 GAGAGTGTAGAGCAGGAGGGTGG + Intronic
1089331447 11:117691773-117691795 GAGAAGGTAGAGCAGAAGAGAGG - Intronic
1089526467 11:119100559-119100581 GAGAATGTGGAGCACCAGGAAGG + Intronic
1089612533 11:119677481-119677503 GAGAAAGGAGAGGAGGAGGGAGG + Intronic
1089725091 11:120470225-120470247 GAGAATGAGTTGAAGAAGGGTGG + Intronic
1090187056 11:124745785-124745807 GAGCAGGGGGAGAATAAGGGCGG + Intronic
1090201801 11:124862933-124862955 GAGAATGGGAAGGAAAAGGGAGG + Intergenic
1090237100 11:125157244-125157266 GAGATTGGGAAGGAGAAGGTAGG + Intergenic
1090366504 11:126211306-126211328 GAGAATGGGGAGAAGGCGGAGGG - Intronic
1090439785 11:126715992-126716014 GAGGTTGGGCAGGAGAAGGGCGG + Intronic
1090527318 11:127551448-127551470 GAGAAAGGAGAGCACAAGAGGGG - Intergenic
1090560409 11:127926370-127926392 GAGCAAAGGGAGCAGAAAGGAGG - Intergenic
1090803093 11:130186724-130186746 GAGGATGGGGAGAGAAAGGGTGG + Intronic
1091178851 11:133585079-133585101 GAGATTGTGGAAGAGAAGGGTGG + Intergenic
1091832308 12:3558248-3558270 GGGAAAGGGGAGGAGAAGGAAGG - Intronic
1091916373 12:4273866-4273888 GAGAAGGTGGAGCAGAAGGGAGG - Exonic
1092041901 12:5392792-5392814 GGGAATGGGGAGAAGAGGAGAGG - Intergenic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092232362 12:6783253-6783275 GAGGATGGGGAGCAGGGGAGGGG - Intergenic
1092370875 12:7915905-7915927 GGGAAGGGGGAGGGGAAGGGGGG - Intergenic
1092379009 12:7979656-7979678 GAGAATGGGGTGAACACGGGAGG + Intergenic
1092379094 12:7980174-7980196 GAGAATGGGGTGAACACGGGAGG + Intergenic
1092763668 12:11832641-11832663 GAGGATGAGGAGCAGATGGCTGG - Intronic
1093017628 12:14170914-14170936 AAGAGAGGGGAGCAGAGGGGAGG + Intergenic
1093446277 12:19262721-19262743 GACACTGGGGAGCACAAGAGAGG + Intronic
1093706979 12:22285355-22285377 GAGAAATGGGAGCCAAAGGGTGG - Intronic
1093748923 12:22776455-22776477 GGGAAGGGGAAGCGGAAGGGAGG + Intergenic
1093873113 12:24316243-24316265 GGGGAAGGGGAGTAGAAGGGTGG + Intergenic
1094628249 12:32146842-32146864 GAGAAGGAGGAGGAGAAGGAAGG - Intronic
1095236187 12:39799000-39799022 GATAATGGGGAGAAGATGGTAGG - Intronic
1095380327 12:41583098-41583120 GAGAATGGGGAACAAGAGGAAGG + Intergenic
1095608921 12:44104273-44104295 AAGAATGGAGAGATGAAGGGAGG - Intronic
1095616646 12:44198225-44198247 TAGGAAGGGCAGCAGAAGGGTGG + Intronic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1095922478 12:47544685-47544707 GAGGATGGGGGGCAAGAGGGAGG - Intergenic
1096050200 12:48600797-48600819 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
1096157191 12:49347260-49347282 GAGAAACGGGAGCAGAGGGTTGG - Exonic
1096263673 12:50107812-50107834 GAGAAGGGAGAACAGAGGGGCGG + Intronic
1096595018 12:52689493-52689515 GAGTAGGGGGAGGAGGAGGGAGG + Intergenic
1096751054 12:53759145-53759167 GAGAAGGGGGTACAGAATGGGGG - Intergenic
1096994079 12:55828303-55828325 GAGACTGGGAACCAGAAGGATGG - Exonic
1097175004 12:57137547-57137569 GAGAATGGAGAGGACAAGGCAGG + Intronic
1097420203 12:59368341-59368363 GAGAAAGGGCAGCAGGAGGAAGG - Intergenic
1098216392 12:68224691-68224713 GAGAAAGGGGAGAGGGAGGGAGG + Intronic
1098495906 12:71135375-71135397 GAGGAGGAGGAGGAGAAGGGGGG + Intronic
1098607846 12:72415519-72415541 GGGGAGGGGGAGCAGAAAGGAGG - Intronic
1098988643 12:77040685-77040707 GGGAGTGGGGACCAGGAGGGAGG + Intronic
1099033615 12:77559564-77559586 GGGGATGGGGAGCAGGAGTGGGG + Intergenic
1099481367 12:83170433-83170455 GAGAATGCAGGGGAGAAGGGAGG - Intergenic
1100118132 12:91334626-91334648 GAGGAGAGGGAGAAGAAGGGAGG + Intergenic
1100704605 12:97186521-97186543 GAGAAAGGGGAGCAGGAGAAAGG + Intergenic
1100865402 12:98852110-98852132 GAGAATGGGCTGCAGTGGGGAGG + Intronic
1100978886 12:100148995-100149017 GAGGATGGAGAACAGAATGGAGG + Intergenic
1101073058 12:101096776-101096798 GAGATTTGGGAAGAGAAGGGAGG - Intronic
1101234848 12:102778147-102778169 GAGAAAGAGAAGGAGAAGGGAGG - Intergenic
1102461535 12:113102780-113102802 GAGTCTGGGGAGCAGAAGTGGGG - Intronic
1102627443 12:114246809-114246831 AAAAATTGAGAGCAGAAGGGAGG - Intergenic
1102789828 12:115635895-115635917 GAGAAAGGGGAGGGGAAGGAAGG + Intergenic
1102794186 12:115674167-115674189 GAGGAGGGGGAGGAGAGGGGAGG - Intergenic
1103241922 12:119420577-119420599 GGGGATGGGGGGCAGAAGGTGGG + Intronic
1103243915 12:119438909-119438931 AAGAAAGGGAAGCAGAACGGGGG - Intronic
1103948802 12:124540886-124540908 GAGAGTGGAGAGCTGGAGGGGGG + Intronic
1104031841 12:125070346-125070368 GAGAATGCGGTTTAGAAGGGCGG + Intronic
1104259953 12:127173197-127173219 GAGAACCGGGAGTAGCAGGGCGG + Intergenic
1104355284 12:128079737-128079759 AATGATGGGGAGCAGGAGGGTGG + Intergenic
1104517785 12:129443692-129443714 GAGAAGGGGGAGCTGAAAGCAGG - Intronic
1104544413 12:129698556-129698578 GAGAAGGGAGGGGAGAAGGGAGG + Intronic
1104544486 12:129698699-129698721 GAGAAAGGGGAGGAAAGGGGAGG + Intronic
1104879762 12:132062401-132062423 GAGAATGAGGATCTGAAGGTGGG + Intronic
1105541855 13:21322774-21322796 GGGCATGGGCAGCAGATGGGAGG - Intergenic
1105806718 13:23955733-23955755 GAGAGTGGTGAGCAGGAGTGGGG + Intergenic
1105817580 13:24051174-24051196 GAGACTGGGGAGCAGAACTAGGG - Intronic
1105944440 13:25177411-25177433 GAGACTGGGAAGCTGCAGGGGGG + Intergenic
1106017630 13:25884425-25884447 GAGAAGTGGGAGCAGAAGCGGGG - Intronic
1106141438 13:27015215-27015237 GAAATTGGGGAGCAGAGTGGCGG - Intergenic
1106389963 13:29325507-29325529 GAGAAGGAGGAGGAGGAGGGAGG + Intronic
1106923540 13:34589690-34589712 GAGGGTGGGAAGCAGAAGGGAGG + Intergenic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107596672 13:41970307-41970329 GAGAGTGGGAAGCAAGAGGGAGG + Intergenic
1108596396 13:51953737-51953759 GAGGAAGGGGAGTAGAAGAGAGG - Intronic
1109056409 13:57555201-57555223 GAGAATGGTGTGAACAAGGGAGG - Intergenic
1110329332 13:74252765-74252787 AAGAATGGGGAAGAGAAGGGAGG - Intergenic
1110868078 13:80420211-80420233 GAGAAGGGGGGAGAGAAGGGGGG - Intergenic
1110868106 13:80420301-80420323 GAGAAGGGAGAAGAGAAGGGGGG - Intergenic
1110868143 13:80420430-80420452 GAGAAGGGAGAAGAGAAGGGGGG - Intergenic
1110868150 13:80420452-80420474 GAGAAGGGAGAAGAGAAGGGGGG - Intergenic
1110970420 13:81754308-81754330 AAGAATGGGGAGCCACAGGGAGG + Intergenic
1111087902 13:83400776-83400798 GAGAATGGGGTGAACCAGGGAGG - Intergenic
1112015748 13:95330084-95330106 GGGGATGGGGAGGAGAAAGGAGG + Intergenic
1112344518 13:98577815-98577837 GAAAATGGGGCGCAGAGGGCAGG + Intronic
1113159616 13:107365024-107365046 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
1113362856 13:109647185-109647207 GAGAAGGAGGAGCTGAAAGGAGG - Intergenic
1113375195 13:109758939-109758961 GGGAAAGGGAAGGAGAAGGGAGG + Intronic
1114308221 14:21442632-21442654 GAGAAAGGGGAGGAGAGGAGAGG + Intronic
1114334094 14:21670066-21670088 GATAATGGGGTTCAGCAGGGGGG + Intergenic
1114492272 14:23110657-23110679 GAGAATGGGGATAAGGAGAGAGG + Intergenic
1114630399 14:24155843-24155865 GAGAAAGGGAAGCAGAGGGAGGG + Intronic
1114655639 14:24314029-24314051 GAGCATGAGGAGCAGGAGTGAGG - Exonic
1114840105 14:26253155-26253177 GAGAAAGGGGAGGGGAAGTGAGG - Intergenic
1114887410 14:26870972-26870994 AAGAATGGGGAGGAGAGAGGAGG - Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115047267 14:29011196-29011218 GAGAAATGGGAGCAGAAGCTAGG - Intergenic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115498191 14:34027247-34027269 GAGGAGGGGGAGGAGAGGGGAGG + Intronic
1115498201 14:34027269-34027291 GAGGAGGGGGAGGAGAGGGGAGG + Intronic
1116458020 14:45141473-45141495 GAGAAAGGGGAGGGGAGGGGAGG - Intronic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117617280 14:57546428-57546450 AAGAGGGGGGACCAGAAGGGAGG + Intergenic
1118171655 14:63395298-63395320 GAGAAAAGGGAGGAGAAAGGAGG + Intronic
1118171699 14:63395446-63395468 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1118312732 14:64705203-64705225 GAGAGTGGGGGCCAGAAGCGGGG + Intronic
1118342585 14:64907462-64907484 GAGAATGGCTAGCAGATGGAGGG - Intergenic
1118377347 14:65188633-65188655 GGGAATGGATAGCAGAAGGCGGG + Intergenic
1118611852 14:67547551-67547573 GAGGTAGGGGAGCAGATGGGTGG - Intronic
1119133521 14:72196000-72196022 TAGTTTGGGGAGCAGAAGGGAGG + Intronic
