ID: 960645267

View in Genome Browser
Species Human (GRCh38)
Location 3:119873485-119873507
Sequence CCTGTTTACCTGCCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960645263_960645267 -9 Left 960645263 3:119873471-119873493 CCTGTTTCCAGACTCCTGTTTAC 0: 1
1: 0
2: 2
3: 20
4: 188
Right 960645267 3:119873485-119873507 CCTGTTTACCTGCCCTCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960645267 Original CRISPR CCTGTTTACCTGCCCTCCAA GGG Intronic
900377155 1:2360174-2360196 CCTGTTAACCTGTCCTCCATAGG - Intronic
900420199 1:2552976-2552998 CCTGGGTTCCAGCCCTCCAAGGG - Intergenic
900424232 1:2568682-2568704 CCTGGGTTCCAGCCCTCCAAGGG + Intergenic
900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG + Intergenic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901624396 1:10615747-10615769 CCACTTCACCTGCCCTCCGATGG - Intronic
902561893 1:17282832-17282854 CATGTTCACCTGCAGTCCAAAGG - Exonic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
903332478 1:22603086-22603108 CCTGCTTCCCTGCCTGCCAACGG - Exonic
904857873 1:33513296-33513318 CCTTTTTACATTCCCACCAATGG + Intergenic
904966628 1:34379203-34379225 CCTGATTATGTGCCCTGCAATGG - Intergenic
905371333 1:37484039-37484061 ACCGTGTGCCTGCCCTCCAAGGG + Exonic
906142964 1:43544652-43544674 CCTGTTTCCCTGTCCTCTTATGG + Intronic
909170858 1:72293284-72293306 TCTGTTTTCCTGCCTTCCAGTGG + Intergenic
913318293 1:117571312-117571334 CCTGGTGACCTGCGCTCCACTGG + Intergenic
914991309 1:152501730-152501752 CCTGTTTGCCTGGCATCCCAGGG + Intergenic
916116868 1:161492459-161492481 CTTATTTACCTTCCCACCAATGG + Intergenic
920400560 1:205673516-205673538 CCTGTATACCTCACCTCCTAAGG - Intronic
920518419 1:206603758-206603780 CCTGTTTTCCTGTCTTCCTAAGG - Intronic
922091473 1:222399539-222399561 CCTGTGCTCCTTCCCTCCAATGG + Intergenic
923151354 1:231236075-231236097 TCTGTTTAACTGTCCTACAATGG + Intronic
924483183 1:244454674-244454696 ACTGTTTACCTCCTCTGCAAGGG + Intronic
1064471595 10:15641025-15641047 CCTGTGTAGCTACCCTCCCAAGG - Intronic
1067085745 10:43237339-43237361 CTGCTTCACCTGCCCTCCAATGG + Intronic
1069627965 10:69880125-69880147 CCTGTTTCCCGCCACTCCAATGG + Intronic
1071371667 10:84957717-84957739 CCTGAGTCCCTGACCTCCAAAGG + Intergenic
1073599239 10:104830674-104830696 CCTGGTTACCTGCCATACATAGG + Intronic
1078655466 11:13234845-13234867 CCTGTTTACCTGCTCACTCAAGG - Intergenic
1084557963 11:69886092-69886114 CCTGTTTGCCTGCCCTACACAGG - Intergenic
1090458167 11:126867309-126867331 TCTCATTACCTGCACTCCAATGG + Intronic
1091135525 11:133185445-133185467 GCTGTCTACCTTCCCTGCAATGG - Intronic
1093776815 12:23084924-23084946 CCTGTTAACCTGCCAGCTAATGG + Intergenic
1094304825 12:29006870-29006892 CCTGATTTCCAGGCCTCCAAGGG + Intergenic
1095966418 12:47870192-47870214 CCTGTTCTCCTGCCTTCCAAGGG + Intronic
1096605017 12:52758521-52758543 TCTGTATACCTGCTCTCCAGTGG - Intergenic
1101987763 12:109460939-109460961 CCTGCCTACCTGCCCACTAAGGG + Intronic
1102584850 12:113915577-113915599 CCTGTCTCCCTGCTCTCCCAGGG + Intronic
1103747251 12:123133671-123133693 CCTCTTTCCCTGCCTTCAAATGG + Intronic
1105706583 13:22971178-22971200 CCTGGTTTCCTGACCTCCCATGG + Intergenic
1106240797 13:27911563-27911585 CCTGATTCCCTGCAGTCCAAAGG + Intergenic
1109768024 13:66930644-66930666 CCTTCTTCCCTCCCCTCCAAAGG - Intronic
1113581608 13:111434031-111434053 CCTGTGTACCTGACCTGCCATGG - Intergenic
1115780500 14:36763502-36763524 CCTGTTTCCCTTCCCTCCAGTGG - Intronic
