ID: 960656539

View in Genome Browser
Species Human (GRCh38)
Location 3:120010722-120010744
Sequence ATTTTGGCCTGGGTGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1261
Summary {0: 1, 1: 0, 2: 10, 3: 119, 4: 1131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960656533_960656539 -5 Left 960656533 3:120010704-120010726 CCAAGACTGCGCCACTGCATTTT 0: 1
1: 10
2: 246
3: 3798
4: 30815
Right 960656539 3:120010722-120010744 ATTTTGGCCTGGGTGACAAAGGG 0: 1
1: 0
2: 10
3: 119
4: 1131
960656532_960656539 7 Left 960656532 3:120010692-120010714 CCTGTAAGTGAGCCAAGACTGCG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 960656539 3:120010722-120010744 ATTTTGGCCTGGGTGACAAAGGG 0: 1
1: 0
2: 10
3: 119
4: 1131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960656539 Original CRISPR ATTTTGGCCTGGGTGACAAA GGG Intronic
900133654 1:1103761-1103783 ATTTCTGCCTGGGCGACAGAGGG - Intronic
900378296 1:2370706-2370728 ACTCTAGCCTGGGTGACAGAGGG - Intronic
900469079 1:2843012-2843034 ATTTTTCCCTGGGTCAGAAATGG + Intergenic
901376601 1:8844174-8844196 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
901505559 1:9683090-9683112 ATGCCAGCCTGGGTGACAAAGGG + Intronic
902034973 1:13451243-13451265 ACTCTAGCCTGGGTGACAAAGGG - Intergenic
902929324 1:19719559-19719581 ACTCTAGCCTGGGTGACAGAGGG - Intronic
903257671 1:22113796-22113818 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
903297802 1:22356278-22356300 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
903423347 1:23234684-23234706 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
903629410 1:24755574-24755596 ACTCTGGCCTGGGTGACCGACGG + Intronic
903709733 1:25314524-25314546 ATTCCAGCCTGGGTGACAGAAGG - Intronic
903717382 1:25377870-25377892 ATTCCAGCCTGGGTGACAGAAGG + Intronic
903863893 1:26383701-26383723 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
903960072 1:27051467-27051489 GGGTTGGCCTGGGTGACCAAGGG - Intergenic
904059125 1:27694313-27694335 ACTCTAGCCTGGGGGACAAAAGG - Intergenic
904122160 1:28206501-28206523 ATTCCAGCCGGGGTGACAAAGGG + Intronic
904247721 1:29199649-29199671 ACTCCAGCCTGGGTGACAAAGGG - Intronic
904271599 1:29353886-29353908 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
904461504 1:30683412-30683434 ACTCTAGCCTGAGTGACAAAGGG - Intergenic
904515671 1:31053043-31053065 ATTCCAGCCTGGGTGACAGAGGG - Intronic
904546973 1:31282706-31282728 ACTCCGGCCTGGGTGACAGAGGG - Intronic
904639661 1:31915570-31915592 ATTCCAGCCTGGGTGACAGAGGG - Intronic
904647249 1:31977091-31977113 ATTCTAGCCTGGGTGACAGACGG - Intergenic
905023843 1:34836570-34836592 ATTCCAGCCTGGGTGACAGAGGG - Intronic
905589467 1:39150054-39150076 ACTTCAGCCTGGGTGACAGAGGG - Intronic
905748637 1:40441668-40441690 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
905764705 1:40590760-40590782 ATTCTAGCCTGGGTGACAGAGGG + Intergenic
906115845 1:43356737-43356759 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
906140087 1:43529234-43529256 AATTTGGTTTGGATGACAAACGG - Intronic
906219227 1:44065440-44065462 ACTTCAGCCTGGGTGACAGATGG - Intergenic
906327532 1:44856835-44856857 ACTCTAGCCTGGGTGACAGAGGG - Intronic
908197636 1:61761009-61761031 ACTCCAGCCTGGGTGACAAAGGG - Intronic
908235436 1:62143481-62143503 ACTTCAGCCTGGGTGACAGAGGG - Intronic
908327236 1:63035290-63035312 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
908361777 1:63375167-63375189 ACTTCAGCCTGGGTGACAGAGGG + Intronic
908464537 1:64379144-64379166 TCTTAGGCCTGGGAGACAAAAGG - Intergenic
908491302 1:64646697-64646719 ATTCCAGCCTGGGTGACAGAGGG + Intronic
908505544 1:64794363-64794385 ACTCCAGCCTGGGTGACAAATGG + Intronic
908731945 1:67235424-67235446 ACTCCGGCCTGGGTGACAGAGGG - Intronic
908748112 1:67395233-67395255 ACTTGAGCCTGGGTGACAGAAGG + Intronic
908956333 1:69633459-69633481 ATTCCAGCCTGGGTGACAGAGGG - Intronic
909071247 1:70996497-70996519 ACTTCAGCCTGGGTGACAGAGGG - Intronic
909086696 1:71176872-71176894 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
909443892 1:75726334-75726356 ACTCTAGCCTGGGTGACAGAGGG + Intronic
909753836 1:79197882-79197904 ATTTTGGCATGGCTTATAAAAGG + Intergenic