1119925389 14:78488779-78488801 GGGGAGGGGGAGGAGAAGGGAGG + Intronic
1120306292 14:82774583-82774605 GGGAATGGAGAGCAGAGAGGTGG + Intergenic
1120425586 14:84343324-84343346 GGGAAGGGGAAACAGAAGGGAGG - Intergenic
1120768636 14:88355212-88355234 GAGAATAGGCAGCAAAAAGGGGG - Intergenic
1120880800 14:89413941-89413963 GAGAAGGGGGAGGAGGAGGAGGG + Intronic
1121104439 14:91271214-91271236 GAGGAAGGGGAGCAGAGGGAGGG + Intergenic
1121473406 14:94174116-94174138 GAGGAGCGGGCGCAGAAGGGTGG + Intronic
1121572762 14:94959915-94959937 GGCACTGGGGAGCAGAAGGGAGG - Intergenic
1121586638 14:95067498-95067520 GAGAATGGTCTGGAGAAGGGTGG + Intergenic
1121821495 14:96971763-96971785 GAGAAGGAGGAGAAGAAGGGAGG + Intergenic
1122059920 14:99130154-99130176 GAGGATGGGGAGGAGACTGGAGG - Intergenic
1122080358 14:99262853-99262875 GGGAGGGGGGAGGAGAAGGGTGG + Intronic
1122130956 14:99604318-99604340 GCGACTGGGGAGCAGAGGCGCGG + Intergenic
1122217387 14:100213195-100213217 GAGAGAGGGGAGGGGAAGGGAGG + Intergenic
1122247598 14:100414977-100414999 GAGCAGGGGGAGCAGCAAGGGGG + Intronic
1122299407 14:100723419-100723441 GAGGAGGGGGAGCAGACAGGAGG + Intergenic
1122550331 14:102545684-102545706 GGGGGTGGGGAGCAGAAAGGAGG + Intergenic
1122652340 14:103232556-103232578 GGGGCTGGGCAGCAGAAGGGTGG + Intergenic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123113971 14:105885575-105885597 GAGTAGGGGCAGCAGGAGGGCGG - Intergenic
1123116199 14:105895194-105895216 GAGTAGGGGCAGCAGAAGGGCGG - Intergenic
1123409968 15:20050054-20050076 AAGAAGGGGAAGCAGGAGGGAGG + Intergenic
1123519300 15:21056761-21056783 AAGAAGGGGAAGCAGGAGGGAGG + Intergenic
1123580724 15:21712966-21712988 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1123617373 15:22155589-22155611 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1124598394 15:31110695-31110717 GAGGATGGGGAGCAATAGAGGGG - Intronic
1124718349 15:32088561-32088583 GAGGATGGGGAGCAACAGGAAGG - Intronic
1124993587 15:34700368-34700390 GAGAAGGGAGAGGAGGAGGGAGG - Intergenic
1125592969 15:40866207-40866229 GAGAATGGGGAGCTCAGGGAAGG + Intergenic
1126167602 15:45666925-45666947 GAGAAAGGAGAGGAGAGGGGAGG - Intronic
1126167612 15:45666954-45666976 GAGAAAGGAGAGGAGAGGGGAGG - Intronic
1126226214 15:46273050-46273072 GAGAATAGGGATCAGAAGATAGG + Intergenic
1126431861 15:48594332-48594354 GAGACTGGAGAGCAGAAGGCAGG - Intronic
1126686783 15:51255309-51255331 GGGTATGGGGAGTTGAAGGGAGG + Intronic
1126794356 15:52247913-52247935 GAGAATGTGGAGTAGGAGGGAGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127601978 15:60546922-60546944 GAGTGTGGGAAGCTGAAGGGAGG - Intronic
1128391997 15:67188592-67188614 GGGAGTGTGGAGCAGAAGGCGGG - Intronic
1128524659 15:68404119-68404141 GAGAAGGGAGAGCAGGAGAGAGG - Intronic
1128541978 15:68542590-68542612 TCCAATGTGGAGCAGAAGGGAGG + Intergenic
1128681286 15:69653787-69653809 GCTTATTGGGAGCAGAAGGGTGG - Intergenic
1128727233 15:69997286-69997308 GATAATGGAGAGCAGATTGGTGG - Intergenic
1128788916 15:70418398-70418420 AAGAGTGGAGAGCAGAAGTGGGG - Intergenic
1128889237 15:71316203-71316225 GAGAATGAAGACCAGAAGAGAGG - Intronic
1129283647 15:74506160-74506182 GGGAAAGGGGAGAAGAAGCGTGG - Intergenic
1129567135 15:76634271-76634293 GAGAGTGGGGAAAAGCAGGGTGG - Intronic
1129846620 15:78770718-78770740 GAGACTGAGGAGCAGTGGGGAGG + Intronic
1130044669 15:80434717-80434739 GGGAGTGGGGAGCAGAGGAGAGG + Intronic
1130050618 15:80480739-80480761 AAGGATGGGGAGAGGAAGGGAGG - Intronic
1130069804 15:80636836-80636858 CTGAAAGGGGAGCAGAGGGGAGG + Intergenic
1130192734 15:81751774-81751796 GAGAGTGGGGAGAAGACAGGTGG - Intergenic
1130226081 15:82059096-82059118 GAGAAGGGGAAGAAGAAGGAGGG - Intergenic
1130255292 15:82323235-82323257 GAGACTGAGGAGCAGTGGGGAGG - Intergenic
1130599682 15:85266771-85266793 GAGACTGAGGAGCAGTGGGGAGG + Intergenic
1130865406 15:87929441-87929463 GAGCATGGGGAGAAGAGAGGGGG + Intronic
1131074948 15:89489650-89489672 GGGACTGAGAAGCAGAAGGGAGG - Intronic
1131093575 15:89641887-89641909 GCGAATGGAGAGCTGAAAGGGGG + Intronic
1131238369 15:90716993-90717015 GAGAATGGGGTGCAGACGCCTGG + Intergenic
1131246630 15:90799881-90799903 GAGGAAGGGGAGAAGGAGGGGGG + Intronic
1131252109 15:90837717-90837739 GAGAAGGGGGCTGAGAAGGGAGG - Intergenic
1131327351 15:91460892-91460914 GAGAATGCAGTGAAGAAGGGAGG + Intergenic
1131539057 15:93260856-93260878 AATAAAGGGGAGAAGAAGGGAGG - Intergenic
1131750921 15:95507171-95507193 GAGAATGGGGAGAACCCGGGAGG + Intergenic
1202989594 15_KI270727v1_random:447211-447233 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1132854382 16:2038404-2038426 GGGAAGGGGGAGGGGAAGGGGGG - Exonic
1132871996 16:2119482-2119504 GGGAGTGGGGAGCTCAAGGGTGG - Intronic
1134520531 16:14917414-14917436 GGGAGTGGGGAGCTCAAGGGTGG + Intronic
1134551043 16:15138560-15138582 GGGAGTGGGGAGCTCAAGGGTGG - Intronic
1134708203 16:16316065-16316087 GGGAGTGGGGAGCTCAAGGGTGG + Intergenic
1134715418 16:16356098-16356120 GGGAGTGGGGAGCTCAAGGGTGG + Intergenic
1134951399 16:18352580-18352602 GGGAGTGGGGAGCTCAAGGGTGG - Intergenic
1134959339 16:18396061-18396083 GGGAGTGGGGAGCTCAAGGGTGG - Intergenic
1135128185 16:19829079-19829101 GAGAATTTGGACCAGAGGGGTGG + Intronic
1135394821 16:22123190-22123212 GAAAATGGGGTGCAGAAAGTGGG + Intronic
1135849883 16:25953593-25953615 GTGAATGGGGATGAGATGGGTGG + Intronic
1135882682 16:26274112-26274134 GAGAATGGAGAGAAGAAGATGGG - Intergenic
1135886531 16:26314584-26314606 GAGACTGGGGAGGAGAGAGGAGG - Intergenic
1136641397 16:31568694-31568716 GAGATTGGAGAGCTGAAGGATGG - Intergenic
1137462789 16:48680532-48680554 CAGCATTGGGAGCAGAAGGAAGG - Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1137934562 16:52622126-52622148 GAGAAGGTGGATGAGAAGGGAGG + Intergenic
1138561927 16:57806297-57806319 GAGAATGGGGTGAAGGAGAGGGG - Intronic
1138702826 16:58882320-58882342 GAGAAGAGGGTGGAGAAGGGTGG + Intergenic
1139317620 16:66087076-66087098 GAGAATAGAGAAAAGAAGGGTGG + Intergenic
1139318568 16:66094345-66094367 AAGGAAGGGGAGCAGAAGGCCGG - Intergenic
1139413916 16:66790283-66790305 GAGAAAGGGGAGAGGAGGGGAGG + Intronic
1139424922 16:66873699-66873721 GAGGAGGGGGAGGAGGAGGGGGG - Intergenic
1139482788 16:67239925-67239947 GGGAATGGAGAGAAGATGGGAGG + Intronic
1139754573 16:69132335-69132357 AAGAATGGCGAGCCGAGGGGCGG - Intronic
1139933787 16:70552113-70552135 GAGAATGGGGCAAAGAAGGGAGG - Intronic
1140026740 16:71297662-71297684 GAGAGTGGGGAGAGGAAGGCAGG - Intergenic
1140716375 16:77728955-77728977 GAGAATGGGGTGCAGGGAGGAGG - Intronic
1140981285 16:80112156-80112178 GGGAATGGAGTGCAGAGGGGTGG + Intergenic
1141007164 16:80363233-80363255 GAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1141099253 16:81185112-81185134 GAGGATGGAGAAGAGAAGGGTGG - Intergenic
1141366441 16:83447924-83447946 GAGACTGGGGACCAGAGAGGTGG - Intronic
1141372457 16:83500512-83500534 GAGGAGGGGGAGGAGGAGGGAGG - Intronic
1141818938 16:86431970-86431992 CAGAATGTGGGGCAGTAGGGTGG + Intergenic
1141845105 16:86603327-86603349 GAGAAGGGGGAGGAGAAAAGAGG - Intergenic
1142108695 16:88319623-88319645 GTGGATGGGGAGGAGAAGGGTGG - Intergenic
1142684890 17:1571997-1572019 GAGGATGAGGGGCAGACGGGAGG + Intronic
1143333677 17:6157070-6157092 GAGCCTAGGGAGCAGAAGTGAGG + Intergenic
1143704459 17:8687362-8687384 GGGAGTGGGGAGGAGAGGGGAGG - Intergenic
1143757565 17:9078158-9078180 GAGAGTGGTGAGCAGAAGAATGG + Intronic
1144534783 17:16077523-16077545 GAGGAGGGGGAGGAGAGGGGAGG + Intronic
1144560994 17:16320259-16320281 GAGGAAGGGGAGGAGAGGGGAGG + Intronic
1146160628 17:30557597-30557619 GGGAATGGGGAGAACAAGGCTGG + Exonic
1146210498 17:30938761-30938783 GTCTATGGGGAGGAGAAGGGAGG + Intronic
1146263510 17:31436551-31436573 GAGCAGGGGGTGCAGAAGAGTGG + Intronic
1146329808 17:31917670-31917692 GAGAAAGGGGGTCAGGAGGGAGG - Intergenic
1146544235 17:33724590-33724612 GGGAATGAGGAGCCTAAGGGAGG + Intronic
1146935659 17:36811180-36811202 GAGTGTGGGGAGCAGGAGGGAGG - Intergenic
1147212474 17:38879953-38879975 GAGAAGGGGCAGCTGAAGGAGGG - Intronic
1147219678 17:38920922-38920944 GAGAGTGGTGAGTGGAAGGGAGG + Exonic
