ID: 960645214

View in Genome Browser
Species Human (GRCh38)
Location 3:119872936-119872958
Sequence AATTAAGCAGAGACAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960645214 Original CRISPR AATTAAGCAGAGACAGAGAT TGG (reversed) Intronic
901970630 1:12904986-12905008 AATTAAGTATAGATATAGATAGG - Intronic
902014535 1:13296784-13296806 AATTAAGTATAGATATAGATAGG + Intergenic
902076062 1:13786998-13787020 AATTAATTATAGACAGAGAGAGG + Intronic
902843365 1:19089814-19089836 AATTTCGCTGAGACACAGATTGG - Intronic
903242251 1:21991072-21991094 AATATAGCAGAGACTCAGATAGG + Intronic
903245761 1:22014260-22014282 AATATAGCAGAGACTCAGATAGG + Intergenic
903886564 1:26544256-26544278 TATCAAGTGGAGACAGAGATTGG - Intronic
904428510 1:30446972-30446994 GGTTAAGGAGACACAGAGATGGG + Intergenic
904951122 1:34239779-34239801 AATTCACCAGAGAGAAAGATGGG - Intergenic
905600249 1:39243881-39243903 AATTTTTCAGACACAGAGATCGG - Intronic
905879223 1:41452687-41452709 AATTAGGCAGCTTCAGAGATTGG - Intergenic
906548165 1:46637390-46637412 AATTAAAAAATGACAGAGATGGG + Intronic
907381664 1:54095741-54095763 AATTACTAAGAGACAGAGCTGGG - Intronic
907545464 1:55256063-55256085 AATGAAGCAAACACAGACATTGG - Intergenic
907548743 1:55286223-55286245 AATGAACTAGAGACAGAGCTGGG + Intergenic
908670658 1:66543949-66543971 AATTAGGCACAGTAAGAGATTGG + Intronic
908723844 1:67154514-67154536 AATTAAAAAAAGACAGAGAAGGG - Intronic
909113930 1:71510590-71510612 ACTTAAGCAGAGAAGGGGATGGG + Intronic
909423958 1:75499681-75499703 AAATAAGAAGAGAAAGAGATAGG - Intronic
909790000 1:79664424-79664446 GATTAAGGAAAAACAGAGATAGG - Intergenic
909821121 1:80062432-80062454 TATTAAGAAGAGACAGAGTTAGG + Intergenic
911330814 1:96523661-96523683 ACTGGAGCAGAGACAGAGGTGGG - Intergenic
911413993 1:97547480-97547502 ATTTAAACAGAGACAGACACTGG - Intronic
911769269 1:101718688-101718710 AATTAGGCAGATACAGAGAAAGG - Intergenic
911788600 1:101982389-101982411 AGGTAAACACAGACAGAGATAGG + Intronic
912741055 1:112197741-112197763 AATTAAGCAGAGAAAAAGGGAGG + Intergenic
912797820 1:112703539-112703561 AATGAAGCAAAGACAGGGGTAGG + Intronic
913365327 1:118031645-118031667 ACTGAAGCAGAAACAGAGTTTGG + Intronic
914200788 1:145483465-145483487 AGGTCAGCCGAGACAGAGATGGG - Intergenic
914479901 1:148056593-148056615 AGGTCAGCCGAGACAGAGATGGG - Intergenic
915659818 1:157394006-157394028 GAGTAGGTAGAGACAGAGATAGG - Intergenic
915873667 1:159588817-159588839 AATTAGGCAGACATACAGATAGG - Exonic
917000860 1:170357092-170357114 AGTTAAAAAGAGACAAAGATAGG - Intergenic
917378310 1:174375072-174375094 AAGGAAGTAGAGACAGACATTGG + Intronic
918392318 1:184079252-184079274 ATTTAAGCAAAATCAGAGATTGG + Intergenic
918556475 1:185806239-185806261 AACTAATAAGAGACAGAAATGGG + Intronic
918617100 1:186557498-186557520 AAGAAAGAAGAGACAGAGAGTGG - Intergenic
919055166 1:192561665-192561687 AATAGGGCAGAGAGAGAGATTGG - Intergenic
919237910 1:194870160-194870182 AAGAAAGGAGAGACAGAGATGGG + Intergenic
919907514 1:202088030-202088052 AAATAGGCAGGGACAGAGACAGG + Intergenic
920237967 1:204521908-204521930 AATAAAGCAGGGAAGGAGATAGG + Intronic
922509025 1:226147394-226147416 TAGTAAGCACAGAAAGAGATAGG - Intronic
922528714 1:226326559-226326581 AATAAAGCAGAGAGACAGCTAGG - Intergenic
923313866 1:232760450-232760472 AAATTAACAGAGCCAGAGATGGG - Intergenic
923374785 1:233350335-233350357 AACTAAGCAGCGCCAGGGATCGG - Intronic
1062842607 10:682622-682644 AATTACACAGAGACAAAGACTGG + Intronic
1063019704 10:2115403-2115425 AATAAAGAAAAGAGAGAGATAGG - Intergenic
1063939646 10:11114095-11114117 AAGTAAGCAGAGGGAGAAATAGG - Intronic
1064270335 10:13859630-13859652 AATGAAGAGGAGACAGAGATTGG - Intronic
1066334500 10:34462811-34462833 AATAAAGCAGAGCCAGACAGTGG + Intronic
1066349057 10:34619907-34619929 TATTATGCAGAAACAGAGAGAGG - Intronic
1067233062 10:44425523-44425545 AATGAATGAGAAACAGAGATAGG + Intergenic
1067556234 10:47275043-47275065 ATTTAAAGAGAGAGAGAGATTGG + Intergenic
1067854438 10:49780172-49780194 AAAGAAGGAGAGACAGAGAAAGG - Intergenic
1067854442 10:49780201-49780223 AAAGAAGGAGAGACAGAGAAAGG - Intergenic
1068275572 10:54791674-54791696 TATGAAGTAGAGAGAGAGATTGG - Intronic
1068795104 10:61070899-61070921 AAGGAAGGAGAGAGAGAGATAGG - Intergenic
1069114468 10:64488271-64488293 AATTAAGAAGAGACTAAGAGTGG - Intergenic
1069237815 10:66100056-66100078 CAATAAGCAGAGTCTGAGATTGG + Intronic
1069246051 10:66208196-66208218 AATTAAGTAGACAGAGAGAGAGG + Intronic
1069359431 10:67624765-67624787 GATTATGCAGAGAGAGAGACTGG - Intronic
1069826344 10:71257266-71257288 ATTTAAGAAGACACAGAGAGAGG - Intronic