910023504 1:82621949-82621971 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
910406348 1:86894802-86894824 ATTCTAGCTTGGGTGACAGAGGG + Intronic
910434972 1:87196948-87196970 ATGTTGGGCTGAGTAACAAAGGG + Intergenic
910531915 1:88246919-88246941 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
910858830 1:91723446-91723468 ACTCTAGCCTGGGTGACAGAGGG + Intronic
910891910 1:92027693-92027715 ACTTCAGCCTGGGTGACAAAGGG - Intergenic
910974085 1:92887391-92887413 ACTCTAGCCTGGGTGACAGAGGG + Intronic
911082206 1:93944243-93944265 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
911119585 1:94282317-94282339 ACTCTGGCCTGGGTGACAGAGGG - Intergenic
911124860 1:94331952-94331974 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
911447561 1:98016842-98016864 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
911630982 1:100183267-100183289 ACTTCAGCCTGGGTGACAAAGGG + Intergenic
911787484 1:101969178-101969200 ATTCCAGCCTGGGTGACAGAGGG - Intronic
912045052 1:105443507-105443529 ATTTAGGCCTGGTTTACAGATGG + Intergenic
912371875 1:109179871-109179893 ACTCTAGCCTGGGTGACAAGAGG + Intronic
912787362 1:112617670-112617692 ACTTCAGCCTGGGTGACAAAGGG + Intronic
912840036 1:113031233-113031255 ATTTGGGCCTCTGTTACAAAGGG - Intergenic
914772386 1:150700308-150700330 ATTCCAGCCTGGGTGACAGAGGG - Intronic
914821725 1:151109706-151109728 ATTCTAGCCTGGGCAACAAAGGG - Intronic
914840611 1:151245566-151245588 ATTCTAGCCTGGGTGACAGAGGG - Intronic
914892890 1:151643325-151643347 ATTCCAGCCTGGGTGACAGAGGG - Intronic
915098141 1:153478527-153478549 GTTTTGCCCAGGGTCACAAAGGG - Intergenic
915125509 1:153660815-153660837 ACTCTAGCCTGGGTGACAGAGGG - Intronic
915295832 1:154921120-154921142 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
915314565 1:155021030-155021052 ATTTTAGCCTGGGTGACAGAGGG - Intronic
915368930 1:155331665-155331687 ATTCCAGCCTGTGTGACAAAGGG + Intergenic
915472058 1:156131555-156131577 ACTTCAGCCTGGGTGACAGAGGG + Intronic
915542515 1:156577206-156577228 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
916408386 1:164520409-164520431 ACTCTAGCCTGGGTGACAAAGGG + Intergenic
916427089 1:164691045-164691067 ACTCCAGCCTGGGTGACAAAGGG - Intronic
916483140 1:165233420-165233442 ACTCTAGCCTGGGTGACAGAAGG + Intronic
916525304 1:165603756-165603778 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
916760966 1:167817330-167817352 ACTCCAGCCTGGGTGACAAAGGG + Intronic
916968187 1:169976747-169976769 ATTCTAGCCTGGGTGGCAGAGGG - Intronic
917402974 1:174672311-174672333 ACTCCAGCCTGGGTGACAAAGGG - Intronic
917427456 1:174929713-174929735 ATTCCAGCCTGGGTGACAGAGGG + Intronic
918051864 1:180980585-180980607 ACTCTAGCCTGGGTGACAGAGGG - Intronic
918581508 1:186136141-186136163 ACTCCAGCCTGGGTGACAAAGGG + Intronic
918979395 1:191535931-191535953 ATTTTTGCCTGGGACAGAAAGGG + Intergenic
919121584 1:193347657-193347679 ACTTTGGCCTGGTTGATGAATGG - Intergenic
919394452 1:197027288-197027310 ACTTTAGCCTGGGTGACAGAGGG - Intergenic
919534736 1:198773683-198773705 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
919583027 1:199400894-199400916 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
919842384 1:201618919-201618941 ATTTTAGCCTGGGTGAGAAAGGG - Intergenic
920114164 1:203608208-203608230 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
920144949 1:203851934-203851956 ACTCCAGCCTGGGTGACAAAGGG + Intronic
920206400 1:204295455-204295477 ACTCTAGCCTGGGTGACAGAGGG + Intronic
920291545 1:204927040-204927062 ACTCTGGCCTGGATGACAGAGGG + Intronic
920408524 1:205738875-205738897 ACTCTGGCCTGGGTGAGAGAGGG + Intronic
920515420 1:206581564-206581586 ATTCCAGCCTGGGTGACAGAGGG + Intronic
921093093 1:211861887-211861909 ATTCCAGCCTGGGTGACAAAGGG - Intergenic
921394547 1:214654532-214654554 ATTCCAGCCTGGGTGACAGAGGG + Intronic
921862251 1:220052239-220052261 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
921905344 1:220489906-220489928 ATTCCAGCCTGGGTGACAAAGGG - Intergenic
922277364 1:224091495-224091517 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
922573727 1:226648304-226648326 TCTTTGTCCAGGGTGACAAATGG + Intronic