1147363019 17:39943321-39943343 GAGGACGGGGAGGAGGAGGGAGG + Intronic
1147414403 17:40278197-40278219 GAGAATGGGTGGCAGAGGTGGGG - Exonic
1147500095 17:40954830-40954852 GAGAGTGAGGAGCAGAAGACGGG + Intergenic
1147566521 17:41539555-41539577 GAGCATGGGGAGAAGAGAGGAGG + Intergenic
1147705649 17:42423159-42423181 GAGAAGCAGGAGCGGAAGGGAGG + Exonic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1147882414 17:43662711-43662733 GAGAAAGGGAAGCAGGTGGGTGG - Intergenic
1148143566 17:45345282-45345304 GAGGGTGGGGAGCAGAGTGGAGG + Intergenic
1148454157 17:47801938-47801960 GAGAATGAGGACAAGAAGGAAGG - Intergenic
1149292414 17:55230105-55230127 GAGAATGGTGAGCAGAAGAGTGG - Intergenic
1149649745 17:58269327-58269349 GAGAAGGGAGAGCAGATGGCTGG - Intergenic
1150483824 17:65530755-65530777 GGAAATGGGGAGAAGAGGGGAGG - Intronic
1150645764 17:66976586-66976608 GACGATGGGGAGGAGAAAGGAGG - Intronic
1150648070 17:66992266-66992288 TAGATTGGGGAGGAGACGGGTGG + Intronic
1150833288 17:68542169-68542191 GAGGATGGGGAGGAGAGAGGAGG + Intronic
1150964177 17:69948492-69948514 GAGAAGGAGGAGGAGAGGGGAGG + Intergenic
1151056476 17:71037671-71037693 GAGAATGCTGAGCAGCAGCGTGG + Intergenic
1151367427 17:73626550-73626572 GGGGATGGGGAGCTGGAGGGAGG - Intronic
1151433140 17:74078458-74078480 GAGCAGGTGGAGAAGAAGGGAGG + Intergenic
1151518460 17:74612444-74612466 GGGACTGGGGAGGAGAAAGGAGG + Exonic
1151549409 17:74813435-74813457 GAGAATGAGGGGCTGAAGTGAGG - Intronic
1151599722 17:75098814-75098836 GAGGATGCAGGGCAGAAGGGAGG + Intronic
1151680965 17:75622495-75622517 GAGGATGGGGAGCGGATGGTGGG + Intergenic
1151815693 17:76470380-76470402 GAGAGTGGGGAGCAGCAGGATGG + Intergenic
1151925028 17:77189247-77189269 GAGAACAGAGAGCAGATGGGTGG + Intronic
1152002582 17:77655806-77655828 GACAATGGGGAGGAGAGGGATGG - Intergenic
1152099241 17:78291529-78291551 GAGACTGAAGAGCAGCAGGGAGG + Intergenic
1153328567 18:3848284-3848306 GAGGAGGAGGAGCAGTAGGGAGG + Intronic
1153471974 18:5456926-5456948 GAGAAGCTGGAGCAGCAGGGAGG + Intronic
1153741957 18:8138522-8138544 GAGACTGAGGACCAGAACGGAGG - Intronic
1153825141 18:8868160-8868182 GGGAATGTGGAGCAGAAGGTGGG - Intergenic
1153976508 18:10272665-10272687 GGGAACGGGGAAGAGAAGGGAGG + Intergenic
1154024544 18:10695295-10695317 GAGGCTGGGGAGAAGAAGGCTGG + Intronic
1154031448 18:10757093-10757115 GAGGATGGGGAGGAGAAATGGGG + Intronic
1154032531 18:10766282-10766304 GAGAAGGGGAAGCAGAAAGGAGG + Intronic
1154484987 18:14866234-14866256 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1155325715 18:24662968-24662990 GAGAATGGGGAGAAGGAAAGAGG - Intergenic
1155326153 18:24666780-24666802 GAAAATGGGGAGGAGAAAAGTGG - Intergenic
1155621665 18:27786593-27786615 CAGAATGGGATCCAGAAGGGTGG + Intergenic
1155668077 18:28335732-28335754 GAGAATGAGGTGGAGAAGGGTGG - Intergenic
1156024815 18:32640199-32640221 AAGAATGGAGAACAGAAGAGTGG - Intergenic
1156265320 18:35482752-35482774 GAGAGTGGGGTGCGGAAGGGAGG - Intronic
1156329419 18:36105627-36105649 AAGAATGAGCAGCAGAGGGGAGG - Intergenic
1156463577 18:37335008-37335030 GAGAGGGGGGAGCAGAGGGAGGG - Intronic
1156605238 18:38658438-38658460 CTGAATAGGGAGCATAAGGGTGG + Intergenic
1157085209 18:44573440-44573462 GAGAATGGAGGGTAGAAGGAGGG + Intergenic
1157560825 18:48644747-48644769 GAGTATGGGGAGGAGTAGGCTGG + Intronic
1157618397 18:49001405-49001427 GGGAGTGGGGAGTAGAAGGAGGG + Intergenic
1157954512 18:52081837-52081859 GAGAATAGGGAACAGTGGGGAGG + Intergenic
1158058713 18:53312961-53312983 GGGAGTGGGGAGAGGAAGGGAGG + Intronic
1158326630 18:56320050-56320072 GAGAAAGGGGAGGAGAAGATGGG - Intergenic
1158851037 18:61496038-61496060 GAGAGGGGGGAGAGGAAGGGAGG - Intronic
1158851046 18:61496062-61496084 GAGAGGGGGGAGAGGAAGGGAGG - Intronic
1158963470 18:62604814-62604836 GAGAAGGAGAAGGAGAAGGGAGG + Intergenic
1159009275 18:63042931-63042953 GAGCATGGGGAGGAGGATGGAGG + Intergenic
1160325692 18:77945399-77945421 AACAAGGAGGAGCAGAAGGGAGG + Intergenic
1160453210 18:78979339-78979361 GAGAGGGGGGAGTGGAAGGGAGG + Intergenic
1160570798 18:79816389-79816411 GAGAAGGGGGAGGGGAGGGGAGG - Intergenic
1160819772 19:1052505-1052527 GAGGAGGGGGAGGAGAAGGGGGG + Intronic
1160819835 19:1052671-1052693 GAGAAGGGGGAGGAGTAGGAGGG + Intronic
1160965635 19:1745934-1745956 GAGAAGGGGGAGTAGAAGGAAGG + Intergenic
1160991389 19:1861744-1861766 GAGGGTGGAGAGCAGGAGGGCGG - Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161403992 19:4081767-4081789 GAGAAGGGGGAGTAGGAGGGAGG - Intergenic
1161565704 19:5000919-5000941 AGGAATGGGGAGGAGAAAGGGGG - Intronic
1161732860 19:5972748-5972770 GAGCTTGGGGTGGAGAAGGGGGG - Intronic
1161899796 19:7109919-7109941 GAGAACTGGGAGCAGAAAGGAGG + Intergenic
1162024183 19:7884495-7884517 GAGGAGGGGGAGGAGAAGGAAGG + Intergenic
1162053081 19:8046782-8046804 GAGGAGGGGGAGGAGAAGGGGGG - Intronic
1162180814 19:8867531-8867553 GTGAATGGGGAGGAGAATGGGGG + Intronic
1162283594 19:9720371-9720393 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
1162549511 19:11350837-11350859 GAGAAGGAGGAGCACAAGTGGGG + Exonic
1162646564 19:12054213-12054235 GAGAATGGCGAGAACACGGGAGG + Intergenic
1162780033 19:13002179-13002201 GAGAAAGGGGGAAAGAAGGGGGG - Intronic
1163082339 19:14953078-14953100 GAACATGGGGAGCAGATGGAGGG + Intronic
1163125830 19:15243711-15243733 GAGCATGGGGAGCAGGAGCTGGG - Intronic
1163350968 19:16776974-16776996 GAGAGTGGGGAGGGGAAGGGAGG + Intronic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163610122 19:18296291-18296313 GTGAGTGGGGAGAAGAAGAGGGG - Intergenic
1163652979 19:18529680-18529702 GAGAAGTTGGTGCAGAAGGGAGG - Intergenic
1163779604 19:19239549-19239571 GAGGATGGAGAGGAGAAAGGAGG - Intronic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1163779722 19:19239969-19239991 GAGGATGGGGAAGAGAAAGGAGG - Intronic
1163779739 19:19240031-19240053 GAGGAGGGGGAGGAGAAAGGAGG - Intronic
1163779755 19:19240069-19240091 GAGGATGAGGAGCAGGAGGGAGG - Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164022579 19:21321617-21321639 GAGGATGGGGAGGGGAGGGGAGG + Intronic
1164401866 19:27908124-27908146 GAGGATGGAGTGCAGAAGAGAGG + Intergenic
1164441259 19:28282346-28282368 GAGAATGGGGAGAAAATGGCAGG - Intergenic
1164453871 19:28390770-28390792 GAGTAAGGGGAACAGAAGAGTGG + Intergenic
1164551987 19:29219546-29219568 GAGCAAGGGGAGCAGAAAGGAGG + Intergenic
1164836612 19:31358945-31358967 GAGGATGGGGAGGAGGAAGGAGG - Intergenic
1165015870 19:32879614-32879636 GGGAATGGGGAGCAGCAGGACGG + Intronic
1166161788 19:40959475-40959497 GAGAAGGGGGAGAGGAAGGGAGG - Intergenic
1166232697 19:41434656-41434678 GAGAAAGGGAAGGAGAAAGGAGG + Intronic
1166250611 19:41567863-41567885 GGGAATGTGGAGAAGAAAGGAGG + Intronic
1166400243 19:42473552-42473574 GAGAATGGCGTGAACAAGGGAGG - Intergenic
1166433081 19:42742525-42742547 AAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166446058 19:42857778-42857800 GAGAAGAGGGAGCAGCAGAGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166823144 19:45592739-45592761 GAGTGTGGGGAGAAGAAGGTTGG - Intronic
1166843152 19:45711303-45711325 GAGGATGGGGGCCAGAATGGGGG + Exonic
1166981772 19:46635549-46635571 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981798 19:46635619-46635641 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981814 19:46635657-46635679 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981830 19:46635695-46635717 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1167112024 19:47468212-47468234 GAGGCTGAGGAGCAGAGGGGAGG - Intronic
1167333548 19:48870899-48870921 GAGAATGGCGAGAACCAGGGAGG + Intergenic
1167380421 19:49134976-49134998 GGAAGTGGGGATCAGAAGGGAGG - Intronic
1167577946 19:50326665-50326687 GAGAATGTGGTGGAAAAGGGGGG - Intronic
1167672738 19:50863616-50863638 TAGAATGGGGAGGAAAAGAGGGG - Intronic
1168059602 19:53883465-53883487 GGAAAAGGGGAGCTGAAGGGGGG + Intronic
1168396732 19:56054742-56054764 GGGAATGGGAAGTAGAAGGGGGG + Intronic
925288260 2:2729923-2729945 GAGATTGAGTAGCAGAAGGCAGG + Intergenic
925372938 2:3360928-3360950 AAGGAAGGGGAGGAGAAGGGAGG + Intronic
925443332 2:3907119-3907141 GAGGAATGGAAGCAGAAGGGAGG - Intergenic