1069835434 10:71305023-71305045 AATGAAGTAGAGACAGAGGAAGG - Intergenic
1070478334 10:76852368-76852390 AATTCTGGAGAGACAAAGATAGG + Intergenic
1070803244 10:79255630-79255652 CAGAATGCAGAGACAGAGATAGG - Intronic
1071247446 10:83780345-83780367 ACTTAAGGAGACACAGATATTGG - Intergenic
1071406331 10:85336816-85336838 AATTGAACAAAGACAGAAATTGG - Intergenic
1071800274 10:89052434-89052456 AATTAAAGAGAGAAAGAGAGAGG - Intergenic
1072821652 10:98564168-98564190 ATTTAAGCAAAGGCAGAGAGTGG - Intronic
1072896921 10:99375342-99375364 ATTTGAGTGGAGACAGAGATAGG + Intronic
1074560861 10:114534170-114534192 AGGTAAGCAGAGCCAGGGATGGG + Intronic
1075378210 10:121996780-121996802 ATCTAAGCAGAGACATTGATGGG + Intronic
1077373925 11:2196412-2196434 AATTAGAGAGAGACAGAGATGGG - Intergenic
1078231002 11:9442843-9442865 ATTTTAGTAGAGACAGAGTTTGG - Intronic
1078931301 11:15913825-15913847 AGTTAGGCAGAGGCAGAGGTGGG + Intergenic
1079121589 11:17688918-17688940 AATAATGTAGTGACAGAGATCGG + Intergenic
1079826481 11:25201518-25201540 AAATCAGCAGAGACAGGGCTAGG + Intergenic
1079944593 11:26725991-26726013 AATACAGCAGAAACAGAAATTGG + Intergenic
1080569893 11:33546324-33546346 AATGGAGCAGGGACAGAGAGTGG - Intronic
1080953283 11:37062517-37062539 ACTAAGGCAGAGAGAGAGATGGG + Intergenic
1081452513 11:43185573-43185595 AATAAAGTAGAGACAAAAATGGG + Intergenic
1081860520 11:46331058-46331080 TACTAGACAGAGACAGAGATGGG + Intergenic
1082067378 11:47911635-47911657 AAAGAAGCAGAGACAGAGGCAGG + Intergenic
1083099394 11:60287337-60287359 TACAAAGCAGAGAGAGAGATGGG + Intronic
1083895370 11:65617167-65617189 AAAGAAGCAGTGACAAAGATGGG + Intronic
1083997978 11:66281610-66281632 AATTCAGCAGAGCCAGACATGGG - Intronic
1084607422 11:70180634-70180656 AATAAACAAGAGACAGAGATAGG + Intronic
1084961535 11:72719395-72719417 AATTAACTAGAGACAGGGCTTGG + Intronic
1086081530 11:82907978-82908000 AAGTAAGCAAAGACATACATAGG + Intronic
1086581703 11:88407644-88407666 ACTTTGGCAGAGAAAGAGATGGG - Intergenic
1086897501 11:92330309-92330331 AATAAAGCAGAGAGGGGGATAGG - Intergenic
1087276954 11:96170329-96170351 AATTAATCAGACACAGATAATGG + Intronic
1088009946 11:104987558-104987580 GATGAAGTAGAGAAAGAGATAGG + Intergenic
1088303949 11:108388220-108388242 GATAAAGCAGGGACAGTGATGGG - Intronic
1088630520 11:111769923-111769945 GATGAGTCAGAGACAGAGATGGG - Intergenic
1089293577 11:117454113-117454135 AAAGAAGAAGAGACAGAGAATGG - Intronic
1090512044 11:127385731-127385753 AATTAATGAGAGACAAATATTGG - Intergenic
1090684068 11:129096189-129096211 AATAAAGCAGACACAGAATTGGG + Intronic
1090996922 11:131875035-131875057 ACTTAAGCTGAGACAGAACTGGG + Intronic
1091125893 11:133096779-133096801 AAGTCATCAGAGATAGAGATGGG + Intronic
1091130354 11:133141514-133141536 AATGAAGGAGAGAGAGAGACAGG - Intronic
1091260387 11:134229471-134229493 GCTGAAGCAGAGACAGAGAGAGG - Intronic
1091821959 12:3482034-3482056 AAGTTAGCTGAGACAAAGATTGG - Intronic
1092161923 12:6319876-6319898 AATGAAGCTGGGACAGAGAAGGG + Intronic
1092222291 12:6722902-6722924 AAATAAGCAGAAACACAGAAAGG - Intergenic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1093025498 12:14241630-14241652 AATTAAAAAAAAACAGAGATAGG - Intergenic
1093093753 12:14949602-14949624 AATTAAATAGAGATAAAGATTGG + Intronic
1094328322 12:29264654-29264676 AATAAAGGAGAGAGAGAGAGAGG + Intronic
1094463222 12:30721113-30721135 AATTAAGCAGTGGCAAAGAAAGG + Intronic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1095840041 12:46682982-46683004 AAGTAGGCAGAGCCAGAGGTTGG - Intergenic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1096368354 12:51047710-51047732 ATTTAAGTTGAGACAGAGCTTGG + Intergenic
1097560409 12:61198183-61198205 CATGAAACAGAGGCAGAGATTGG + Intergenic
1097951061 12:65428734-65428756 AATTGAACATAGACAGAGAAAGG - Intronic
1098023990 12:66183703-66183725 AACAAAGGAGAGACACAGATAGG + Intergenic
1098457848 12:70695732-70695754 AATTTAACAGAGAGAGAGAGAGG + Intronic
1099101575 12:78447920-78447942 CATTAAGCAGAGATTGAGAGAGG + Intergenic
1101427586 12:104600584-104600606 AAAGAAGCAGAGACACAGAGAGG + Intronic
1101953475 12:109194164-109194186 AAAAAAACAGAGACAGAGACTGG - Intronic
1102704157 12:114866805-114866827 AACTAATCAAATACAGAGATGGG - Intergenic
1102956875 12:117064675-117064697 AATTCAGCAGAGAAAGGGAGGGG + Intronic
1103551278 12:121739215-121739237 AATTCACGAAAGACAGAGATTGG + Intronic
1104574802 12:129957337-129957359 AATGAATCAGAGAAAGAGACAGG + Intergenic
1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG + Intergenic
1105811039 13:23995695-23995717 AATTAGGCAGAGAAATAGAGGGG + Intronic
1106349813 13:28919664-28919686 GAGAAAGTAGAGACAGAGATAGG - Intronic
