ID: 960642627

View in Genome Browser
Species Human (GRCh38)
Location 3:119842261-119842283
Sequence GCCTGAAGCCAGCTAATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960642627_960642634 22 Left 960642627 3:119842261-119842283 CCCACCATTAGCTGGCTTCAGGC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 960642634 3:119842306-119842328 ACCCGTGAATAATTTTTTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960642627 Original CRISPR GCCTGAAGCCAGCTAATGGT GGG (reversed) Intronic
900486260 1:2924214-2924236 GCCCGAAGCCAGCTGGTGGGAGG - Intergenic
901064458 1:6488368-6488390 GCCTGAAGACAGCTGAATGTTGG + Intronic
901645527 1:10715021-10715043 CCCTAAAGTCAGCTAATGGAAGG - Intronic
902704246 1:18193448-18193470 GCCTGCAGACAGCCAATTGTGGG - Intronic
903282111 1:22255896-22255918 TCCTCAACCCAGCTAAGGGTAGG - Intergenic
905301758 1:36990451-36990473 GCCTGAAGCCAGCTCCTCCTGGG - Intronic
905571582 1:39010513-39010535 ACCTAAGGCTAGCTAATGGTGGG - Intergenic
905800442 1:40839112-40839134 GCCTGAGACCAGCTACTGCTGGG - Exonic
912438553 1:109680123-109680145 TCCTGCAGCCAGCTGATTGTGGG + Intronic
912441073 1:109698578-109698600 TCCTGCAGCCAGCTGATCGTGGG + Intronic
912615957 1:111100351-111100373 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
917179502 1:172279995-172280017 GCCAGAAGCCAGACAATGGAGGG - Intronic
918750610 1:188264916-188264938 TCCTGAAGGCAGCAAATGGTTGG + Intergenic
920242306 1:204562220-204562242 GGCTGAAGCCAGCTCCTGGTGGG + Intergenic
922673191 1:227530595-227530617 TCCTGAAGGCAGCAAATAGTTGG + Intergenic
923813251 1:237344190-237344212 GGGTGAATCCAGCTAATGATCGG + Intronic
1067100034 10:43328102-43328124 GCCTGAAGTCGGCTCATGGTGGG - Intergenic
1068035462 10:51754516-51754538 GCTTGAAGCAAGCTCATAGTTGG + Intronic
1068266692 10:54658869-54658891 CCTTGAAGGCAGCAAATGGTAGG - Intronic
1069831316 10:71284036-71284058 ATCTGAGTCCAGCTAATGGTGGG + Intronic
1070782547 10:79146109-79146131 GCCTGAGGCCAGGGAAGGGTGGG + Intronic
1071163379 10:82778099-82778121 GCCTGAAGCAATCTAATGCTTGG - Intronic
1071289239 10:84176650-84176672 GCCTGATGCCAGCCATGGGTGGG - Intronic
1072522302 10:96239220-96239242 GCCTAAAGCCAGGGAATGTTAGG + Intronic
1074365660 10:112855573-112855595 TCCTGAAGCCTGCTTTTGGTGGG + Intergenic
1078415491 11:11161356-11161378 GCCTGTAGCCAATTGATGGTAGG + Intergenic
1080820951 11:35805955-35805977 GCCTTAAGCCATCTACTGTTAGG - Intronic
1082140319 11:48601593-48601615 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1082567485 11:54698561-54698583 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1082614290 11:55339634-55339656 ACATGAAGTCAGCTAATGCTAGG - Intergenic
1082620472 11:55415408-55415430 ACATGAAGTCAGCTAATGCTAGG - Intergenic
1085748055 11:79131770-79131792 GACTGAAGGCAGCAGATGGTTGG - Intronic
1086082654 11:82921279-82921301 TCCTGAAGGCAGCAGATGGTTGG + Intronic
1086094524 11:83037107-83037129 GCCTGGACCAAGATAATGGTAGG + Intronic
1086202435 11:84219786-84219808 ACCTGCAGCCAGCTTACGGTTGG + Intronic
1087156827 11:94913041-94913063 GCCTGAAGCTCGTTCATGGTGGG - Intergenic
1088239825 11:107761847-107761869 TCCTGAAGACAGCAGATGGTTGG - Intergenic