925450009 2:3961182-3961204 GAGAATGGCGTGAACAAGGGAGG - Intergenic
925718788 2:6808785-6808807 GAGAAAGGGGAGGAGGAGGGAGG + Intergenic
925835234 2:7938742-7938764 AAGTATGGGGAGCAGACAGGAGG - Intergenic
926216434 2:10908460-10908482 TAGATGGGGGAGCAGAAGGCTGG - Intergenic
926846456 2:17146520-17146542 GGGAATGGGGAGCAGGGGGGTGG + Intergenic
927130137 2:20051723-20051745 GCCAATGGGGAGCGGAAGGCTGG + Exonic
927135952 2:20096685-20096707 GAGAATGGAGGGCAGAGGGTGGG - Intergenic
927187353 2:20491313-20491335 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
927287510 2:21371701-21371723 GAGAAAGGGGAGAGAAAGGGAGG + Intergenic
927307532 2:21590642-21590664 CAGACTGGGGAGCAGAAGAGAGG - Intergenic
927365213 2:22287176-22287198 GAGAATGGGAAAAAGAAGGGAGG + Intergenic
927372170 2:22368818-22368840 GAGAATGGGGAGGGGAGGGGAGG + Intergenic
928083103 2:28327237-28327259 GAGAAGGAGGAGGAGAAGGGAGG - Intronic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
929237895 2:39625751-39625773 GAGAGTGGGGAGGGGAATGGAGG + Intergenic
929244482 2:39686671-39686693 CAGGATGGGGAGAAGATGGGGGG + Intronic
929254293 2:39792551-39792573 AAGAATGGGAAGCAGAAAGTTGG + Intergenic
929460480 2:42099339-42099361 CAGCATGGGGAGCAGAGGTGGGG + Intergenic
930021518 2:47004662-47004684 GGGAATGAGCAGGAGAAGGGAGG + Intronic
930984019 2:57563208-57563230 GGGACTGAGCAGCAGAAGGGCGG - Intergenic
930989345 2:57632010-57632032 GAAAATGGAGACTAGAAGGGAGG + Intergenic
931474041 2:62570344-62570366 GAGGGTGGGGAGGGGAAGGGAGG - Intergenic
931711702 2:64993451-64993473 GAGAATTGGGATGAGAAGGCTGG + Intronic
931784398 2:65606384-65606406 GATAATAGGAAGTAGAAGGGTGG + Intergenic
931826296 2:66004181-66004203 GGGAAGGGGAAGGAGAAGGGAGG - Intergenic
933206688 2:79514180-79514202 GAAAATAGGGAGCAGAAGGGTGG + Intronic
934930767 2:98420871-98420893 GAGACTGTGGAGCAGAAGGAAGG - Intergenic
935211233 2:100940852-100940874 GAGAATGAGGAGCTGAGAGGTGG + Intronic
935556488 2:104515398-104515420 GAGTGTGGGGAACAGCAGGGAGG + Intergenic
935624722 2:105162627-105162649 TTAAATGGGGAGAAGAAGGGAGG + Intergenic
935958763 2:108403382-108403404 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
936379408 2:111970748-111970770 GAGGAGGAGGAGGAGAAGGGAGG - Intronic
936530465 2:113272885-113272907 GAGAATGAGGACCCGAAGGGGGG + Intronic
936672383 2:114672367-114672389 GAGAATGGGAAGGAAATGGGGGG - Intronic
936687908 2:114849977-114849999 GGGGATGGGGAGGAGAGGGGAGG - Intronic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
937042480 2:118833263-118833285 GAAAATAGGGAGTGGAAGGGTGG + Intergenic
937573353 2:123390970-123390992 GAGAATGGGGAGGAGGAAGGAGG - Intergenic
938036800 2:128041431-128041453 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
938178405 2:129157463-129157485 GAGAATGCTGAGCAAAAGAGAGG - Intergenic
938191958 2:129291508-129291530 GAGACATGGGAGCAGAACGGAGG + Intergenic
938252046 2:129822908-129822930 AGGAAAGGGGAGCAGGAGGGAGG + Intergenic
938271940 2:129980021-129980043 GAAAAAGGCGAGCGGAAGGGCGG - Exonic
938279066 2:130051870-130051892 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938330050 2:130442746-130442768 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938359895 2:130678757-130678779 GAGAATGGGGAGCACAAGGCTGG - Intergenic
938436304 2:131285478-131285500 GAGAATGGGGAGCACAAGGCTGG - Intronic
938444067 2:131363793-131363815 GAAAAAGGCGAGCGGAAGGGCGG + Intergenic
938688329 2:133762690-133762712 GTGAGTGGGGAGCAGAATGGGGG + Intergenic
938768468 2:134479825-134479847 GAGAAGTGGAAGCAGCAGGGTGG - Intronic
938800562 2:134759622-134759644 GAGAAAGGGGAGGGGAGGGGAGG + Intergenic
939606154 2:144256709-144256731 GGGAAAGGGGAGGAAAAGGGAGG + Intronic
939683463 2:145168310-145168332 AAGAATGGGGAGCAGAACACTGG + Intergenic
940259425 2:151764999-151765021 GAGGATGGGGAGCAGGAGGGAGG - Intergenic
940424423 2:153514596-153514618 GAGAGTGCGGAGGAGAAGAGAGG - Intergenic
940517344 2:154698261-154698283 GAGATTGGGGAGCGGCGGGGAGG + Intergenic
940788435 2:158006377-158006399 GAGAATGGCGTGAACAAGGGAGG + Intronic
941413383 2:165188130-165188152 AATAAGGAGGAGCAGAAGGGTGG + Intronic
941591149 2:167422126-167422148 GAGAAGGGGGAGGAGGAGGGAGG + Intergenic
942143488 2:173001735-173001757 GTGAAGGGGGAGCAGGAGCGAGG + Intronic
942379762 2:175376645-175376667 GAGAAGGGGAAGGGGAAGGGGGG + Intergenic
942454897 2:176130690-176130712 GAGGATGCGGAGGAGGAGGGGGG - Exonic
942711888 2:178846077-178846099 GAGTCTGGGGAGCAGCAGTGAGG + Intronic
944077951 2:195753247-195753269 GAGATGTGGGAGCAGAAGGAAGG + Intronic
944453387 2:199867481-199867503 GAGATTTGGGAGTAGAGGGGAGG - Intergenic
944972135 2:205005135-205005157 GAGAAGAGGGAGCAAAGGGGAGG - Intronic
945367811 2:208977911-208977933 CAGAAAGGGGAGGGGAAGGGAGG - Intergenic
945647909 2:212523618-212523640 GATGATGAGGAGCAGATGGGTGG + Intronic
945851179 2:215009290-215009312 TAGAGAGGGGAACAGAAGGGTGG + Intronic
945987531 2:216367312-216367334 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946052487 2:216875416-216875438 GATTATAGGAAGCAGAAGGGAGG + Intergenic
946146565 2:217735492-217735514 GAGAATGGCGGGCAGGAGGCTGG - Intronic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946239184 2:218343595-218343617 GAGGATGGGGAGTAGTAAGGGGG - Intronic
946273007 2:218609799-218609821 GAGACTGTGGTCCAGAAGGGAGG - Intronic
946330420 2:219005899-219005921 GAGCATGGGCAGCAGCAGTGGGG - Intronic
946431208 2:219628071-219628093 GAGATGGGGGAGGAGAGGGGAGG + Intronic
946449708 2:219769311-219769333 AAGCAGGGGGAGGAGAAGGGAGG - Intergenic
946661991 2:222011002-222011024 GAGGGTGGGGAGCAGAAGGAAGG + Intergenic
946777138 2:223155204-223155226 GAGAGAGAGGGGCAGAAGGGTGG - Intronic
946843228 2:223837731-223837753 GAGGAGGAGGAGGAGAAGGGAGG - Intronic
947001265 2:225459731-225459753 GAGAATGGGGAGAACCCGGGAGG - Intronic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947708371 2:232294293-232294315 TAGAATGGGGAGCAGGACAGGGG + Intronic
947751426 2:232534794-232534816 GAGATGGGGGAGAAGAAGAGAGG + Intronic
947805125 2:232961233-232961255 GAGAATGGAGATAAGAACGGTGG - Intronic
947833687 2:233159950-233159972 GAGAATGGGGCCCAGACAGGTGG + Intronic
948087818 2:235265991-235266013 GAGTGTGGGAAGAAGAAGGGCGG + Intergenic
948273288 2:236689884-236689906 GAGAAGGGGGAGAGGAAGGGAGG - Intergenic
948434828 2:237945919-237945941 ACGCATGGGGAGCAGAAGGAAGG + Intergenic
948691210 2:239706294-239706316 GAGAAAGGGGGGCAGAAAGGAGG - Intergenic
948751541 2:240136159-240136181 GGGAAGGGGGAGCGGAAGGGCGG - Intronic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948953670 2:241271874-241271896 GCGACTGGCGAGCAGAAGGCAGG + Intronic
1168814620 20:728234-728256 GGGGGTGGGGAGCAGACGGGCGG + Intergenic
1168848350 20:960141-960163 GAGAAAGGAGAGGAGAATGGAGG + Exonic
1169139294 20:3218005-3218027 GAGAATGGTGTGAACAAGGGAGG - Intronic
1169227795 20:3866825-3866847 GAGAATGGAGACCAGAGGGGAGG - Exonic
1169250070 20:4053540-4053562 GAGAAAGGAGCGGAGAAGGGAGG + Intergenic
1169250863 20:4060356-4060378 GATCTTGGGGAGCAGGAGGGAGG + Intergenic
1169303644 20:4469483-4469505 GAGCCTGGGGAGGAGCAGGGAGG - Intergenic
1169493935 20:6095189-6095211 GAGGATTGGGAGGAGAATGGGGG + Intronic
1170573016 20:17642950-17642972 GAGCATGGCCAGCAGGAGGGTGG + Intronic
1170791805 20:19514846-19514868 TAGAAAGGGGAGCAGAGGGAGGG + Intronic
1170830056 20:19832398-19832420 GACAGTGGGGAGCAAGAGGGAGG - Intergenic
1171216015 20:23352868-23352890 GTGAGTGGGGATTAGAAGGGAGG - Intronic
1172474685 20:35227378-35227400 GAGAAGGGGGAGGGGGAGGGCGG + Intronic
1172506550 20:35467075-35467097 CAGTGTGGGGAGAAGAAGGGAGG + Intronic
1172536907 20:35680989-35681011 GAGAAGGGGTAGAAGGAGGGAGG - Intronic
1173056284 20:39616490-39616512 GAAAATGGGGGGCAGGAGGATGG - Intergenic
1173494564 20:43509219-43509241 GAGAAAGGGGAGGGGAGGGGAGG - Intronic
1173571414 20:44079140-44079162 GGGAGTGGGGAGTAGGAGGGTGG + Intergenic
1173614333 20:44393063-44393085 GAGTATGGGGAGACCAAGGGTGG + Intronic
1173773522 20:45684256-45684278 GAGATTGGGGAGCATGAGGTGGG + Intergenic
1174378586 20:50141994-50142016 GGGGATGGGGAGGGGAAGGGTGG + Intronic