1106877733 13:34093008-34093030 AATTCAGCACAGAAAGAAATGGG + Intergenic
1107065569 13:36211330-36211352 ATTTAAGCAGAGACATAAAGTGG - Intronic
1107244065 13:38271380-38271402 AATTGAGCTGAGTCAGGGATAGG - Intergenic
1107560420 13:41552676-41552698 AATTAAGGTGAAACAGAGAGGGG - Intergenic
1107700814 13:43045807-43045829 AATTAAGCAGATAAAGAAGTAGG - Intronic
1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG + Intergenic
1108799112 13:54070957-54070979 ACCTCAGCAGAAACAGAGATAGG + Intergenic
1108843282 13:54648357-54648379 CAAGAAGCAGAGACTGAGATGGG + Intergenic
1109147679 13:58801753-58801775 AATAAAGGAGAGAAAGAGATAGG + Intergenic
1109296784 13:60542699-60542721 TATTAAGTAGAGACATACATAGG - Intronic
1109545422 13:63836950-63836972 AGTTAAGAAGACACGGAGATTGG + Intergenic
1110133190 13:72032558-72032580 AAGTCAGCAGAGAGAGAGAGAGG + Intergenic
1110299741 13:73912509-73912531 GGAGAAGCAGAGACAGAGATTGG + Intronic
1110429187 13:75403731-75403753 TAGTAAGCACAAACAGAGATGGG - Intronic
1110747162 13:79067736-79067758 AGGTAAACAGAGACAGAGAGAGG + Intergenic
1110867653 13:80414857-80414879 AAATTACCAGAGACAGAGAAAGG - Intergenic
1111579856 13:90208511-90208533 AATTAATAAGAGACAGACCTTGG - Intergenic
1111755161 13:92384069-92384091 AATTAAACATATACAAAGATTGG + Intronic
1112845480 13:103637504-103637526 AATTAAGCTAATATAGAGATAGG - Intergenic
1114573548 14:23692992-23693014 CATTAAACAAAGACAGAGACAGG - Intergenic
1114894173 14:26965137-26965159 AATTGAGGATATACAGAGATAGG + Intergenic
1115093362 14:29605335-29605357 ACTTAAGCAGAGAGAGAAAAAGG - Intronic
1115159237 14:30374457-30374479 GAGTTAGCAGAGACAGGGATGGG + Intergenic
1115824629 14:37254558-37254580 GAATAGGCAGAGACAGAGGTTGG - Intronic
1116359293 14:43972783-43972805 AATAAAACAGAGTGAGAGATAGG + Intergenic
1117277843 14:54207566-54207588 AATACAGCAGAGACAGATACAGG + Intergenic
1117708046 14:58493811-58493833 CATTAAGCTGAGAGAGAGAAAGG + Intronic
1118765653 14:68907848-68907870 ACCCAAGCAGGGACAGAGATAGG + Intronic
1119626133 14:76177779-76177801 AATTAAGTAAAGACAAAGAAGGG - Intronic
1121222102 14:92293657-92293679 CATTGAGCTGAGACATAGATTGG - Intergenic
1123029705 14:105445877-105445899 AATTAAAAAGAGAGAGACATTGG - Intronic
1123057911 14:105580719-105580741 TAAGAAACAGAGACAGAGATGGG - Intergenic
1123707142 15:22958892-22958914 AATTAATAAAAGGCAGAGATGGG + Intronic
1126185408 15:45826467-45826489 ACATAATCAAAGACAGAGATTGG + Intergenic
1126650089 15:50911346-50911368 AAGAAAGCAGAAACAGAAATAGG - Intronic
1126825908 15:52547692-52547714 AATTGAGAGGAGACAGATATTGG + Exonic
1127240924 15:57113382-57113404 AATTCAGCAGAAAAAGAGAGAGG - Intronic
1127352456 15:58166991-58167013 ATTTAACAAGAGACAGAAATGGG + Intronic
1127461185 15:59200640-59200662 AATTAAGCAGAGACCAACAACGG + Intronic
1127651333 15:61011065-61011087 ATTTAAGCAAAGGCAGAGGTAGG + Intronic
1127673432 15:61217428-61217450 CAATGAGCAGAGAGAGAGATGGG + Intronic
1127691043 15:61398208-61398230 AAATAAACAGAGAAAGAGAAAGG + Intergenic
1128564689 15:68693133-68693155 AATGAGGCAGAGAAAGAGAGGGG - Intronic
1129793683 15:78360337-78360359 AATGAAACAGAGAAAGAGAAGGG + Intergenic
1129969898 15:79769121-79769143 AACTAATCAGAGACAGAGCCAGG + Intergenic
1130300762 15:82678610-82678632 AATTATGCAGGGACAGAAATGGG - Intronic
1131609759 15:93948308-93948330 AGTTAAACAGAGTCAGAGATTGG + Intergenic
1131889911 15:96961755-96961777 AATTAAGATGAGACATGGATAGG - Intergenic
1132194562 15:99902841-99902863 GATGAAGCAGAGAGAGAGAGAGG + Intergenic
1132684897 16:1158222-1158244 AAGGAAGCAGAGACACAGATGGG + Intronic
1133690378 16:8208712-8208734 AAATACGGAGAGAAAGAGATTGG + Intergenic
1134389447 16:13805800-13805822 AATAAAGCAGAGAAAGAAATAGG - Intergenic
1134791347 16:16991950-16991972 AATTAACAAGAGACAGAGCCAGG + Intergenic
1134904981 16:17972370-17972392 AAGTGAGCAGAGGCAGAGATGGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135406111 16:22199196-22199218 AAATGATCAGAGACAGAGTTAGG - Intergenic
1136056364 16:27692750-27692772 CACAAAGCAGAGACAGACATGGG - Intronic
1136396835 16:29997065-29997087 GATACAGCAGAGGCAGAGATAGG + Intronic
1136942834 16:34606009-34606031 AATCAAGCAGAAACATAGAATGG - Intergenic
1136942921 16:34607117-34607139 AATTAAGCAGAAACATAGAATGG - Intergenic
1138313470 16:56048104-56048126 AAATAAAGAGAGACAGAGAGGGG - Intergenic
1138730422 16:59187992-59188014 AATTAAGCAGAGACGATGATAGG + Intergenic
1138737301 16:59265351-59265373 ATTCAAGCAGAGACAGTGATTGG - Intergenic
1139148200 16:64347776-64347798 ATTTAAGCAGTGACATAGACTGG + Intergenic
1140195890 16:72855060-72855082 AATTAAACAGAGAGAGGGCTGGG + Intronic
1141738562 16:85873230-85873252 ACTTAAACAGAAACAGAAATGGG + Intergenic