1089104025 11:115987219-115987241 GCCTGACGGCAGCAAATGCTTGG - Intergenic
1089553322 11:119298916-119298938 GCCTGGAGCCAGCCCATGTTGGG + Intronic
1089826064 11:121278997-121279019 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1090878678 11:130814259-130814281 GCATGCAGACAGCTTATGGTAGG + Intergenic
1092263368 12:6963807-6963829 GGCTGCAGCCAGCTAAGGGCTGG - Intergenic
1093389789 12:18604123-18604145 TCCTGAAGGCAGCAGATGGTTGG - Intronic
1095732939 12:45524691-45524713 TCCTGAAGACAGCAGATGGTTGG - Intergenic
1095932256 12:47638901-47638923 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1096065705 12:48738360-48738382 GGCTGTAGCCATATAATGGTTGG + Intergenic
1096437878 12:51610295-51610317 TCCTGAAGGCAGCAGATGGTTGG + Intronic
1098960677 12:76737063-76737085 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1100290807 12:93213158-93213180 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1101377649 12:104184660-104184682 GCCTGAAGTCAGCCTGTGGTGGG - Intergenic
1101635076 12:106533688-106533710 TCCTGAAGGCAGCAGATGGTTGG + Intronic
1101994836 12:109517817-109517839 GCCAGAAGCCATCTGCTGGTGGG - Intronic
1102463580 12:113115106-113115128 GTCTGAAGCCAGCTAAGTGAGGG + Intronic
1102916533 12:116758230-116758252 ACCTGAAGGCAGCAGATGGTTGG + Intronic
1104302286 12:127575392-127575414 GCCTGGAGCCAGCAGAAGGTGGG - Intergenic
1104716310 12:131018530-131018552 GCCTGAAGTCAGTGAATGATGGG - Intronic
1107634451 13:42378309-42378331 GCCTGGAGCCAGATTATGGAGGG - Intergenic
1107755790 13:43621153-43621175 TCCTGAAGGCAGCAGATGGTTGG + Intronic
1113031832 13:106001678-106001700 ACTTAAAGTCAGCTAATGGTAGG + Intergenic
1114997703 14:28377248-28377270 ACCAGAGGCCAGCAAATGGTGGG + Intergenic
1115265215 14:31493408-31493430 TCCTGAAGGCAGCAGATGGTTGG - Intronic
1115299455 14:31867400-31867422 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1116665205 14:47765972-47765994 GCTTGAAGACAACCAATGGTGGG - Intergenic
1116950327 14:50872992-50873014 CACTGAAGCCAGGTATTGGTTGG + Intronic
1117768721 14:59109910-59109932 GCTTGAAGGCAGCTGATAGTTGG - Intergenic
1121099051 14:91237279-91237301 GCCTGAAGCCAGCCTGAGGTTGG + Intronic
1128128014 15:65207120-65207142 GCCTGAGGCCAGCTGGGGGTGGG - Intronic
1131356721 15:91751725-91751747 GCCTGAAGCCAGCTTGAGGTGGG - Intergenic
1132793871 16:1708740-1708762 CCCCGAAGCCAGCCAATGCTTGG + Intronic
1133146537 16:3791249-3791271 GCCTGAAGCCTACAAATGGCAGG + Intronic
1134210595 16:12273206-12273228 GCCAGAAGCCTGCTGCTGGTGGG + Intronic
1134275373 16:12771342-12771364 GCAAGAAGCCAGCACATGGTAGG - Intronic
1134507850 16:14822844-14822866 GCCTGGAACCAGGCAATGGTGGG - Intronic
1134976279 16:18573080-18573102 GCCTGGAACCAGGCAATGGTGGG + Intergenic
1139045845 16:63059042-63059064 GCTTGATGCCAGCTTATGGTTGG - Intergenic
1140843398 16:78863598-78863620 GCCTGAATACAGCTTATGGTTGG - Intronic
1142069170 16:88080904-88080926 GCCTGAAGTCACCTACTGCTTGG - Intronic
1144452637 17:15393851-15393873 GCATGAAGCCAGGAAATGGAAGG - Intergenic
1146600092 17:34206514-34206536 GCCTGAAGCCAAATGATGCTGGG - Intergenic
1149410705 17:56403562-56403584 TCCTGAAGGTAGCAAATGGTTGG + Intronic
1149480342 17:56998426-56998448 GCCTTAAGCCAGCTCATGAATGG + Exonic