922974272 1:229770659-229770681 ACTTTAGCCTGGGTGACAGAGGG - Intergenic
923111299 1:230892641-230892663 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
923391740 1:233519392-233519414 ACTTTAGCCTGGGTGACAGAAGG - Intergenic
924023781 1:239812070-239812092 ACTCCAGCCTGGGTGACAAAGGG - Intronic
924055041 1:240116721-240116743 ATTCCGGCCTGGGTGACAGAGGG + Intronic
924228480 1:241943183-241943205 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
924491891 1:244545951-244545973 ATTTGGGCCTGGTTTACAGATGG + Intronic
924545926 1:245027922-245027944 ATTCCTGCCTGGGTGACAGACGG - Intronic
924645601 1:245874626-245874648 CTTTTGGCTTGTGTGACACATGG - Intronic
1063461864 10:6220132-6220154 ACTCTAGCCTGGGAGACAAAGGG - Intronic
1063631664 10:7739854-7739876 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1063918038 10:10904257-10904279 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
1064098229 10:12440315-12440337 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1064150976 10:12864705-12864727 ACTCTGGCCTGGGAGACAGAGGG - Intergenic
1064236596 10:13581862-13581884 ACTGTAGCCTGGGTGACAGAGGG + Intergenic
1064427683 10:15244484-15244506 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1064449550 10:15429506-15429528 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1064630593 10:17306595-17306617 ACTCCGGCCTGGGTGACAGACGG + Intergenic
1064675525 10:17756219-17756241 ACTCTAGCCTGGGTGACAGATGG + Intronic
1064720657 10:18225670-18225692 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1064733700 10:18359302-18359324 ACTCTAGCCTGGGTGACAGAAGG - Intronic
1065000236 10:21331741-21331763 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1065002463 10:21349268-21349290 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1065108324 10:22413498-22413520 ACTCCGGCCTGGGTGACAGAGGG + Intronic
1065159232 10:22901862-22901884 ATTTTAGCCAGGTTGACAACGGG - Intergenic
1065227814 10:23563279-23563301 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1065273065 10:24056293-24056315 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1065277406 10:24098949-24098971 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1065499306 10:26363404-26363426 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1065515270 10:26518278-26518300 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1065550363 10:26863409-26863431 ACTCTAGCCTGGGTGACAGAAGG + Intergenic
1065611941 10:27480319-27480341 ACTCTAGCCTGGGTGACAGAAGG + Intergenic
1065768621 10:29055781-29055803 CTTTAGGACTGGGTGGCAAAAGG - Intergenic
1065928425 10:30457049-30457071 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1066270219 10:33815169-33815191 ACTGCAGCCTGGGTGACAAAGGG + Intergenic
1066420651 10:35261670-35261692 ATTCCAGCTTGGGTGACAAAGGG + Intronic
1067211997 10:44267085-44267107 ATTCCAGCCTGGGTGACAACAGG + Intergenic
1067266109 10:44746695-44746717 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
1068279540 10:54851625-54851647 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1068412843 10:56679795-56679817 TGTTTGGCCTGAGTGACTAAAGG - Intergenic
1068582083 10:58753193-58753215 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1069000240 10:63254884-63254906 ACTTGAGCCTGGGTGACAGAGGG - Intronic
1069044989 10:63733936-63733958 ATTTGGGCCTGAGTGTTAAAGGG + Intergenic
1069400220 10:68036283-68036305 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1069561072 10:69430013-69430035 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1069563810 10:69450292-69450314 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1069730512 10:70608826-70608848 ACTTCAGCCTGGGTGACAAGAGG - Intergenic
1070017514 10:72548727-72548749 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1070118858 10:73556374-73556396 ATTGTTGCCTGGGTGACAGAGGG - Intronic
1070157469 10:73844438-73844460 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1070299645 10:75193902-75193924 ATTCCAGCCTGGGTGACACAGGG - Intergenic
1070636278 10:78130664-78130686 ACTTTAGCCTGGGTGACAGTGGG + Intergenic
1070681697 10:78453425-78453447 ATATGGGCCTTGGTGAGAAAGGG + Intergenic