1174663026 20:52231580-52231602 GAGAAGGAGGAGGAGAAGGGAGG - Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175298836 20:57928587-57928609 GAGAAGGAGGAGGAGAAGGGTGG - Intergenic
1175531187 20:59674983-59675005 GAGAAGGGGGAACAGGAGAGGGG - Intronic
1175531200 20:59675023-59675045 GAGAAGGGGGAGGAACAGGGAGG - Intronic
1175571527 20:60026428-60026450 GAGAAGAGGAGGCAGAAGGGAGG + Intronic
1175948216 20:62568507-62568529 GAGAGGGGGCAGCAGAAGGGGGG + Intronic
1176043115 20:63076527-63076549 GAGCATGGGGAGCAAGAGAGGGG + Intergenic
1176796342 21:13373241-13373263 GAGAAGGGGGAGCTGGAGGCTGG - Intergenic
1177550527 21:22615061-22615083 GAGAATGGGGTGAACCAGGGAGG + Intergenic
1178069736 21:28950889-28950911 GACAATGGGAAGGGGAAGGGAGG + Intronic
1178751269 21:35305730-35305752 AAGAAAGGGGAGGAGAAGAGAGG - Intronic
1179117583 21:38508182-38508204 GACAGTGGGGAGAAGAGGGGTGG - Intronic
1179128249 21:38611471-38611493 GAGCTTGAGGAGCAGCAGGGAGG - Intronic
1179135806 21:38678894-38678916 GGGAATGGGGAGGAGAGGGGAGG + Intergenic
1179781233 21:43702274-43702296 GAGAATGGGGAAAAGAAGACAGG + Intergenic
1180304902 22:11066363-11066385 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1180649501 22:17367022-17367044 AGGAAAGGGCAGCAGAAGGGAGG + Intronic
1180720396 22:17903614-17903636 GGGAATGGGACTCAGAAGGGTGG - Intronic
1180897275 22:19345841-19345863 GAAAATGAGAAGCAGAAGGTTGG - Intronic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181333324 22:22111432-22111454 GTGAGAGGGGAGCAGCAGGGAGG - Intergenic
1181422540 22:22811792-22811814 GAGGAGGGGGAGCAGGAGAGGGG - Intronic
1181528980 22:23505411-23505433 GAGAATGGGGTGAACATGGGAGG - Intergenic
1181582157 22:23834379-23834401 GAGACTGGGGAGGGGTAGGGAGG - Exonic
1181759431 22:25048068-25048090 GAGAATGGGGAGGAGAATGGAGG + Intronic
1181854238 22:25770823-25770845 GGGAACGGGGAGGAGATGGGAGG - Intronic
1182048995 22:27299000-27299022 GAGAAAGAGAAGAAGAAGGGAGG + Intergenic
1182408346 22:30158563-30158585 GAGAAGGGGAAGGGGAAGGGAGG - Intronic
1182439469 22:30354296-30354318 ATGAATGGGGACCAGATGGGAGG - Intronic
1182931478 22:34178308-34178330 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1183057345 22:35315113-35315135 GAGAATGGGTGGGAGGAGGGAGG + Intronic
1183068590 22:35380750-35380772 GGGGACAGGGAGCAGAAGGGGGG + Intronic
1183096890 22:35557633-35557655 GAGACTTGGGAAGAGAAGGGTGG + Intergenic
1183319070 22:37154147-37154169 GAAAGTGGGGAGCAGAATGGGGG + Intronic
1183339308 22:37270634-37270656 GGGATCGGGGAGCAGAGGGGAGG + Intergenic
1183388146 22:37526811-37526833 GAAAATGGGGCCCAGAAAGGAGG - Intergenic
1183393618 22:37560016-37560038 GAGAATGGGGAGCAAAGGAGTGG + Intergenic
1183565567 22:38612007-38612029 GGGAGTGGGGAGGAGAAGTGGGG - Intronic
1183727137 22:39596287-39596309 GAGATGGGGGAGCAGGACGGAGG + Intronic
1183794534 22:40104685-40104707 TAGAGTGGGGAGCAGAGAGGAGG + Intronic
1183985635 22:41568767-41568789 GAGACCAGAGAGCAGAAGGGAGG - Intronic
1184169852 22:42752442-42752464 GCCCATGGGGAGCAGAAGGAGGG + Intergenic
1184172741 22:42769294-42769316 GAGGGTGGGGGGCAGCAGGGTGG + Intergenic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184664350 22:45979253-45979275 GAGAAGGGCGCGGAGAAGGGCGG + Intergenic
1184838769 22:47040297-47040319 GAGAACGGCGTGGAGAAGGGTGG + Intronic
1184852470 22:47128318-47128340 GAAAATGTGGAGCAGATGGGTGG - Intronic
1185060275 22:48603022-48603044 GAGAATGGGGACCGGTGGGGTGG - Intronic
1185089359 22:48757176-48757198 GGGAAGGAGGAGGAGAAGGGAGG + Intronic
1185089371 22:48757215-48757237 GGGAAGGAGGAGGAGAAGGGAGG + Intronic
949362325 3:3244865-3244887 GAGTTTGGGGGGCAGAGGGGTGG - Intergenic
949853855 3:8442129-8442151 GGGAAGGTGGAGAAGAAGGGAGG + Intergenic
949972437 3:9420295-9420317 TAGTATGTGGAGCAGAAGAGGGG - Intronic
950453489 3:13078854-13078876 GAGAAGTAGGGGCAGAAGGGCGG - Intergenic
950458874 3:13109249-13109271 GAGAATGGGAGGGAGGAGGGGGG - Intergenic
950610335 3:14122907-14122929 GAGGCTGGGCAGCAAAAGGGTGG + Intronic
950876776 3:16282628-16282650 TAGAAGGGTGAGCAGAAGGTTGG + Intronic
950948644 3:16976722-16976744 GAGAGTGGGGAGATGGAGGGAGG + Intronic
950983164 3:17330965-17330987 GAGAATGGGGAGGAAAAGGAGGG - Intronic
951180790 3:19655803-19655825 GAGAATTGGCATCAGATGGGTGG - Intergenic
951353404 3:21634231-21634253 AGGAAGGGAGAGCAGAAGGGAGG + Intronic
951991388 3:28679336-28679358 AGGAATGGGGAGAAGAGGGGTGG - Intergenic
952277602 3:31892447-31892469 GAGCAGAGGGAGCAGAAAGGCGG + Intronic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952531458 3:34266446-34266468 GAGAAAGGAGGGAAGAAGGGAGG - Intergenic
952633655 3:35501207-35501229 GATGCTGGGGAGCATAAGGGAGG + Intergenic
953002159 3:38945867-38945889 GAGAAAGGGAAGCAGAAGGGGGG - Intronic
953813419 3:46133551-46133573 GAGGATGGAGAGCTGAAGGGAGG - Intergenic
954219637 3:49145093-49145115 GAGATTAGGAAACAGAAGGGGGG - Intergenic
954589740 3:51772957-51772979 GAGAAGGGTAAGCAGGAGGGAGG - Intergenic
954674874 3:52310325-52310347 GAGCAGGGGGACCAGAGGGGAGG - Intergenic
954886804 3:53882052-53882074 GAGAACGGAAAGGAGAAGGGCGG - Exonic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955178653 3:56643663-56643685 GAGAATGGCGAGAACCAGGGAGG + Intronic
955952570 3:64257297-64257319 GAGGGTTGGGAACAGAAGGGTGG - Intronic
955996113 3:64682568-64682590 GAGAAAGCGGAGGAGAAGAGTGG - Intronic
956081026 3:65556364-65556386 GGGCATGGGGACCAGCAGGGAGG - Intronic
957219514 3:77363881-77363903 GAGAAAGGGGAGCAGAAGACAGG + Intronic
957939714 3:86990439-86990461 GGGAAGGGAGAGCAGCAGGGTGG - Intronic
958906574 3:99948522-99948544 GAGAAGGGGGAGGGGAAGGGAGG + Intronic
959240908 3:103792497-103792519 GAGAAGGGGAAGGGGAAGGGAGG - Intergenic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959481092 3:106873514-106873536 GAGAATGTGGAACAGAGTGGAGG + Intergenic
959889259 3:111535297-111535319 GAGCATGGGGTGAAGGAGGGAGG + Intronic
960626254 3:119685124-119685146 GAGGATGGGGATCAGAAGCTGGG - Intergenic
960639098 3:119810032-119810054 GAGAATGGGGAGCAGAAGGGGGG - Intronic
960702373 3:120451047-120451069 GAGAATGGGGAGGAGCTGGGGGG - Exonic
961001445 3:123376735-123376757 GAGAATGGGGAACAAAAGTCTGG + Intronic
961325170 3:126105288-126105310 GCCAAGGGGGAGCAGGAGGGAGG - Intronic
961346033 3:126263940-126263962 TAGATTGGGGAGCAGAAGGGAGG + Intergenic
962262004 3:133916377-133916399 GTGAGCGGGGAGGAGAAGGGAGG + Intergenic
962459042 3:135591768-135591790 GGGATTGGGGAGGAGAAGGAGGG - Intergenic
962619903 3:137167948-137167970 AGGAAAGGGGAGGAGAAGGGAGG - Intergenic
962716939 3:138134529-138134551 CAGAAAGGGGTGCAGAAGGAAGG - Intergenic
962784765 3:138757624-138757646 GAGAGAGGGGAGGGGAAGGGAGG + Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
964512616 3:157469457-157469479 GGGAGTGGGGAGGAGAAAGGAGG + Intronic
964671365 3:159229760-159229782 GAGGAGGGGGAGGAGGAGGGGGG - Intronic
964718986 3:159753056-159753078 GAAGATGAGGAGCAGAAGTGGGG - Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
965438675 3:168685710-168685732 GAGATTGGGGAGCAGCGGGATGG - Intergenic
965694397 3:171392346-171392368 GAGAAAGGGGAGGAGAGGGATGG + Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966043376 3:175519342-175519364 GAGACAGGAGAGCAGGAGGGTGG + Intronic
967202501 3:187084890-187084912 GGGAATAGGGAGGAGCAGGGAGG - Intergenic
968632396 4:1658773-1658795 GAGGATGGGGCACAGGAGGGGGG + Intronic
968889174 4:3358922-3358944 GAGGAAGGGGAGGAGGAGGGGGG - Intronic
969126522 4:4952449-4952471 GGGAATGAGGAGGAGATGGGAGG - Intergenic
969358960 4:6649127-6649149 CAGAATAGGGAGGAAAAGGGAGG - Intergenic
969397670 4:6933263-6933285 GGGAAGGGGGAGGGGAAGGGAGG - Intronic
969492533 4:7508194-7508216 GGGAAGGGGGAGAAGGAGGGAGG + Intronic
969609965 4:8222022-8222044 GAGAGAGGGGAGGAGAAAGGAGG - Intronic
970170488 4:13284377-13284399 GACCATGGGGAGCAGAACTGAGG - Intergenic
971008647 4:22405090-22405112 GAGAAGGGGTAGAAGAAAGGTGG + Intronic
971426082 4:26516908-26516930 GAGAATTGGGCCAAGAAGGGTGG - Intergenic
972103243 4:35447880-35447902 GAGAAAGGAGGGAAGAAGGGAGG + Intergenic
972147974 4:36052876-36052898 GAGAATGGTGAGAACCAGGGAGG + Intronic