1143741289 17:8955791-8955813 GTTTCAGCAGAGACAGAAATGGG + Intronic
1143982210 17:10879849-10879871 AGTTAAGCAGACACTGAGCTGGG - Intergenic
1144169547 17:12646745-12646767 AATTAGCCAGAGAAAGTGATAGG + Intergenic
1144415130 17:15039195-15039217 AAGGAAGGAGAGAAAGAGATGGG + Intergenic
1144564348 17:16347695-16347717 AATGATGCAGAGACAGTGATGGG + Intronic
1146171089 17:30633936-30633958 AATTAAAAAGAGAGAGAGAATGG - Intergenic
1147356798 17:39904810-39904832 AGTTAGGAAGAGACAGAGGTAGG + Exonic
1148249896 17:46067946-46067968 AATTAAAAAGAGAGAGAGAGAGG + Intronic
1148635572 17:49146609-49146631 AATTAAGAAAAGACAGTGTTGGG - Intronic
1148681015 17:49473512-49473534 AATTAACCAGAGCCAGGCATGGG - Intronic
1148891827 17:50813208-50813230 AATAAAATAGAGACAGATATGGG + Intergenic
1148997576 17:51724508-51724530 TATTAAGCAAAGACAGAGTGAGG - Intronic
1150366067 17:64586451-64586473 AATTAAGAAGAGGCATAGCTGGG + Intronic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1151738258 17:75960220-75960242 ACTTATGCCCAGACAGAGATGGG - Exonic
1151838963 17:76603727-76603749 AAAAAAAGAGAGACAGAGATGGG + Intergenic
1153121673 18:1735305-1735327 AATGAAACAGAAACAGAGAGAGG - Intergenic
1153604703 18:6820362-6820384 ACTGAAGCAGAGAGAGAGTTGGG + Intronic
1153635883 18:7113186-7113208 ACTTCAGCAGAGAGAGAGCTGGG + Intronic
1155049708 18:22135921-22135943 AATGCAGCAGAGATAGAGATGGG + Intergenic
1155708110 18:28841382-28841404 AAGTAATCAGTGGCAGAGATAGG - Intergenic
1155789299 18:29945263-29945285 AATAAAGCAGGAACAGAGAAAGG - Intergenic
1157082484 18:44541029-44541051 AATTAAGAAAATACAGAGAAGGG - Intergenic
1158335204 18:56408749-56408771 AATCAACTAGAAACAGAGATTGG + Intergenic
1158578924 18:58664410-58664432 CTTTACGCAGAGACAGGGATGGG + Intergenic
1159373824 18:67565410-67565432 AATTAACCAGAGAAAGAGGAAGG + Intergenic
1161664456 19:5566746-5566768 AAAACAGCAGAGACAGAAATGGG + Intergenic
1162108610 19:8387259-8387281 AAATCAGGAGAGAGAGAGATGGG + Intronic
1162230953 19:9265885-9265907 AACTAAGAAGACACAGAGATGGG + Intergenic
1162851833 19:13437039-13437061 AATTAAGCAGATACAGAGGAGGG + Intronic
1163067475 19:14809516-14809538 AAGCAAGAAGAAACAGAGATTGG + Intronic
1163067476 19:14809585-14809607 AAGCAAGAAGAAACAGAGATTGG + Intronic
1163067477 19:14809608-14809630 AAGCAAGAAGAAACAGAGATTGG + Intronic
1165545858 19:36535346-36535368 CATTTAGGAGAAACAGAGATAGG - Intronic
1165702494 19:37949174-37949196 GATAAAGAAGAGACAGAGATGGG - Intronic
1166295399 19:41886984-41887006 ACTCAAGGAGAGACAAAGATGGG + Intronic
1166311967 19:41967895-41967917 ACATAGGGAGAGACAGAGATGGG + Intronic
1167409121 19:49334657-49334679 AATTAAAAAAAAACAGAGATAGG - Intergenic
1167797166 19:51716947-51716969 AGGTAAGCAGGGGCAGAGATTGG - Exonic
925102631 2:1261860-1261882 AGCCAAGCAGAGACAGGGATGGG + Intronic
925201790 2:1973136-1973158 AATTCACCAGAGAGAGAGAGAGG - Intronic
926005607 2:9371457-9371479 ATTTAAGCAGGCACAGAGCTGGG - Intronic
926996802 2:18744329-18744351 AACCAACCAGAGAAAGAGATGGG - Intergenic
928085281 2:28342315-28342337 GATTAAGTAAAGACAGACATTGG - Intergenic
928191941 2:29178752-29178774 ATATATGCAGAGAAAGAGATAGG - Intronic
928857782 2:35820304-35820326 ATTTAAGAAAAGAAAGAGATTGG - Intergenic
928886768 2:36158155-36158177 AATTAAAGTGAGACAGTGATTGG - Intergenic
929297940 2:40269875-40269897 AAGTAAGCAGAGATATAGAAAGG + Intronic
929737673 2:44567632-44567654 TATTAGACAGAGACAGACATGGG + Intronic
930753596 2:54954536-54954558 AATAAAGCAGACAAAGTGATAGG - Intronic
931893517 2:66702622-66702644 AGATAAGCAGGGGCAGAGATAGG + Intergenic
932037778 2:68264692-68264714 AATCAAGGAGTGATAGAGATGGG + Intergenic
932057391 2:68460298-68460320 AATGAGGCAGAGATAAAGATGGG + Exonic
933600216 2:84321416-84321438 AATAAGTCAGAGATAGAGATGGG + Intergenic
933804252 2:85986844-85986866 TATTTAGTAGAGACAGAGACCGG - Intergenic
934668536 2:96191578-96191600 ATTCAAGCAAAGACAAAGATAGG - Intronic
935058583 2:99589112-99589134 AAATATGCAGAGATAGACATTGG - Intronic
936632769 2:114221792-114221814 AATTAAGAAGTGACACAGAATGG - Intergenic
937649651 2:124305937-124305959 AACTGAGCAGAGACATATATAGG - Intronic
938777615 2:134555705-134555727 AAGCCAGCAGAGAAAGAGATAGG - Intronic
939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG + Intronic
939884620 2:147667736-147667758 AATTAAGCATTCACAGACATTGG + Intergenic
940027928 2:149228330-149228352 AAACAAAGAGAGACAGAGATGGG - Intergenic
940769474 2:157825052-157825074 AATAAAGAAGAGAGAGAGAAAGG - Intronic
940941814 2:159570647-159570669 AATAAGACAGAGACAGAGAAAGG - Intronic
941141877 2:161793605-161793627 CATTAAGAAGAGAGAGAGAAGGG - Intronic