1116451422 14:45070787-45070809 CCTGTGTACCTTCCACCCAAAGG - Intronic
1122234013 14:100322071-100322093 CCTGTTTTCCTGTCCTCTAATGG - Intergenic
1122849930 14:104522653-104522675 CCTGGTTTCCTGACCTCCCATGG + Intronic
1122898328 14:104771534-104771556 CCTCCTGCCCTGCCCTCCAAGGG - Intronic
1125505746 15:40266568-40266590 CCTCTTTGCCAGTCCTCCAAGGG - Intronic
1125603347 15:40927360-40927382 CCTGCTTACCTGACCCTCAAGGG - Intergenic
1126064760 15:44818188-44818210 TCTGTTTAACTGTCCTCCCACGG + Intergenic
1126095077 15:45082405-45082427 TCTGTTTAACTGTCCTCCCACGG - Intergenic
1127781503 15:62320447-62320469 CCTGTTTCCCTTCCTTTCAATGG - Intergenic
1132304370 15:100800868-100800890 CCTGCTTCCCTACCCTCCTATGG - Intergenic
1132347657 15:101118276-101118298 CCTGTTGCCGTGCCCTCCAGAGG + Intergenic
1133799101 16:9070494-9070516 CGTGTTAATCAGCCCTCCAAAGG - Intergenic
1134568571 16:15272255-15272277 CCTGTTTACATGCCTACCAGTGG - Intergenic
1134733861 16:16484107-16484129 CCTGTTTACATGCCTACCAGTGG + Intergenic
1134933639 16:18228175-18228197 CCTGTTTACATGCCTACCAGTGG - Intergenic
1137558448 16:49488185-49488207 CCTGTTTTTCTTCCCTCCTAAGG - Exonic
1138160427 16:54748105-54748127 CCACTTTCCCTGCCCTCAAAAGG + Intergenic
1140317497 16:73913230-73913252 CCTGCTTACCTGCCTGCCTATGG + Intergenic
1142757321 17:2024028-2024050 CGTGATCACCTGCCCTCCCAGGG + Intronic
1142977685 17:3655560-3655582 CCTGTTTTCCTGCTTTCCCAGGG - Intronic
1143294588 17:5861234-5861256 ACTGTTGACCTCCCTTCCAATGG + Intronic
1144588485 17:16503596-16503618 CCAGTTCTCCTGCCCTCCACTGG - Intergenic
1150005038 17:61463975-61463997 CCTGCTTACCAGCCCCCCTATGG - Intronic
1152854708 17:82658208-82658230 CCTGTTCTCCCGCCCTCCCAAGG + Intronic
1153720408 18:7896115-7896137 TGTGTTGACCTGCCCTCCTATGG + Intronic
1156274298 18:35568053-35568075 ACTGTTTCCCTGCCCTCATATGG + Intergenic
1161000421 19:1907945-1907967 GATTTTGACCTGCCCTCCAAGGG + Intronic
1165160831 19:33814809-33814831 CCATTTTACCTGCCCTCTAAGGG + Intronic
1165609787 19:37141433-37141455 CCTTTTTACCTTCCCTTCATGGG - Intronic
1165711759 19:38016384-38016406 CCTGTTTTTCTGCCATCCACTGG + Intronic
929846730 2:45537978-45538000 CCTCCTTGCCTGCTCTCCAATGG - Intronic
930203087 2:48563045-48563067 CCTGGTTACCTGCCCTTCACAGG - Intronic
932493438 2:72135154-72135176 CCTGTCGACCTGCCCTTCAGTGG - Exonic
934115191 2:88783153-88783175 TGTGTTGACCTGCTCTCCAATGG - Intergenic
935127756 2:100239361-100239383 CTTGTTTTCCTCCCCTCCAAGGG + Intergenic
938711178 2:133977480-133977502 CCTGTTTGCCTGCTCTCAGAGGG - Intergenic
944365222 2:198911318-198911340 TATGTTTACCTGCTTTCCAAAGG - Intergenic
945367100 2:208967961-208967983 CCTCTTCACCTGCCCACCAAAGG - Intergenic
945994018 2:216420837-216420859 CCTGTTTTTCTGCTCTGCAAAGG - Intronic
946153207 2:217789895-217789917 CCTGTTTACCTGGCCAGCCACGG + Intergenic
948133031 2:235614803-235614825 CCTGTTTTCTTGGCCTCCTAGGG + Intronic
1171271406 20:23821374-23821396 CCTGCTTCCCAGGCCTCCAATGG + Intergenic
1178976847 21:37227675-37227697 GCTGTTCACCTGCCCTACACTGG - Exonic
1179505229 21:41835686-41835708 GCTGTTCACCTGCCCTAGAAAGG + Intronic
950183964 3:10933770-10933792 CCTGATTGCCTTGCCTCCAAAGG + Intronic
951023561 3:17806362-17806384 CCTGTTTACTTGCCTTACCACGG + Intronic
954935518 3:54323181-54323203 ACTGCTTCCCTGGCCTCCAAAGG - Intronic
955813533 3:62817899-62817921 CCTGTTTTTCTTCCCTCAAAGGG - Intronic
955888056 3:63621175-63621197 TCTGTTTCCATGTCCTCCAAGGG - Intergenic
956062958 3:65366921-65366943 GCTGGTTAACTGCCCTCAAATGG - Intronic