972281492 4:37606117-37606139 GAGAAGGAGGAGGAGAAGGAAGG + Intronic
972510091 4:39760849-39760871 GAGTAGGAGGAGCAGAAGTGAGG + Intronic
972662615 4:41130761-41130783 GCGGATGGGGAGCAGAAGTGGGG - Intronic
972689465 4:41382486-41382508 GGGAATTGGAAGCAGGAGGGAGG + Intronic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974297453 4:60020452-60020474 AAAAACAGGGAGCAGAAGGGAGG - Intergenic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
976389409 4:84493559-84493581 GAGAAAAGGGAGGAGAGGGGAGG + Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977133036 4:93266949-93266971 GACACTGGAGATCAGAAGGGTGG - Intronic
977259385 4:94780776-94780798 GAGAATGGCGTGAACAAGGGAGG - Intronic
977597854 4:98903312-98903334 AAGAATGCAGAGCAGAAAGGTGG + Intronic
977996153 4:103499181-103499203 GTGAATGGGTAACAGAAGAGAGG + Intergenic
978097655 4:104797827-104797849 GATAATGGAGAGTAGAAGGATGG - Intergenic
978268573 4:106859064-106859086 GTGAAGGGGGAGGAGGAGGGGGG + Intergenic
978457064 4:108906199-108906221 GTGAGGGGGCAGCAGAAGGGAGG - Intronic
978625395 4:110679704-110679726 GGGAATGGAGAGAGGAAGGGGGG - Intergenic
979131932 4:117057710-117057732 GACAATTGGGACCAGAAGGAAGG + Intergenic
979328216 4:119403384-119403406 GAGAATGTGTAGGAGAAGGACGG - Intergenic
979403910 4:120285379-120285401 GAGCATGGAGAGAAGCAGGGAGG + Intergenic
979621540 4:122804070-122804092 GAGAGCAGGCAGCAGAAGGGTGG + Intergenic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
980962694 4:139492124-139492146 GAGGCTGGGGAGGAGAGGGGTGG - Intergenic
980967994 4:139542229-139542251 GAGGCTGGGGAGTAGAAGGCAGG + Intronic
980981436 4:139657604-139657626 GAGGAAGGGGAGGAGAAGGAGGG + Intergenic
981342309 4:143635520-143635542 GAGGATGAGGAGGAGCAGGGAGG - Intronic
981737894 4:147971895-147971917 GAGAATGGGGAGTTCCAGGGTGG + Intronic
982063153 4:151624787-151624809 GAGGTCGGGGAGCAGAAGGGAGG + Intronic
982196343 4:152919313-152919335 GTGAATGGTCAGGAGAAGGGAGG + Intergenic
982795328 4:159637424-159637446 GAAAATGGGGACCAGCAGGAAGG - Intergenic
983334610 4:166375821-166375843 GAGGTTGGGGTGCTGAAGGGAGG + Intergenic
984606727 4:181794471-181794493 TAGAATAGAGAGTAGAAGGGCGG - Intergenic
984771034 4:183436353-183436375 GAGAAAGGGAAGCAGAGAGGTGG + Intergenic
985121436 4:186646783-186646805 GAGAACGGGGAGCAGGAGCATGG - Intronic
985200126 4:187476079-187476101 GAGAAAGGGGAGGTGAAGTGGGG + Intergenic
985774549 5:1833977-1833999 GAGAAGAGGGAGCAGCCGGGAGG - Intergenic
985966805 5:3343846-3343868 GAGACTGGGAAGAAGCAGGGTGG + Intergenic
986009734 5:3701177-3701199 GAGAAGGAGGAGAAGAAGGAGGG - Intergenic
986221740 5:5774798-5774820 GAGAAAGGGGAGGAGGAGTGGGG - Intergenic
987983045 5:25113200-25113222 GAGAGTGGAGAGTAGAAGGAGGG + Intergenic
988251874 5:28769550-28769572 GGGAATGGGTAGCAGAAAGATGG + Intergenic
988457623 5:31400645-31400667 GGGCATGGGGAGCAGGAAGGAGG - Exonic
988701413 5:33678745-33678767 GAGAAAGGGTGGCAGGAGGGTGG + Intronic
990499022 5:56376535-56376557 CAGAATGGGGAGCTGGAGAGGGG + Intergenic
991343434 5:65637539-65637561 GAGAATGGGGTGAACATGGGAGG + Intronic
991433616 5:66573456-66573478 GGGAAGGGGGGGCAGGAGGGAGG + Intergenic
992149922 5:73892772-73892794 TATAATTGGGAGCACAAGGGTGG + Intronic
992349692 5:75916336-75916358 GAGAAGGGGAGGAAGAAGGGGGG - Intergenic
992571589 5:78065044-78065066 GAGAGTGAGGAGTAGCAGGGTGG + Intronic
992579058 5:78151995-78152017 GGGAAGGGGCAGGAGAAGGGAGG - Intronic
992948964 5:81837954-81837976 GGGAAGCGGGAGCAGGAGGGAGG + Intergenic
993321448 5:86472584-86472606 GAGAATGGGGAAAGGAAGAGTGG + Intergenic
993486862 5:88497429-88497451 GAGTATGGGGAGCACAGAGGAGG - Intergenic
993692987 5:91025639-91025661 CTGAATGTGCAGCAGAAGGGTGG - Intronic
994046700 5:95318311-95318333 GAGAATAGGGAGGGGACGGGAGG - Intergenic
994278174 5:97864975-97864997 GAGAATGGGGTGAACACGGGAGG + Intergenic
994284541 5:97948948-97948970 GAGAACGGGGAGGGGAGGGGAGG - Intergenic
994389880 5:99179505-99179527 GAGAAGGGTGAGCAGGAGGGAGG + Intergenic
994475151 5:100258537-100258559 AAGAATGGAGAGAAGAATGGAGG - Intergenic
994549052 5:101207765-101207787 GAGAATTGGGACCAGAGGTGGGG + Intergenic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995154816 5:108898532-108898554 GAGGAAGGGGAGGGGAAGGGAGG - Intronic
995432374 5:112095292-112095314 GAAGATAGGGAGCAAAAGGGTGG + Intergenic
995606841 5:113866082-113866104 GAAAATGGGATGGAGAAGGGTGG + Intergenic
996126031 5:119726715-119726737 GAGAATTGGTACCAGAAGTGGGG + Intergenic
996387594 5:122925254-122925276 GAGAAGGGGGAGGGGAAGGAAGG - Intronic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996506290 5:124271095-124271117 TAAAATGGGGAGAGGAAGGGAGG + Intergenic
997228984 5:132229057-132229079 GAGAAGGGGGAGGAGATGGAAGG - Intronic
997294677 5:132762093-132762115 GAGAATCAGGAGCACCAGGGAGG - Intronic
997932103 5:138081134-138081156 GAGAATGGCGTGAACAAGGGAGG + Intergenic
998299258 5:141002281-141002303 ATGAATGGGGAGCAAAGGGGCGG + Intronic
998387421 5:141765769-141765791 GAGATTGGAGAGCAGGAGGATGG - Intergenic
998569626 5:143245599-143245621 GAGAAAGGGGATAAGAAGGCAGG - Intergenic
998592219 5:143489801-143489823 GTGAGTGGGGAGAGGAAGGGAGG + Intergenic
999236210 5:150097314-150097336 GGGAAGGGGAAGGAGAAGGGAGG + Intronic
999265219 5:150262541-150262563 GAGAATGTGCAGGAGAAGTGAGG - Intronic
999747126 5:154600886-154600908 GAGAAGGGGCAGGAGCAGGGTGG - Intergenic
1000209802 5:159098595-159098617 GAAAATGGAGAGAGGAAGGGAGG + Intronic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1000440515 5:161257788-161257810 GAAATTGAGAAGCAGAAGGGAGG - Intergenic
1000963663 5:167629880-167629902 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1001014567 5:168128520-168128542 GGGAAGGGGGAGCAAAGGGGAGG - Intronic
1001570249 5:172726021-172726043 GAGCCTGAGGAGCAGCAGGGAGG - Intergenic
1002036749 5:176476897-176476919 GAGAATGGCGTGAACAAGGGAGG - Intronic
1002512120 5:179727544-179727566 GAGAGTGGAGAAAAGAAGGGTGG + Intronic
1002524769 5:179808945-179808967 GAGAATGGGGTGAAGGTGGGAGG - Intronic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002696988 5:181098345-181098367 AAGGGTGGGGAGCAGAGGGGTGG + Intergenic
1002697021 5:181098415-181098437 AAGGGTGGGGAGCAGAGGGGTGG + Intergenic
1002723686 5:181281461-181281483 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1003107840 6:3228934-3228956 GAGACTGCGGATCTGAAGGGAGG - Intronic
1003329046 6:5114248-5114270 AAGACTGGGGGGCAGAAAGGTGG + Intronic
1003655329 6:8001833-8001855 GAAAATGGGGAGCATAGGGAAGG + Intronic
1003928025 6:10895614-10895636 GAGAAAGGAGAACAAAAGGGGGG + Intronic
1004135724 6:12964436-12964458 GAGAATGGGGAACAGAAAGAGGG + Intronic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1004581774 6:16961354-16961376 GTGAATGGGGAGTCGAGGGGTGG + Intergenic
1004831205 6:19478338-19478360 GAGGATATGGAGCAGAAGTGAGG + Intergenic
1004993763 6:21168231-21168253 GAGGAGGAGGAGCAGAAGGCTGG - Intronic
1005758442 6:28946357-28946379 GAGAATGGAGAACAAAGGGGAGG + Intergenic
1006295066 6:33166660-33166682 GAGAGTGGGGTGGAGAGGGGTGG - Intronic
1006299241 6:33185103-33185125 GAGAAAGGTTAGCAGAAGGGAGG + Intronic
1006321583 6:33322570-33322592 GAGAATGGGGAAAATTAGGGTGG - Intronic
1006404666 6:33838007-33838029 GAGAGAGGGGAGCTGCAGGGAGG + Intergenic
1006449834 6:34099498-34099520 GAGAGTGGGGACTAGCAGGGGGG + Intronic
1006611105 6:35295116-35295138 GGGAAGGGGGTGCAGAAGGAAGG - Intronic
1006719704 6:36142389-36142411 GAGAATGGAGAGGAGAATGGAGG - Intronic
1006906880 6:37538679-37538701 GGGACTGGGAAGCAGCAGGGAGG - Intergenic
1007339434 6:41181153-41181175 GAGGATGGAGAGAAGAAGGGTGG - Intergenic
1007400030 6:41598161-41598183 GAAAATGGGGAGGAGAAGGTGGG - Intronic
1007637341 6:43307503-43307525 GAGAATGTGAAGCAGAGGGCTGG + Intronic
1007789178 6:44299195-44299217 GAGAATGGGGATCAGGAGTGTGG - Intronic
1008031908 6:46706372-46706394 GAGAATTGCGAGCAGAAGCTTGG + Intronic
1008246135 6:49175926-49175948 GAGAAAGGGGAGTAGGAGGAAGG + Intergenic
1008541991 6:52553554-52553576 TAGAATGGGGAGGAGGAAGGAGG - Intronic
1008921741 6:56850121-56850143 GAGAAAGGGGAGGTGGAGGGAGG - Intronic
1010704368 6:79090025-79090047 GAGAGAGGGGGGAAGAAGGGAGG - Intergenic