1070681707 10:78453465-78453487 ATATGGGCCTTGGTGAGAAAGGG + Intergenic
1071305685 10:84297118-84297140 ATTTCAGCCTGGGCGACAGAGGG - Intergenic
1071431124 10:85607848-85607870 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1072071258 10:91920233-91920255 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
1072120413 10:92401149-92401171 ACTTCAGCTTGGGTGACAAAGGG - Intergenic
1072691372 10:97574248-97574270 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1072702723 10:97655603-97655625 ATTCTATCCTGGGTGACAGAGGG - Intronic
1073319089 10:102603192-102603214 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1073589275 10:104740992-104741014 ATTCTAGCCTGGGTGACAGAGGG - Intronic
1074120507 10:110490665-110490687 ATTCTGGCCAGGAAGACAAATGG - Intergenic
1074372271 10:112909642-112909664 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1074462255 10:113648287-113648309 CTTTTTGCCTGGCTGACAGAAGG + Intronic
1074479868 10:113809462-113809484 ACTCTAGCCTGGGTGACAAGAGG + Intergenic
1074535072 10:114323057-114323079 ATCCTGGGCTGGGTGACAGAGGG - Intronic
1074690654 10:116001366-116001388 TTTTTAGCCAGGGAGACAAAGGG - Intergenic
1075705632 10:124498695-124498717 ACTCTAGCCAGGGTGACAAATGG - Intronic
1075759897 10:124847816-124847838 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1075764869 10:124885310-124885332 ACTCTAGCCTGGGCGACAAAAGG + Intergenic
1076292241 10:129354733-129354755 ACTTTAGCCTGGGTGACAGAGGG + Intergenic
1076403785 10:130199511-130199533 ACTTTAGCCTGGGAGACAGAGGG + Intergenic
1076757996 10:132584766-132584788 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1077347121 11:2066568-2066590 ACATTAGCCTGGGTGACTAAGGG + Intergenic
1077582693 11:3426994-3427016 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1077655334 11:4013735-4013757 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1077923837 11:6661332-6661354 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1077943260 11:6867242-6867264 ATTCTAGCCTGGGTGACAGAAGG - Intergenic
1078282509 11:9917362-9917384 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1078746742 11:14122964-14122986 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1078772096 11:14360431-14360453 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1079029350 11:16974232-16974254 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1079035787 11:17018778-17018800 ACTTTAGTCTGGGTGACAGAAGG - Intergenic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1080039734 11:27747132-27747154 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1080373796 11:31684237-31684259 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1080677573 11:34441759-34441781 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1081464862 11:43306950-43306972 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1081480138 11:43478638-43478660 ACTCTCGCCTGGGTGACAGATGG - Intronic
1081657260 11:44865754-44865776 CTTTTAGCCTGGATGACAACTGG - Intronic
1081940001 11:46933083-46933105 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1082033915 11:47628605-47628627 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1082074458 11:47965557-47965579 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1082172296 11:49019943-49019965 ACTTTGGTCTGAGTGACAGAGGG + Intergenic
1082173129 11:49030302-49030324 ATTTCAGCCTGTGTGACAGAAGG + Intronic
1082742692 11:56928100-56928122 ACATTGACCAGGGTGACAAAAGG + Intergenic
1082838708 11:57670435-57670457 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1082949385 11:58794583-58794605 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1082955959 11:58870073-58870095 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1083105927 11:60358794-60358816 ATTTCAGCCTGGGTGACAGAGGG - Intronic
1083378169 11:62243057-62243079 ATTCCAGCCTGGGTGACAAAGGG + Intronic
1083433628 11:62628247-62628269 ATTCTAGCCTGGGTGACAGAGGG - Intronic
1083917733 11:65760583-65760605 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1084091736 11:66883211-66883233 CTTGTGGACTGGGGGACAAAGGG + Intronic