941190298 2:162373343-162373365 ATTTGAGTAGAAACAGAGATAGG + Intronic
941441953 2:165549426-165549448 AATTAGGCAGATATAGAGCTTGG + Intronic
941996936 2:171610041-171610063 AATGAAGCAGGTACAGAGAAGGG - Intergenic
942631098 2:177950394-177950416 ACTAAAGCATAGACAGAGATGGG - Intronic
942802703 2:179893740-179893762 ATTTATGCAGAGAAAGAGAAAGG - Intergenic
942803191 2:179899421-179899443 AATAAAGCAGAGGCAATGATGGG - Intergenic
942950266 2:181713374-181713396 AATAAAGCAGGGAGAGGGATAGG + Intergenic
943219549 2:185087948-185087970 AAATATGCAGAAACAGAGAGAGG + Intergenic
943438428 2:187896310-187896332 GAATAAGCAGAGATAGAGAGGGG + Intergenic
943698416 2:190961962-190961984 ATGTAAGTAGAGAGAGAGATTGG + Intronic
944505828 2:200409580-200409602 ATTAAAGCAGAAACAGAGGTTGG + Intronic
944961536 2:204880239-204880261 AATTAGTCAAAGACAGAGATAGG - Intronic
945158221 2:206861420-206861442 AATTAAATAGAGACAAACATGGG - Intergenic
946074778 2:217064708-217064730 AATGAAGCAGAGAAAGACAAGGG - Intergenic
946811114 2:223526801-223526823 AAAAAAGGAGAGAGAGAGATTGG + Intergenic
946984966 2:225261201-225261223 AACTAAAAAGAGAGAGAGATGGG + Intergenic
947094621 2:226551714-226551736 AATTAAGCATAGCCAGAGGGAGG + Intergenic
947759600 2:232594082-232594104 AACTAAGCAGAAACAGAGCCGGG - Intergenic
948394469 2:237633945-237633967 AGTAAGGCAGAGACAGATATGGG - Intronic
948723326 2:239917202-239917224 AATTAAAAAGAGAAAGAAATAGG + Intronic
1169174291 20:3495917-3495939 GATTAAGGAGAGAGAGAGAATGG + Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169784891 20:9349112-9349134 AATTAAGAAAAGACACAGAAGGG - Intronic
1170191681 20:13651043-13651065 AGAGAAGCAGAGCCAGAGATGGG + Intergenic
1170834902 20:19875795-19875817 AATGAAGCAGAGACAGACAGTGG + Intergenic
1171106869 20:22441997-22442019 AAAAAAGCAGAGACAAAGAGGGG + Intergenic
1173423462 20:42923234-42923256 AAATAAGCAAAGCCACAGATTGG + Intronic
1173761059 20:45561010-45561032 GTTTAGGCAGAGACAGAGTTCGG + Intronic
1173970814 20:47150787-47150809 AAGGAGGCAGAGACAGAGAAGGG + Intronic
1174530513 20:51209125-51209147 AAGGAAGCTGAGACAGAGAATGG - Intergenic
1174740797 20:53012283-53012305 AACTGAGCAGAAACAGAGACGGG - Intronic
1175460140 20:59146260-59146282 AGAGAAGCAGAGGCAGAGATGGG + Intergenic
1175495234 20:59409900-59409922 AATGAGGAATAGACAGAGATGGG + Intergenic
1177225120 21:18244485-18244507 AATTTAGCACAGAAAGAGAAAGG + Intronic
1177754286 21:25326403-25326425 AACTAAGAAGGGCCAGAGATGGG - Intergenic
1178749142 21:35284051-35284073 AATCAAGAAGGGATAGAGATGGG - Intronic
1179332391 21:40416514-40416536 AAATAAGCAGACAAAGAGTTTGG + Intronic
1181965287 22:26652329-26652351 AAATAAAGAGAGAGAGAGATAGG - Intergenic
1182004619 22:26949457-26949479 CATGAACCAGAGCCAGAGATGGG - Intergenic
1182723158 22:32420562-32420584 AGTTAAGAAGAGGCAGAAATGGG - Intronic
1183023636 22:35047453-35047475 AAATAAACAGAGGCAGAGAGTGG + Intergenic
1183694421 22:39413594-39413616 TTTTTAACAGAGACAGAGATGGG + Intronic
1184455745 22:44608654-44608676 ACTTAAGCAGGGCCAGAGAGAGG + Intergenic
949607405 3:5669193-5669215 AAATAGGAAGAGACAGAGTTTGG - Intergenic
949784727 3:7728401-7728423 AATTAATCAGGCATAGAGATCGG - Intronic
951364243 3:21761459-21761481 AATTCAGCTAAGACAGATATAGG + Intronic
951925569 3:27905653-27905675 AAAAAATCAGAGACAGAGCTGGG + Intergenic
953557318 3:43956822-43956844 AAGAAAGCAGAGCCTGAGATGGG + Intergenic
954325840 3:49863247-49863269 AAATAAGCAGAGTCAGATAATGG + Intronic
955710546 3:61774743-61774765 AATGAAGCAGAGACACCGGTAGG - Intronic
956234626 3:67054937-67054959 AAATCAGTAGAGACAGAGACTGG - Intergenic
956841066 3:73140835-73140857 AATTAAGCAGAGACACACCCAGG + Intergenic
957399824 3:79695914-79695936 AATTAAGCGGACACAGTTATAGG + Intronic
959054968 3:101558532-101558554 AAATAAGCAGCTAAAGAGATGGG - Intergenic
959312278 3:104754501-104754523 CACCAAGCAGAGACTGAGATAGG - Intergenic
959636108 3:108572782-108572804 AATTAAAAAGATATAGAGATTGG - Intronic
959707634 3:109353621-109353643 AGTAAAGCAGAGACATATATTGG + Intergenic
959818815 3:110707718-110707740 AAGAAAGTAGAGAAAGAGATAGG - Intergenic
959865006 3:111256741-111256763 AAATAACAAGAGACAGAAATTGG - Intronic
960390563 3:117072802-117072824 AATTTAACAGAGATAGACATGGG - Intronic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
960975664 3:123171547-123171569 AACTTATCAGAGACAGAGACAGG - Intronic
961493239 3:127271190-127271212 AATTAAGCACAGTGAGAAATTGG - Intergenic
961495898 3:127291034-127291056 AATGCAGCAGAGAAAGAGAGGGG - Intergenic
962412364 3:135152464-135152486 CATGAAGCAGACACAAAGATGGG + Intronic
963666028 3:148187478-148187500 TGTGAAGCAGAGGCAGAGATTGG + Intergenic