1011167667 6:84467793-84467815 AAGAAAGGGGAAGAGAAGGGAGG - Intergenic
1012903558 6:105037470-105037492 GAGGAGGGGGAGGAGAGGGGAGG - Intronic
1013341698 6:109221553-109221575 GAGGAAGGGGAGGGGAAGGGAGG - Intergenic
1013429099 6:110040110-110040132 GAGAAGGGGCAGCAGAGAGGGGG + Intergenic
1013474502 6:110495030-110495052 GAGAATTGGAAGCAGCAGGATGG - Intergenic
1014266121 6:119279710-119279732 GAGAAAGCGGAGGAGAAGGTAGG - Intronic
1014411838 6:121134334-121134356 GAGAATGGAGAGCAAGAGGAGGG - Intronic
1014885167 6:126771474-126771496 TAGCATGGGGAGCAGAAATGGGG + Intergenic
1015876881 6:137831343-137831365 GAGGAGGGGGAGCAGAGGGAGGG + Intergenic
1016387648 6:143544045-143544067 GAGAAAGGGGAACAGAAGATAGG - Intronic
1017512648 6:155128054-155128076 GAAAAGGGGGAGAAGGAGGGAGG - Intronic
1017908299 6:158771839-158771861 GGGGATGGGGAGCAGCAGTGAGG - Intronic
1018352525 6:162975773-162975795 GAAAAGGGAGAGAAGAAGGGAGG - Intronic
1018429746 6:163713528-163713550 GAGAATGAGGAGGAGAGGGTTGG - Intergenic
1018844733 6:167547598-167547620 GGGAAGAGGGAGGAGAAGGGAGG - Intergenic
1018924284 6:168195528-168195550 GAGCAGGGGGAGGAGGAGGGAGG - Intergenic
1019146844 6:169981210-169981232 GAGATTGGGAAGCAGAAGTGTGG + Intergenic
1019269785 7:140379-140401 GAGCATGGGAAGCAGGTGGGGGG + Intergenic
1019269817 7:140502-140524 GAGCATGGGAAGCAGGTGGGGGG + Intergenic
1019320521 7:413430-413452 GAGAATGGGGTGAAGCCGGGAGG - Intergenic
1019494944 7:1333414-1333436 GAGAAGGGGGAGGAGGGGGGAGG - Intergenic
1019531685 7:1506557-1506579 GAGGAGGGGGAGAAGAAGGAAGG - Intergenic
1019535345 7:1526356-1526378 AAGAAGGGGGAGGAGAAAGGAGG + Intergenic
1019623909 7:2006021-2006043 GAGATGGGGGAGCGGCAGGGAGG + Intronic
1019686763 7:2386198-2386220 GAGAGTGGGGACAAGTAGGGTGG + Intergenic
1019778375 7:2925684-2925706 CAGGATGGGGAGAAGTAGGGAGG - Intronic
1019815640 7:3197840-3197862 GAGAAGCGGGAGCGGAGGGGGGG - Intergenic
1020415067 7:7936042-7936064 GAGAATGGGTAGCTGAAGTGGGG + Intronic
1020530171 7:9323159-9323181 AAGAATGGGGAGAAGGAAGGAGG + Intergenic
1021279105 7:18694903-18694925 GAAAATGAGGAGTAGGAGGGAGG - Intronic
1021759745 7:23892150-23892172 GAGAATGGTTAGTAGAAGGAAGG + Intergenic
1021865509 7:24952824-24952846 GAGATTGGGGAGGGGAAGCGGGG - Intronic
1021969397 7:25951486-25951508 GAGGCTGGTGGGCAGAAGGGCGG - Intergenic
1022057026 7:26747786-26747808 GAGAAAGGGGAGCGGAGGGGAGG - Intronic
1022070424 7:26908467-26908489 AAGAAAGGGGAGGGGAAGGGAGG + Intronic
1022138915 7:27475401-27475423 GAGAGTGGGAAGCATAAAGGTGG + Intergenic
1022235784 7:28459071-28459093 GGGTGTGGGGAGCAGAATGGAGG - Intronic
1022570814 7:31452298-31452320 GAGAATGGGGAATAGAATTGAGG + Intergenic
1023512383 7:40967483-40967505 GAGATTGGGAAGCAGGAAGGAGG - Intergenic
1023916969 7:44596996-44597018 GGGGAAGGGGAGCAGACGGGAGG + Intergenic
1024590972 7:50882919-50882941 GAAAGAGGGGATCAGAAGGGAGG + Intergenic
1024697167 7:51869552-51869574 GGGAATGTGGAGCACAAGGTAGG + Intergenic
1024797237 7:53035362-53035384 GAGGAAGGGGAGCAGACGAGGGG + Intergenic
1024797260 7:53035440-53035462 GAGAAAGGGGAGAGGGAGGGAGG + Intergenic
1024960447 7:54969314-54969336 GTGCATGGAGAGCAGAACGGAGG + Intergenic
1024983650 7:55178058-55178080 GGGAATGGGGAGCAGAGCGGGGG - Intronic
1025289974 7:57709249-57709271 GAGAATGGCGTGAAGATGGGAGG - Intergenic
1025605744 7:63038772-63038794 GAGAAGGGGGAGGAGAAACGAGG + Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026281921 7:68929572-68929594 GGACATGGGGAGCAGAGGGGAGG + Intergenic
1026425320 7:70286144-70286166 GAGAATGGAGTGCAGAAAGCAGG + Intronic
1026800667 7:73397912-73397934 GAGAAGGGGGAGGAGGAGAGAGG + Intergenic
1026904749 7:74056550-74056572 GAGTTGGGGGAGAAGAAGGGAGG + Intronic
1027941066 7:84679717-84679739 GAGAATGGGGAGAACCCGGGAGG + Intergenic
1028455059 7:91029603-91029625 GAGAGTGGGGAGCGGAGGAGAGG - Intronic
1028475095 7:91244629-91244651 GAGAATGCTGAGGAGAAGGGAGG - Intergenic
1028806205 7:95028618-95028640 TAGAATGTGGAGCATAAGTGGGG + Intronic
1029422099 7:100477181-100477203 GAGAAGGAGGAGGAGAGGGGGGG + Intronic
1029457183 7:100677316-100677338 GTGTAGGGAGAGCAGAAGGGTGG - Intronic
1029572103 7:101376771-101376793 GTGATTGAGGAGCAGATGGGAGG + Intronic
1029645155 7:101850349-101850371 GAGAGTGGGGAGAAGTGGGGTGG - Intronic
1029929956 7:104360456-104360478 GAGAATGGGAAGCCAGAGGGAGG + Intronic
1029976519 7:104839849-104839871 GAAAATGGGAAGCAGTATGGTGG + Intronic
1030085980 7:105816091-105816113 GAGGATGGGGAGGAGAAGTGAGG + Intronic
1030379970 7:108800749-108800771 GGGAAGGGGGAGAAGAGGGGAGG - Intergenic
1030820371 7:114085796-114085818 GAGAAGGCGGAGCAGGAGGTGGG + Intergenic
1031639685 7:124145937-124145959 GTGAAGGGGGAGCAGATAGGAGG + Intergenic
1031877400 7:127157236-127157258 GAGGATGGGGAGAAGAAAGGAGG + Intronic
1031978786 7:128110851-128110873 CTGAGTGGGGAGCAGAGGGGTGG - Intergenic
1032269282 7:130388893-130388915 GAGAATGGGAAGGAGTGGGGTGG - Intergenic
1032325840 7:130927463-130927485 GAGGATGGGGAGCACAGGGAGGG - Intergenic
1032341831 7:131080902-131080924 GAGAAGGAATAGCAGAAGGGAGG - Intergenic
1032361273 7:131257704-131257726 GAGGAAGGAGAGGAGAAGGGAGG + Intronic
1032523392 7:132562464-132562486 GAGAAGGAGGAGGAGAAAGGAGG - Intronic
1032560619 7:132888866-132888888 GGGAGGGAGGAGCAGAAGGGAGG + Intronic
1032670059 7:134074312-134074334 AAGAAAGGGGAGAAGAAGGGAGG - Intergenic
1032790991 7:135242204-135242226 GAGGGAGGGGAGCAGAAGGGAGG + Intronic
1033014717 7:137660861-137660883 GAGAAGGGAGAGGAGAGGGGAGG + Intronic
1033154603 7:138946106-138946128 GAGAAAAGGGAGCAGATGAGAGG - Intronic
1033205181 7:139414134-139414156 TAGAATGAGGTGAAGAAGGGGGG - Intronic
1033366990 7:140679231-140679253 GACAAAGGGGCGCAGAGGGGTGG - Exonic
1033477891 7:141708288-141708310 GTGGGTGGGGAGGAGAAGGGAGG + Intergenic
1033599304 7:142877336-142877358 GAGACTGGGGTGCATATGGGAGG - Intronic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1033912835 7:146285868-146285890 GGGAAGGGGGAGGGGAAGGGAGG - Intronic
1034677866 7:152904475-152904497 AGGAATGGGGAGCAGAAGCAGGG + Intergenic
1034885021 7:154792678-154792700 CAGTATGGGGAGCAGATGGTGGG + Intronic
1034888790 7:154820739-154820761 GAGATTGGGGAGAAGGAAGGGGG + Intronic
1035239566 7:157520929-157520951 GAGACTGGGGAGGAGGAGGGTGG + Intergenic
1035468113 7:159092913-159092935 GAGTCTTGAGAGCAGAAGGGAGG - Intronic
1035722051 8:1799303-1799325 GAGGAGGGGGAGGAGAAGGAGGG - Intergenic
1035984778 8:4415250-4415272 GAGGAGGGGGTGCAGAAGTGAGG - Intronic
1036196768 8:6724236-6724258 GAGCAAGGAGACCAGAAGGGTGG - Intronic
1036550911 8:9814532-9814554 GAGAAGGGAGAGGAGAGGGGAGG - Intergenic
1036610922 8:10349334-10349356 GAGAATGGGGAAGAGCACGGCGG - Intronic
1036779205 8:11634212-11634234 GAGAAGGGGGAGGAGAAACGAGG - Intergenic
1037332040 8:17752625-17752647 GTGCATGGGGACCACAAGGGAGG - Intronic
1037348442 8:17923642-17923664 GAGTTTGGGGTGTAGAAGGGCGG + Intronic
1037533124 8:19798492-19798514 GAGATTGGGAAGTAGAAGGAGGG - Intergenic
1037571811 8:20164376-20164398 GAGGATGAGGAGCTGAAGGGAGG + Intronic
1037635748 8:20700097-20700119 GAGAGGGAGGAGCAGAAAGGGGG + Intergenic
1037980457 8:23249808-23249830 GAGCATGTGCAGCAGAAGGCAGG - Intronic
1038190681 8:25317698-25317720 GAGAATGGGGTGCACCCGGGAGG - Intronic
1038190802 8:25318521-25318543 GGGGAAGGGGAGGAGAAGGGAGG - Intronic
1038504912 8:28075856-28075878 GAAAATGGGCTGCAGAGGGGAGG - Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1038905660 8:31899349-31899371 GAGAATAGGGAATAGAAGGATGG - Intronic
1039363792 8:36909223-36909245 AAGAATTGGGAGGAGAAGAGGGG + Intronic
1039363994 8:36911199-36911221 AATTATGGGGAGCAGGAGGGTGG + Intronic
1039447465 8:37644070-37644092 GTGAAGGGTGAGCAGAAGGCAGG + Intergenic
1040656281 8:49513042-49513064 GAGAACGGTGTGCAAAAGGGAGG - Intergenic
1040913305 8:52542969-52542991 GATTATGGGGAGGAGAAGAGGGG - Intronic
1040914976 8:52559470-52559492 GAGAGTGAGGAGGAGAAAGGTGG - Intronic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041241876 8:55855159-55855181 GAGAAGGGGGAGAAGAAGGAAGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041725704 8:61015652-61015674 GAGAAAGCAGAGCAAAAGGGTGG + Intergenic