957149470 3:76467174-76467196 CATTTTTATCTGCCATCCAATGG - Intronic
960645267 3:119873485-119873507 CCTGTTTACCTGCCCTCCAAGGG + Intronic
963378392 3:144498411-144498433 CTTGTCTACCTGTCTTCCAAGGG - Intergenic
966498010 3:180602409-180602431 TCTCATTACCTGCCCTGCAACGG - Exonic
969197203 4:5572490-5572512 CCGGCTTTCCTGTCCTCCAAAGG + Intronic
971319463 4:25593732-25593754 CCTGGGTAAATGCCCTCCAAGGG - Intergenic
972909465 4:43797061-43797083 CCTGAAAACCTCCCCTCCAAAGG + Intergenic
973125052 4:46572653-46572675 CTTGTTTACATTCCCACCAATGG - Intergenic
981962596 4:150558995-150559017 GATGTCTACCTGCCCTTCAATGG - Intronic
989343118 5:40399536-40399558 CCTGTTCAATTACCCTCCAAAGG + Intergenic
994570648 5:101508857-101508879 CCTGTTGCCTTGGCCTCCAAAGG - Intergenic
995252659 5:110012173-110012195 CCTGTTGACCTCACATCCAAGGG + Intergenic
996467412 5:123819815-123819837 CCAATTTACCTGCCTTCAAAGGG + Intergenic
1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG + Intergenic
1006406569 6:33849019-33849041 CCTGTCTACCTGCCCACCTCTGG - Intergenic
1007252252 6:40503749-40503771 CCTGCTTCCCTTGCCTCCAATGG - Intronic
1009555946 6:65167082-65167104 CCATTTTACCTTCCCACCAATGG - Intronic
1009902776 6:69829041-69829063 CTTGTTTTCCTACCTTCCAAAGG - Intergenic
1010951284 6:82040130-82040152 CCTTTTTATCTGCCCTCAATTGG + Intergenic
1015301075 6:131653753-131653775 CCTCTTTCCCTGCTCTCAAAAGG - Intronic
1016463615 6:144304429-144304451 CCTGTGTACCTGCCCTCTCTAGG - Intronic
1020814231 7:12885020-12885042 AATCTTTAGCTGCCCTCCAAGGG - Intergenic
1022952992 7:35356134-35356156 CCTGGCTTTCTGCCCTCCAAGGG + Intergenic
1024623403 7:51183130-51183152 CCTGATTTCCTGCCCTTCAGTGG - Intronic
1025029813 7:55547966-55547988 CCTGTTTGATTCCCCTCCAAGGG + Intronic
1030156720 7:106462727-106462749 CCTTTTTACCTGCTATTCAAAGG + Intergenic
1030425422 7:109370845-109370867 CCTATTTACCTGCTATCCTAAGG - Intergenic
1031438867 7:121767552-121767574 CCTGTTTTTCTGCACACCAACGG + Intergenic
1031921073 7:127600982-127601004 CCTGTTTTCCTGCCTTCCCCAGG + Intronic
1032265896 7:130369726-130369748 CCTGTCTCCGTGCCCTCCAGGGG - Intergenic
1039870258 8:41539991-41540013 CCTGTTTACCTGCCCGAAAGAGG - Exonic
1040498363 8:47986638-47986660 CATGTGTTCCTGCCCTCCAGAGG - Intergenic
1040586468 8:48747776-48747798 CCTGAATGGCTGCCCTCCAAGGG - Intergenic
1040861129 8:52000382-52000404 CCTGTTCACGTGCCCTCAGACGG - Intergenic
1043047972 8:75351967-75351989 CCTTTTTGCCTGGCCTCCCAGGG + Intergenic
1047594961 8:126369126-126369148 GCTGTTTACTTGCCTTCCAGAGG - Intergenic
1049180585 8:141220055-141220077 GCTGTTTATCAGACCTCCAAGGG + Intronic
1053286451 9:36852426-36852448 CCTGTCTACCTGGCCTCTGAGGG - Intronic
1053425078 9:38005080-38005102 CCTGTCATCCTGCCCTCCAGGGG + Intronic
1057710021 9:97431870-97431892 CCTGTTGACCAGCCCTCCAGTGG + Intronic
1058823804 9:108756967-108756989 TCTATTTACCTGCCCTCTAGAGG - Intergenic
1059087496 9:111320159-111320181 CCTGTATACATGCCATCCAGTGG + Intergenic
1060822032 9:126666796-126666818 CCTGTATACCTGCCCTGCCCAGG - Intronic
1061874978 9:133539163-133539185 CCTGGTCAGCTGCCCTCCTAGGG + Intronic
1187183250 X:16963625-16963647 CATGTTGACCTGACCTGCAAAGG - Intronic
1189302340 X:39961052-39961074 ACTATTTACCTGACCTCGAATGG - Intergenic
1189481101 X:41392987-41393009 CCAGCTTCCCTGTCCTCCAATGG - Intergenic
1192313807 X:70036730-70036752 CCTTTTTACCTGGCCTAGAAAGG + Exonic
1198665175 X:139013235-139013257 CTAGTTTACATTCCCTCCAACGG - Intronic