964498053 3:157316067-157316089 AATTAAGAAAAGAGACAGATTGG - Intronic
965976239 3:174626433-174626455 AATTAAGCAAAGGCATAAATAGG - Intronic
966826134 3:183966605-183966627 CAGTGAGGAGAGACAGAGATGGG - Intronic
967516692 3:190377949-190377971 AATCTAGCAGAGAAAGATATGGG + Intronic
967785674 3:193491713-193491735 AATTGAGGAGAGACAGAGTTGGG - Intronic
968258028 3:197297432-197297454 AATTAAGAACAGACAGAAGTCGG + Intronic
968341737 3:197961025-197961047 ATTTAAGCAGAGAGAAAAATGGG - Intronic
969351347 4:6599789-6599811 GATTACACACAGACAGAGATGGG - Intronic
969453273 4:7286920-7286942 AAGTCAGCAGAGGCAGAGAGAGG + Intronic
970049138 4:11893137-11893159 AATTAAATAGATACATAGATTGG + Intergenic
970464234 4:16306974-16306996 GATCAAGTTGAGACAGAGATGGG + Intergenic
971354452 4:25882500-25882522 AGTTAATCAGAGACAGGAATTGG + Intronic
971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG + Intergenic
971511266 4:27427794-27427816 AAAGAAACAGAGACAGAGAGAGG - Intergenic
972357995 4:38299233-38299255 AAAGAAGCAGAGAAAGAGAAAGG + Intergenic
972750784 4:41986559-41986581 AATTAAGCTGAGACAGAGCATGG - Intergenic
973054430 4:45637472-45637494 ATGTAGACAGAGACAGAGATTGG + Intergenic
973766510 4:54168053-54168075 AATTAATTAGAAACAGTGATAGG + Intronic
974057421 4:56998009-56998031 AATTAATTAGAGACAGAGAAAGG + Intronic
974796537 4:66758683-66758705 AATAAAGCAGAGTTAGAGAATGG - Intergenic
975001620 4:69230417-69230439 AATAACAGAGAGACAGAGATGGG + Intergenic
975003823 4:69261700-69261722 AATAACAGAGAGACAGAGATGGG - Intergenic
975159281 4:71107188-71107210 AATTCCCCAAAGACAGAGATTGG - Intergenic
976196047 4:82531994-82532016 AATTAAGTTGAGAAAGGGATGGG + Intronic
977750335 4:100602604-100602626 AACTAAGGTGAGATAGAGATTGG - Intronic
979129616 4:117026150-117026172 AATTTATCAGAGAGAGAGATTGG + Intergenic
979395916 4:120188911-120188933 CATTAAGTAAGGACAGAGATTGG - Intergenic
981575969 4:146206000-146206022 GATAAAGCAGAGGCAGAGTTTGG + Intergenic
981887705 4:149697166-149697188 AAATCAGCTGAGAGAGAGATAGG - Intergenic
982525484 4:156472536-156472558 ACATAAGCACAGACATAGATTGG + Intergenic
982900044 4:160987635-160987657 ATTGAAGCAGAGACAGAGTAGGG + Intergenic
983911308 4:173242674-173242696 AACTAAGCAGAGAGAAAGAAGGG + Intronic
984399933 4:179249650-179249672 AATAAAGCAGAGAAGGGGATGGG + Intergenic
984579232 4:181491544-181491566 AATTATGCAAAGACAGAGTAAGG + Intergenic
984995032 4:185422389-185422411 AATGAAACTGAGAGAGAGATAGG - Intronic
985167639 4:187114248-187114270 AATTAAGAATTGACAGAAATTGG + Intergenic
985207174 4:187550981-187551003 AATTGAGCAGAGAGAGAAATAGG + Intergenic
985669333 5:1198745-1198767 AGACAAGGAGAGACAGAGATAGG - Intergenic
985767592 5:1788025-1788047 AAAGAGACAGAGACAGAGATAGG - Intergenic
986166246 5:5273726-5273748 ATTTAAGCAGGTACAGACATTGG + Intronic
987106572 5:14645680-14645702 AATTTAGCAGAGAGAGAGAGAGG + Intergenic
987214258 5:15716453-15716475 AAGTCAGCAGAGACACAGAGGGG - Intronic
989301588 5:39901318-39901340 AACTATCCAGAGACAGGGATTGG - Intergenic
990234557 5:53752828-53752850 ATTAAAGCAAAGACAGGGATAGG + Intergenic
990484516 5:56244618-56244640 AAGCAATCAGAGACAGAGAGAGG - Intergenic
990619349 5:57543010-57543032 AATGAAGCTGAGACAAAGAAAGG + Intergenic
990950404 5:61293037-61293059 AATGAGGCAGAGGCAGAGCTGGG + Intergenic
991044170 5:62205694-62205716 AATTAAGAAGACAGTGAGATGGG - Intergenic
992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG + Intergenic
993520993 5:88899986-88900008 AATTAATAAGAAAAAGAGATGGG - Intronic
993721594 5:91326357-91326379 AAATAGACAAAGACAGAGATGGG - Intergenic
993889062 5:93450933-93450955 AAAAAAACAGAGAGAGAGATAGG + Intergenic
994140312 5:96334299-96334321 AACTAAGCAGTGACTGTGATAGG - Intergenic
994164593 5:96595592-96595614 AAAGAAGCAGAGACAGTGATGGG + Intronic
994274552 5:97820749-97820771 AATGAGGTAGAGAAAGAGATAGG - Intergenic
994307647 5:98226403-98226425 AAGTAAGGAGAGAGAGAGAAAGG + Intergenic
995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG + Intergenic
997182775 5:131848875-131848897 AATTAAGCAGAAACATTGATTGG - Intronic
998038059 5:138933188-138933210 AATTAAGAGTAGACATAGATAGG + Intronic
999402121 5:151273371-151273393 AATTAAGCAGGTGAAGAGATGGG + Intergenic
999569077 5:152898498-152898520 AAAAAAGCAGACACAGAGAAAGG - Intergenic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1002619752 5:180479620-180479642 AATTAACCAGAGCTAGGGATAGG + Intergenic
1002868661 6:1146517-1146539 AGATAGGCAGAGACAGAGAGAGG + Intergenic
1003384640 6:5655861-5655883 AAATACTCAGAGACAGAGATGGG - Intronic
1006336709 6:33424896-33424918 AATGAAGGAATGACAGAGATAGG + Intronic