1151048581 17:70949699-70949721 TCCTGAAGGCAGCAAATGGTTGG - Intergenic
1152284566 17:79404624-79404646 GCCAGAAGCTAGGTAATGGGAGG - Intronic
1156845662 18:41662916-41662938 GCCTGCAGCCAGACAAAGGTCGG - Intergenic
1157495354 18:48153353-48153375 GCCTGAGGTCAGCTAATAGAGGG + Intronic
1157781779 18:50445949-50445971 GCGTGAATCCATCTCATGGTGGG - Intergenic
1158756699 18:60333669-60333691 TCCTGAAGGCAGCTGATAGTTGG - Intergenic
1162057859 19:8075483-8075505 GCCTGAAGCCACACAGTGGTGGG - Intronic
1162463116 19:10824952-10824974 GCCTGAGGTCAGTTATTGGTGGG + Intronic
1162765076 19:12914324-12914346 GCCTGAAATTGGCTAATGGTGGG - Intronic
1166604057 19:44124924-44124946 ACCTGAAGGCAGCAGATGGTTGG + Intronic
1168072448 19:53960513-53960535 GTCTGAGGCCAGCTGATGGGGGG + Intergenic
1168395887 19:56048126-56048148 TCCTGAAGGCAGCAGATGGTTGG + Intronic
926200827 2:10795771-10795793 GCCTGAGTCCAGCTAATAGAAGG - Intronic
929599250 2:43194658-43194680 GCCTGAACCCAGCTACTCCTGGG + Intergenic
931710576 2:64986665-64986687 GGCTGAGGCCAGATCATGGTAGG + Intergenic
932100368 2:68894176-68894198 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
932436049 2:71703111-71703133 GGCTGAGGCCAGCTCAGGGTAGG - Intergenic
933319068 2:80749180-80749202 ACCAGAAGCCAGATAATGGTGGG - Intergenic
933574763 2:84055026-84055048 GCCTGAGGGCAGGTAATGGGTGG - Intergenic
933892352 2:86783544-86783566 GCCTAAAGCATGCTCATGGTGGG - Intergenic
936066929 2:109339553-109339575 GCCTGAATCCAGCTGATGCCTGG - Intronic
937069057 2:119048544-119048566 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
938561451 2:132475792-132475814 GCCTGAAGCCAGCAATTAGCTGG + Intronic
938598064 2:132809672-132809694 TCCTGAAGGCAGCAGATGGTTGG + Intronic
941859964 2:170269010-170269032 TCCTGAATCCAGCTCATTGTAGG + Intronic
942154536 2:173114294-173114316 TCCTGAAGACAGCAGATGGTTGG + Intronic
943731617 2:191308367-191308389 TCCTGAAGCCAGGTTATTGTTGG + Intronic
944420894 2:199528973-199528995 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
944461880 2:199957917-199957939 GCCTGATGCCTGCCCATGGTGGG - Intronic
945131878 2:206582451-206582473 TCCTGAAGGCAGCAGATGGTTGG + Intronic
946981673 2:225223914-225223936 GCCTCAAGCCAGAAAATGGCAGG - Intergenic
947456872 2:230263370-230263392 TCCTGAAGGCAGCAGATGGTTGG + Intronic
948715194 2:239856699-239856721 GCATGAAGCCAGGTAATGCTAGG + Intergenic
1174869218 20:54167988-54168010 GCCAGCAGCCAGCTCATGGAGGG - Intronic
1175069320 20:56318633-56318655 TCCTGAAGGCAGCTGATGGTTGG - Intergenic
1178059576 21:28836740-28836762 CCCTGAAGGCAGCAGATGGTTGG - Intergenic
1178211666 21:30541547-30541569 GCATGAAGCCAAAAAATGGTAGG + Exonic
1178959244 21:37049119-37049141 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1179255686 21:39713345-39713367 ACCTGAACCCAGGTCATGGTGGG + Intergenic
1181477211 22:23176129-23176151 GCCTGATGCCTGCTCATGGATGG + Intergenic
1183784610 22:40022134-40022156 GCCTCCAGGCAGCTAATGGCCGG - Intronic
949814456 3:8042892-8042914 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
951852102 3:27152742-27152764 TCCTGAAGACAGCAGATGGTTGG - Intronic