1041881903 8:62761388-62761410 GAGTATGCGAATCAGAAGGGTGG + Intronic
1042329642 8:67565096-67565118 GATAATGGAGAGCAGGTGGGAGG + Intronic
1043506085 8:80904516-80904538 GAGAAGTGGGAAGAGAAGGGAGG - Intergenic
1043547818 8:81335096-81335118 GAGGAAGGGGGGCAGCAGGGAGG + Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044427804 8:92073363-92073385 GAGGCTGGGGGGCAGGAGGGTGG - Intronic
1045127796 8:99113069-99113091 GAGAAAGCGGAGGAGAGGGGAGG - Intronic
1045262125 8:100585386-100585408 GAGGATGGAGAGGAGAAGGGAGG + Intronic
1045733069 8:105263949-105263971 GAGAATGGAGAAAAGCAGGGTGG - Intronic
1045793953 8:106020718-106020740 GAGAATGGGTGGGAGCAGGGTGG + Intergenic
1046320192 8:112564334-112564356 GAGAAAGGAGGGGAGAAGGGAGG - Intronic
1046859888 8:119078484-119078506 GAGAATGGGGTGCAATAGAGAGG + Intronic
1046936476 8:119889647-119889669 GAGGATGGGGAGGGGAGGGGAGG + Intronic
1047360264 8:124162642-124162664 GAGAGTAGGGAGCAGAAAGACGG - Intergenic
1047658753 8:127009158-127009180 AAGAATGGAGACCACAAGGGAGG + Intergenic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1048019810 8:130527862-130527884 GGGAATGGGGAGTGGGAGGGTGG + Intergenic
1048251429 8:132869581-132869603 GAGAGTGGAGTGGAGAAGGGTGG - Intronic
1048268355 8:133007246-133007268 GAGAAGGGGGAGGAGAGGCGGGG + Intronic
1048457055 8:134587737-134587759 GGGAATGGAGAGAAGAAGGTAGG - Intronic
1048468722 8:134688529-134688551 GAGAAAGGGGAGAAGGAAGGTGG + Intronic
1049402619 8:142436336-142436358 GCGAAAGGGGAGCAGGAGGAGGG - Intergenic
1049415882 8:142494863-142494885 GAAAATGGGGAGCAAAGCGGGGG + Intronic
1050446577 9:5729013-5729035 GGGAGAGGGGAGCAGAAGGGAGG - Intronic
1050468408 9:5958367-5958389 GAGAAAGGGGAACTGAAAGGGGG - Intronic
1050963212 9:11764892-11764914 GAAAATAGAGAGCAGAAGGATGG + Intergenic
1050991328 9:12156359-12156381 CAGAATGGGGTGCAGATTGGGGG - Intergenic
1052635023 9:31092235-31092257 GAGAATGGAGGGTAGAAGGAGGG - Intergenic
1053185402 9:36012150-36012172 GAGAATGAAGAGAAGACGGGAGG + Intergenic
1053271792 9:36755092-36755114 AAGTATGGGCAGCAGAAGTGGGG - Intergenic
1053885901 9:42645087-42645109 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1054224919 9:62452536-62452558 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1054903601 9:70394601-70394623 GTAAATGGTGAGAAGAAGGGGGG + Intronic
1054925331 9:70583173-70583195 CAGAAGGGGCAACAGAAGGGAGG + Intronic
1055196463 9:73600117-73600139 GAGAATGGCGAGAACATGGGAGG + Intergenic
1055667715 9:78569195-78569217 GAGAAAGAGGAGAACAAGGGTGG + Intergenic
1055703453 9:78971815-78971837 GAGAATGGAGAAAAGAAGGAGGG + Intergenic
1055787574 9:79886575-79886597 GTGAAAGGAGAGCAGAAGAGGGG - Intergenic
1055828714 9:80356922-80356944 GTGAATGGGGACCATAAGTGTGG + Intergenic
1055959488 9:81806862-81806884 GAGAATAGGAAACAGAAGTGGGG + Intergenic
1055978740 9:81979241-81979263 GAGAATGTGGGACAGAATGGTGG + Intergenic
1056524807 9:87433118-87433140 GAGGAGGGGGAGGAGAGGGGAGG + Intergenic
1056579911 9:87883179-87883201 GAGGAAGAGGAGCAGCAGGGAGG + Exonic
1056663713 9:88563675-88563697 GAAATAGGGGAGCAGCAGGGTGG - Intronic
1057387137 9:94614186-94614208 GAGCAGGGGGAGGAGGAGGGAGG + Intronic
1057496762 9:95567418-95567440 GAGAAGGGGGACCAGGAGGTGGG - Intergenic
1057745634 9:97748732-97748754 GACAAAGTGGAGCAGAAGGCAGG + Intergenic
1058668346 9:107340515-107340537 AGGAATGGAGAGCAGAATGGCGG - Intergenic
1059063748 9:111060521-111060543 GAAAGAGGGGAGAAGAAGGGAGG + Intergenic
1059742242 9:117163207-117163229 CAGTTAGGGGAGCAGAAGGGAGG + Intronic
1059788451 9:117612965-117612987 GAGAAAGAGGAGGAGAAGGGAGG + Intergenic
1059803496 9:117774028-117774050 GAGAAGGGAGGGGAGAAGGGAGG - Intergenic
1059888922 9:118779222-118779244 GAGAAGGGAGAGGAGAAGGCTGG + Intergenic
1060268790 9:122127222-122127244 GAGGCTGGGGAGGAGAAGGGGGG - Intergenic
1060819337 9:126652280-126652302 GAGTCTGAGGAGGAGAAGGGGGG + Intronic
1060857523 9:126926791-126926813 GTGGATGGGGAGGAGAAGGCAGG + Intronic
1060946928 9:127575134-127575156 GAGAATGGGGAGGGGAAGTGGGG - Intronic
1061079159 9:128360023-128360045 CAGAGTGGGGACCAGAACGGAGG - Intronic
1061191958 9:129087403-129087425 GAGAATGGTGTGAACAAGGGAGG - Intronic
1061237528 9:129351476-129351498 GAGAAGGGGGAGGAAAAGGAAGG + Intergenic
1061257330 9:129460389-129460411 GAGAGGGGGGAGGAGGAGGGAGG - Intergenic
1061373080 9:130208828-130208850 GAGACTGAGGCTCAGAAGGGTGG + Intronic
1061516517 9:131093377-131093399 GAGGATGGTGAGGAGCAGGGAGG + Intronic
1061625892 9:131840486-131840508 GTAAATGGGGAGGAAAAGGGTGG - Intergenic
1061726512 9:132584857-132584879 GAGAAGGGGGAGGAGGAAGGAGG + Intronic
1061731375 9:132617061-132617083 ATGAAGGGGGAGCAGAAGTGTGG - Intronic
1061832334 9:133303973-133303995 GAGAAGGAAGAGCAGAGGGGAGG - Intergenic
1061934963 9:133852385-133852407 AAGAAGGCAGAGCAGAAGGGTGG + Intronic
1061954641 9:133955420-133955442 GAGAGTGGGGAGAAGCAGGGGGG - Intronic
1062686369 9:137815510-137815532 TAGAAAGGGGAGCAGAGGGCTGG + Intronic
1185603570 X:1354901-1354923 GAGAAGGTGGGGTAGAAGGGTGG + Intronic
1185640965 X:1588801-1588823 GCGAAGGGGGAGGAGAGGGGAGG - Intergenic
1185661476 X:1732286-1732308 GAGAATGGCGAGAACACGGGAGG - Intergenic
1185700465 X:2227553-2227575 GAGAAAGGAGGGAAGAAGGGAGG + Intronic
1185932363 X:4217169-4217191 GAGAATGGCGTGAAGACGGGAGG + Intergenic
1187281584 X:17861382-17861404 GAGGAGGGGGAGCAGGAGGGGGG + Intergenic
1187547417 X:20267153-20267175 GAGGTTGGGGCGCAGAAGGAGGG - Intergenic
1188249164 X:27870877-27870899 GAGAATGGGGAGATGTAGGTTGG - Intergenic
1188514806 X:30973815-30973837 GAGAATGGGGGGCGGACAGGAGG - Intronic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189255210 X:39632775-39632797 GAGAATGGGGAGGATAAGCAAGG + Intergenic
1189388148 X:40554372-40554394 GAATTGGGGGAGCAGAAGGGAGG + Intergenic
1190055799 X:47180335-47180357 GAGGGTGGGGAGGGGAAGGGTGG - Intronic
1190289831 X:48984930-48984952 GAGAATGGCGAGAACACGGGAGG + Intronic
1190744267 X:53312164-53312186 GGGAATTGGGGGCAAAAGGGAGG - Intronic
1190916717 X:54816625-54816647 GAGGATGTTGAGCAGTAGGGAGG + Intergenic
1191061688 X:56304587-56304609 GAGAATGGCGAGAACATGGGAGG + Intergenic
1191680691 X:63837051-63837073 GAGAATTGGGAGCAGGAATGAGG - Intergenic
1191937726 X:66443033-66443055 GGGAATGGGGAGAAGAGGGGAGG - Intergenic
1192623749 X:72706569-72706591 TAGAATGGGAAGCAGAGGGAGGG + Intronic
1192776035 X:74245803-74245825 GAGAATGGGGTGCACCCGGGAGG + Intergenic
1192991387 X:76461603-76461625 GAGATCAGGGAGTAGAAGGGTGG - Intergenic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193512598 X:82423001-82423023 GAGAATGGAGAGTGGAAGGGAGG + Intergenic
1194102280 X:89720393-89720415 CAGAATGGGGAGGGGATGGGAGG - Intergenic
1194167497 X:90537288-90537310 GAGAAAGGGGAGGAGAAAGAGGG + Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1194512791 X:94816163-94816185 GAGAAGGAAAAGCAGAAGGGCGG - Intergenic
1194639874 X:96391167-96391189 GAGAGTGGGCAGAAGAAGAGTGG + Intergenic
1195328432 X:103776756-103776778 GGAAAAGGGGAGGAGAAGGGAGG + Intronic
1195939527 X:110156542-110156564 GAGAAGAGGGCGCAGAAGGAAGG + Intronic
1196237557 X:113300006-113300028 GAGAAGGGAGGGGAGAAGGGAGG - Intergenic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1197651879 X:129073994-129074016 GAGATTGGGAAGAAGAGGGGAGG + Intergenic
1197672676 X:129295842-129295864 GAGGATGTGGGGCAGAAGTGGGG + Intergenic
1197749070 X:129952677-129952699 GAGAAAGGAGAGCGGGAGGGAGG - Intergenic
1198314079 X:135449604-135449626 GAGAAGGGGTGGAAGAAGGGTGG - Intergenic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1199526987 X:148803833-148803855 GAGAGTGGGAATGAGAAGGGTGG - Intronic
1200454870 Y:3377670-3377692 CAGAATGGGGAGGGGATGGGAGG - Intergenic
1201110547 Y:10796201-10796223 CAGAATGGGGAGCAGTGGAGTGG - Intergenic
1201739704 Y:17310942-17310964 GAGAAGGAGGAGGAGAAGGGGGG - Intergenic
1201864690 Y:18637375-18637397 GCAAATGGGGAACAGCAGGGAGG - Intergenic
1201868632 Y:18683003-18683025 GCAAATGGGGAACAGCAGGGAGG + Intergenic
1202342465 Y:23884186-23884208 GAGAATGGTGTGAAGATGGGAGG + Intergenic
1202528304 Y:25785899-25785921 GAGAATGGTGTGAAGATGGGAGG - Intergenic