1007022100 6:38530653-38530675 AATCCTGGAGAGACAGAGATAGG + Intronic
1008478084 6:51954510-51954532 TATTAAGCAGCAACAGAGACTGG + Intronic
1008797846 6:55326599-55326621 AATTAAGAAGAGATAGGGATGGG - Intergenic
1008846675 6:55974450-55974472 AAATAAGCATAGAAAAAGATGGG - Intergenic
1010639058 6:78299896-78299918 AATTAATCAGGGACAGAGTTAGG - Intergenic
1010835247 6:80579065-80579087 AAGGAAGTAGAGACAGAAATAGG + Intergenic
1011089593 6:83581995-83582017 AAATAAACAGAAACAGAGAAAGG + Intronic
1011411058 6:87066887-87066909 ACTTAAGCTGAGAGTGAGATTGG + Intergenic
1011717186 6:90119289-90119311 AATTAGGTAAAGACAGAGCTGGG - Intronic
1011902178 6:92312638-92312660 ACTTAAGCCCAGCCAGAGATTGG - Intergenic
1012672364 6:102070474-102070496 CATAAAACAGAGAAAGAGATAGG + Intergenic
1012794746 6:103745016-103745038 AACCAAGGAGAGACAGAGCTGGG + Intergenic
1013481353 6:110555566-110555588 AATTAAGCAGAGTCTGAAAGTGG + Intergenic
1014633760 6:123819258-123819280 AATGAAATACAGACAGAGATTGG + Intronic
1014693795 6:124594319-124594341 AAAGAGGCAGAGACAGAGAGGGG + Intronic
1014788025 6:125640185-125640207 AATTAAGCAGGGCCTGAGACTGG - Intergenic
1015934599 6:138396104-138396126 AATTTGGCAGACACATAGATAGG - Intergenic
1015976952 6:138800070-138800092 AAATGAGGAGAGACACAGATTGG + Intronic
1016057962 6:139598736-139598758 AAAAAAGGAGAGACAGATATGGG + Intergenic
1016182406 6:141163172-141163194 AATTAATCAGGGAAAGAGAAAGG + Intergenic
1016331139 6:142952883-142952905 AATCTAGCAGGGACAGAGAAGGG + Intergenic
1016515302 6:144886456-144886478 AACTCAGCACAGACAGAGACAGG + Intergenic
1016665510 6:146635354-146635376 AACTAGACAGAGACAGAGAGTGG - Exonic
1017008468 6:150045152-150045174 AATAAATCAGAGGCAGTGATTGG + Intergenic
1018078842 6:160241123-160241145 AAATCAGCAGAGAGAGAGTTAGG + Intronic
1018361127 6:163069710-163069732 AAGAAGGCAGAGAAAGAGATGGG + Intronic
1020457946 7:8395501-8395523 AATTCACCAGAGACTGAGGTAGG - Intergenic
1020468267 7:8505909-8505931 GATTCAGTAGAGACAGAAATGGG + Intronic
1021868103 7:24979106-24979128 GAATAAACAGAGACAGAGGTAGG + Intronic
1022884290 7:34625914-34625936 AATTTAGAAGAGAAAGAGAATGG - Intergenic
1023505125 7:40891202-40891224 AATGGAGCAGAGAAAGAGAATGG + Intergenic
1023658241 7:42447831-42447853 ATCGAAGCAGAGAAAGAGATTGG + Intergenic
1024474219 7:49793055-49793077 AAGAAAGCAAAGACAGAGAGTGG - Intronic
1026544411 7:71309334-71309356 AATTTAGCAGGGAATGAGATGGG - Intronic
1026843501 7:73683931-73683953 GATTTACCAGAGACAGAAATCGG - Intronic
1026880272 7:73903308-73903330 AATGAGGCAGAGAAAGAGAGAGG + Intergenic
1027245686 7:76365733-76365755 AAGGAAGCAGAGACACAGAGAGG + Intergenic
1028864475 7:95691869-95691891 AGAGAAACAGAGACAGAGATTGG + Intergenic
1030593513 7:111508984-111509006 AATTTAACAGACAAAGAGATGGG + Intronic
1030624613 7:111831076-111831098 AGTTCAGGAGAGAGAGAGATGGG - Intronic
1030799879 7:113837044-113837066 AATAAATCAAAGACAGACATAGG + Intergenic
1031668098 7:124510332-124510354 AATTAAACATAAACAGATATAGG - Intergenic
1031745318 7:125488795-125488817 AAATAAGTAAAGACAGAGAATGG + Intergenic
1031810808 7:126366470-126366492 AAATGAGCAGAGAGAGAGCTGGG + Intergenic
1031911899 7:127526089-127526111 AATTAAAAAGAGAAAGAGAGGGG - Intergenic
1033955359 7:146841327-146841349 AATTTGGCAGAGAGAGAGAGGGG + Intronic
1034067995 7:148155189-148155211 ATTTAGGAAGAGACAGAGATGGG + Intronic
1034575700 7:151995060-151995082 AATTATGAAGAGAAAGAAATGGG - Intronic
1034628240 7:152510624-152510646 AAATAAACAGAAATAGAGATGGG + Intergenic
1035608525 8:945544-945566 GAGTAAGAAGAGACAAAGATGGG - Intergenic
1036429712 8:8678840-8678862 GTTAAAGCAGAGACAGAGAAGGG - Intergenic
1036539435 8:9690400-9690422 TATTAAGAAGAGAAAGAGAAGGG - Intronic
1036613624 8:10371574-10371596 CATCAAGCAGAGACAGTGTTTGG + Intronic
1036826525 8:11980692-11980714 AATAAAACAGGGACAGAGAGAGG + Intergenic
1037197705 8:16212047-16212069 ATCTAAGCAGAGTCATAGATAGG + Intronic
1038114581 8:24539086-24539108 GCTTAGGGAGAGACAGAGATTGG - Intergenic
1039055701 8:33534628-33534650 AATTAAGCTTAGTGAGAGATGGG - Intergenic
1039877504 8:41599580-41599602 ATGCAAGAAGAGACAGAGATTGG - Intronic
1040002641 8:42592175-42592197 AATGAAACAAAGACAGAGTTCGG - Intergenic
1041602851 8:59742140-59742162 GATTAGGCAGAGACAGCAATAGG - Intergenic
1041981211 8:63862672-63862694 AAATTACCAGAGACAGAGAGAGG - Intergenic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1043043671 8:75294074-75294096 CATCAAGCAGGGAAAGAGATGGG + Intergenic
1043285757 8:78528299-78528321 AATGAAGCAGAAACAAAAATAGG - Intronic
1043480186 8:80645010-80645032 CATTCAGCAGAGTCAGGGATGGG - Intronic
1043621206 8:82194488-82194510 AATCAAGGAGAGACAAAGAAAGG + Intergenic