956781664 3:72607914-72607936 GCATGAAGCCAGCTATTGACAGG - Intergenic
960406162 3:117262418-117262440 GGCTGGAGCCAGGTCATGGTGGG - Intergenic
960642627 3:119842261-119842283 GCCTGAAGCCAGCTAATGGTGGG - Intronic
961407364 3:126690472-126690494 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
962065818 3:131979592-131979614 TCCTGAAGGCAGCAGATGGTTGG + Intronic
965007594 3:163045017-163045039 GCCTGAAACCAGCTAAGGAGAGG + Intergenic
966707907 3:182936732-182936754 GCCTGTATCCAGCTAAGCGTGGG + Intergenic
966987259 3:185192661-185192683 GCCAGAAGACAGGTAAGGGTTGG - Exonic
975319532 4:72994702-72994724 GCCTGAAGAGAGCTAAGGGTGGG - Intergenic
978642280 4:110884820-110884842 GCCTGCAGACAGCTTATTGTGGG - Intergenic
978999242 4:115197647-115197669 TCCTGAAGGCAGCACATGGTTGG + Intergenic
979206892 4:118048455-118048477 TCATGAAGACAGCAAATGGTTGG - Intronic
979381900 4:120016603-120016625 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
981626178 4:146758073-146758095 TCCTGAAGGCAGCAAATAGTTGG - Intronic
981825034 4:148930356-148930378 TCCTGAAGGCAGCAAATGGTTGG - Intergenic
982189568 4:152840656-152840678 TCCTGAAGGCAGCAGATGGTTGG + Intronic
984818022 4:183856595-183856617 GGCTGACTGCAGCTAATGGTAGG + Intronic
987581017 5:19792473-19792495 GCCTGCAGACAGCACATGGTAGG + Intronic
988132176 5:27120114-27120136 GCGGGAAGGCAGCTAATGCTTGG - Intronic
988169586 5:27636504-27636526 GCCTGCAGACAGCTTATTGTGGG - Intergenic
992520347 5:77544398-77544420 TCTTGAAGCCAGCAGATGGTTGG - Intronic
995472807 5:112521527-112521549 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
995955522 5:117771705-117771727 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
996325599 5:122269272-122269294 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1001529378 5:172451726-172451748 GCATGAAGGCAGCTATTGGCAGG - Intronic
1002132657 5:177091039-177091061 TCCTTAAGCCAGCGGATGGTGGG - Exonic
1003069099 6:2930348-2930370 GCCCGAAGCGAGCTATTGTTAGG - Intergenic
1003234428 6:4282994-4283016 ACCTGGAGCCAGCTTATGGCAGG - Intergenic
1003711785 6:8600971-8600993 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1004233692 6:13854860-13854882 GCCGGAAGGCAGCTAAGGTTTGG + Intergenic
1011168828 6:84481224-84481246 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1011893111 6:92192297-92192319 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1013305384 6:108842512-108842534 GCCTGCAGACAGCCTATGGTGGG + Intergenic
1015514955 6:134074226-134074248 ACCTGAAGCCACCTGTTGGTTGG - Intergenic
1017033912 6:150250146-150250168 ACCTGAAGACATCTTATGGTAGG - Exonic
1017053311 6:150414390-150414412 GCCTGCAGACAGCCTATGGTGGG + Intergenic
1017258085 6:152357226-152357248 GCCTGAAGTCACCTAGTGTTGGG + Intronic
1017372948 6:153735170-153735192 GCCTGGTGCCAGCAAAGGGTGGG + Intergenic
1018113485 6:160559742-160559764 TCCTGAAGGCAGCAGATGGTTGG + Intronic
1021847854 7:24779942-24779964 TTCTGAAGGCAGCTAATGGCAGG + Intergenic
1022464703 7:30645858-30645880 GCCTGCAGCCACTGAATGGTTGG + Intergenic
1023701462 7:42895341-42895363 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1024545698 7:50515661-50515683 TCCTGAAGGCAGCAGATGGTTGG - Intronic
1024917027 7:54513456-54513478 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1025017305 7:55449588-55449610 CCCTGAAGGCAGCTGAAGGTTGG + Intronic
1026681406 7:72469819-72469841 GCCTGAACCCAGTCAAGGGTAGG + Intergenic
1028467329 7:91167668-91167690 GCCTGAAGCCATCTATTATTTGG - Intronic
1028962038 7:96760044-96760066 TCCTGAAGGCAGCAAATGGTTGG + Intergenic
1031540324 7:122987641-122987663 CCCTGCAGCTAGCTAATGGTTGG - Intergenic
1031677402 7:124627619-124627641 GCGTGAAGCCAGATTATAGTAGG + Intergenic
1032289474 7:130575805-130575827 TCCTGAAGGCAGCAGATGGTTGG - Intronic
1033394076 7:140957099-140957121 GCCGGAAGGCAGCTAAGGCTCGG + Intergenic
1035205758 7:157292958-157292980 GCCTGCAGCCAGCAAAAGGTGGG - Intergenic
1039023665 8:33234570-33234592 GCCTGAAGCCATCTAACACTTGG + Intergenic
1041227970 8:55718954-55718976 TCCTGAAGGCAGCAGATGGTTGG - Intronic
1042720091 8:71818243-71818265 GCCAGAAGCCAGGGAATGCTTGG + Intergenic
1043413774 8:80028387-80028409 ACCTGAAGCCACCTAAGGGATGG - Intronic
1045122117 8:99049071-99049093 TCTTGAAGGCAGCTGATGGTTGG + Intronic
1045232313 8:100316919-100316941 GCGGGAAGGCAGCTAAGGGTCGG + Intronic
1045780017 8:105851601-105851623 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1047059908 8:121213757-121213779 GCCTGAACCCTGATCATGGTGGG - Intergenic
1047332368 8:123902696-123902718 TCCTGACGGCAGCAAATGGTTGG + Intronic
1049908838 9:245651-245673 ACATGAAGCCAGCCTATGGTAGG - Intronic
1051362881 9:16296671-16296693 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1051932907 9:22408124-22408146 TCCTGAAGACAGCACATGGTTGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059482807 9:114604961-114604983 GCCTGAAGGCAGAGCATGGTAGG - Intergenic
1061410531 9:130418864-130418886 GCCTGTAGCCATTCAATGGTGGG - Exonic
1186323240 X:8452636-8452658 GCAGGAAGGCAGCTAAGGGTCGG + Intergenic
1187219002 X:17306017-17306039 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1187773411 X:22728735-22728757 TCCTGAAGTCAGCAGATGGTTGG + Intergenic
1189413858 X:40796655-40796677 TCCTGAAGGCAGCAGATGGTTGG - Intergenic
1189962236 X:46334718-46334740 TCCTGAAGCCAGCAGATAGTTGG - Intergenic
1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG + Intergenic
1190895285 X:54612327-54612349 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1191779622 X:64851132-64851154 TCCTGAAGGCAGCAGATGGTTGG + Intergenic
1194654103 X:96550134-96550156 GCATGAAGCCATCTTATGGAAGG + Intergenic
1196171087 X:112589296-112589318 TCCTGAAGCCAGCAGATAGTTGG - Intergenic
1196219086 X:113090145-113090167 CCCTGAAGGCAGCAGATGGTTGG - Intergenic
1196737710 X:118994265-118994287 TCCTGAAGGCAGCAGATGGTTGG - Intronic
1197724591 X:129768144-129768166 TCCTGAAGCCTGATGATGGTGGG + Intronic
1197916996 X:131546499-131546521 GCCTGGAGCCTGCTAATGGGGGG + Intergenic
1198561581 X:137856217-137856239 GCCAGAAGCCAGATAAGGGAGGG - Intergenic
1199068763 X:143451596-143451618 GCTTGCAGACAGCTTATGGTAGG + Intergenic
1199152171 X:144499708-144499730 GCCAGAAACCAGCTCATGGTCGG + Intergenic
1199926517 X:152472102-152472124 ACCTGAAGGCAGCAGATGGTTGG - Intergenic
1201307829 Y:12565966-12565988 TCCTGAAGGCAGCAGATGGTTGG + Intergenic