1044300012 8:90572842-90572864 AAGGAAGCAGAGAAAGAGAGAGG + Intergenic
1044878116 8:96692867-96692889 AATTCTGGAGATACAGAGATAGG + Intronic
1044890515 8:96830344-96830366 AAATCAGGAGAGACTGAGATTGG + Intronic
1045278418 8:100727574-100727596 TATTAAGCAGAGACATACACAGG + Intergenic
1046204178 8:110968537-110968559 AATTAAAGAGAAACAGAGAATGG - Intergenic
1046624337 8:116560758-116560780 AAGTAAGCAGAGGCAGGGAATGG + Intergenic
1046690735 8:117281759-117281781 AATTAATCAGATACAAAGTTTGG + Intergenic
1047057215 8:121179143-121179165 AGCCACGCAGAGACAGAGATCGG + Intergenic
1047436566 8:124839835-124839857 CATAAAGCAGAAACAGAGAAGGG - Intergenic
1047905714 8:129471100-129471122 AATTGAGCAGAGAGAGAGAGAGG + Intergenic
1048225676 8:132583031-132583053 AATCAAAGAGAGACAGAGAGAGG + Intronic
1049102659 8:140590472-140590494 AAGGAAGCAGAGGCACAGATGGG + Intronic
1049356387 8:142190893-142190915 AGTTAGGGAGAGACAGAGACAGG - Intergenic
1050187892 9:2994424-2994446 AAAGAAAAAGAGACAGAGATGGG + Intergenic
1050264940 9:3880049-3880071 GATTTAGCAGTGACAGAGAGGGG - Intronic
1050947087 9:11538173-11538195 AGTTGGACAGAGACAGAGATTGG - Intergenic
1051999839 9:23265434-23265456 AATTAAGTAGAGAAAGAAATAGG + Intergenic
1052003130 9:23312301-23312323 ATTTAATCAGAAACAGGGATAGG - Intergenic
1052972885 9:34388069-34388091 ACTTTAGCAGAGACAGAGGTGGG + Intronic
1052995238 9:34548397-34548419 AGAGAAACAGAGACAGAGATGGG + Intergenic
1055134651 9:72814184-72814206 TTTTAAACAGAGACAGAGAAAGG + Intronic
1055354865 9:75427479-75427501 GATTAAGAGGGGACAGAGATGGG - Intergenic
1055489332 9:76788843-76788865 AATAAAACAGAGACACAGATTGG - Intronic
1055954520 9:81761513-81761535 AATGAAGCAGAGAAAGAGGGGGG - Intergenic
1056463661 9:86832562-86832584 AAATAAGCAAAGACAGGGGTAGG - Intergenic
1056756278 9:89383930-89383952 ACAGCAGCAGAGACAGAGATGGG - Intronic
1057000139 9:91501061-91501083 AATTAAGCAAATCCAGAGAGTGG + Intergenic
1057143234 9:92740111-92740133 AACCACGCAGAGAGAGAGATGGG + Intronic
1058566198 9:106287778-106287800 AGCGAAGGAGAGACAGAGATGGG - Intergenic
1059058453 9:111009313-111009335 AATTACACAGAGGCACAGATGGG + Intronic
1059305832 9:113352390-113352412 AATAAAGCAAAGTAAGAGATTGG + Intronic
1059351938 9:113671725-113671747 AATTAGCCAGAGAGAGAGAAAGG - Intergenic
1059866241 9:118517318-118517340 AATTAAGAAGACACAGATATAGG - Intergenic
1060945985 9:127569405-127569427 ACCTAAGCAGAGAAAGAGACGGG + Intronic
1185543525 X:922916-922938 AAATAAGTAGAGAGAGAGAGAGG - Intergenic
1185795895 X:2964117-2964139 AATTATTCAGAGACAGAAAAGGG + Intronic
1186341358 X:8649504-8649526 AATAAAGCAGAGGAGGAGATGGG - Intronic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1187080764 X:15984644-15984666 AAAGAAGCAAAGACAAAGATAGG + Intergenic
1187649024 X:21379758-21379780 ACTTAGGCAAAGACAGAGAGAGG + Intronic
1187826936 X:23340928-23340950 AATTAAGGAGAGACTGAGATCGG + Intronic
1188160678 X:26798031-26798053 AATTAAGCATATACTGATATAGG + Intergenic
1188422093 X:30002611-30002633 AAATAAAGAGAGAGAGAGATTGG - Intergenic
1188478935 X:30617594-30617616 CATTCAGCAGAGTCAGGGATGGG + Intergenic
1189401004 X:40668434-40668456 ACTTATGGAGAGACTGAGATTGG + Intronic
1189517834 X:41733188-41733210 AAAAAAGGAGAGAGAGAGATAGG + Intronic
1190648661 X:52546933-52546955 AACTAATCAGAGACAGAATTTGG + Intergenic
1190679688 X:52814473-52814495 AACTAATCAGAGACAGAATTTGG + Intronic
1190757228 X:53411756-53411778 AAGAAAGTAGAGACAGAGGTGGG - Exonic
1191646768 X:63489563-63489585 AATCCTGGAGAGACAGAGATAGG + Intergenic
1192073342 X:67963806-67963828 AAGGAGGCAGAGAAAGAGATAGG + Intergenic
1192175592 X:68883106-68883128 AGCTAAGCAGAGGTAGAGATGGG + Intergenic
1193905762 X:87242740-87242762 AAGAAAGCAGAAAAAGAGATGGG - Intergenic
1194143014 X:90228529-90228551 AATTAAACATAGACAAACATTGG - Intergenic
1194252440 X:91592834-91592856 AATTAAACAGAGACATAAACAGG + Intergenic
1194285518 X:92006200-92006222 AAGGAAGTAGAGAAAGAGATAGG - Intronic
1194550555 X:95292726-95292748 AAATAGGTAGAGAAAGAGATAGG + Intergenic
1195379222 X:104255238-104255260 ACTTGAGCAGAGACCCAGATTGG + Intergenic
1196154196 X:112408561-112408583 AAGTAGGTAGAGAAAGAGATGGG + Intergenic
1196521665 X:116680998-116681020 AATTTAACAGAGACAGAAAGTGG - Intergenic
1196646771 X:118126526-118126548 AAGTATTAAGAGACAGAGATGGG + Intergenic
1197920830 X:131591999-131592021 GATTAAGCAAAGACAAAGAATGG + Intergenic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic
1199513971 X:148655177-148655199 CATCAAGTAGAGACATAGATGGG + Intronic
1200571371 Y:4834078-4834100 AATTAAACAGAGACATAAACAGG + Intergenic
1200603085 Y:5230738-5230760 AAGGAAGTAGAGAAAGAGATAGG - Intronic