1084239591 11:67809814-67809836 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1084270905 11:68028642-68028664 ACTCCGGCCTGGGTGACAGAAGG + Exonic
1084379689 11:68803676-68803698 ATTCTAGCCTGGGTGACAGAGGG + Intronic
1084387160 11:68851087-68851109 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1084832833 11:71783031-71783053 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1084848378 11:71918749-71918771 AGTTTTACCTGGGTGTCAAAGGG - Intronic
1085094051 11:73744303-73744325 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1085234029 11:74997828-74997850 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1085816580 11:79743638-79743660 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
1086478907 11:87211909-87211931 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1086595936 11:88570610-88570632 ACTCTAGCCTGGGTGACAAAGGG - Intronic
1086692639 11:89805748-89805770 ATTTCAGCCTGCGTGACAGAAGG - Intronic
1086693461 11:89816017-89816039 ACTTTGGTCTGAGTGACAGAGGG - Intergenic
1086713162 11:90033911-90033933 ATTTCAGCCTGCGTGACAGAAGG + Intronic
1087312672 11:96567982-96568004 ATTTTGGACTTTTTGACAAAAGG + Intergenic
1087708762 11:101525214-101525236 ATTTTGGCTTTGGAGTCAAATGG + Intronic
1087941127 11:104098535-104098557 TGTATGGCCTGGGTGACAGAGGG - Intronic
1088069057 11:105758209-105758231 ATTTCAGCCTGGGTGACACAGGG + Intronic
1088669914 11:112130837-112130859 ATTGCAGCCTGGGTGACAAAGGG + Intronic
1088765037 11:112966743-112966765 ATGTTGGCCTGGGTGCCAAATGG + Intronic
1088879207 11:113960245-113960267 ACTCTAGCCTGGGAGACAAAGGG + Intergenic
1089097052 11:115927792-115927814 ATTTTGGCCTAGGAGGCAACAGG + Intergenic
1089273704 11:117318642-117318664 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1089355115 11:117844525-117844547 ATTCTAGCCTGGGCGACACAGGG - Intronic
1089821371 11:121230156-121230178 AGTTTTGCCTGAGTTACAAATGG + Intergenic
1089839858 11:121406669-121406691 ATTTTGAGCTGGGTGTCAGAGGG - Intergenic
1089937761 11:122383328-122383350 ACTCTGGCCTGGGTGTCAGAGGG - Intergenic
1090289219 11:125527415-125527437 ACTCCAGCCTGGGTGACAAACGG - Intergenic
1090521489 11:127484469-127484491 ACGTCGGCTTGGGTGACAAAAGG + Intergenic
1091429883 12:424961-424983 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1091815599 12:3435552-3435574 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1091938721 12:4454906-4454928 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1092209113 12:6635052-6635074 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1092373895 12:7939437-7939459 ACTCTAGCCTGGGTGACAAGAGG + Intergenic
1092531811 12:9351347-9351369 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1093365301 12:18288127-18288149 ACTCTAGCCTGGGTGACAAGAGG + Intronic
1093743337 12:22712857-22712879 ATTCCAGCCTGGGTGACAAGAGG - Intergenic
1093769784 12:23004823-23004845 ATTCCAGCCTGGGTGACACAAGG + Intergenic
1093832818 12:23785047-23785069 ACTCTAGCCTGGGTGACACAGGG + Intronic
1094502683 12:31035232-31035254 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1095423606 12:42050976-42050998 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1095484046 12:42665897-42665919 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1095497015 12:42795681-42795703 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
1095500970 12:42838437-42838459 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1096294892 12:50375682-50375704 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1096992320 12:55815083-55815105 ACTTCAGCCTGGGTGACAAAGGG - Intronic
1097082223 12:56440848-56440870 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1097097325 12:56559925-56559947 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1097252220 12:57641879-57641901 ACTTTGGCCTGGCTAGCAAAAGG - Intergenic
1097406203 12:59193799-59193821 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1097835901 12:64272470-64272492 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1097889793 12:64765977-64765999 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1098124437 12:67275491-67275513 ACTGTGGCCTGGGTGACAGAGGG + Intronic
1098151250 12:67548761-67548783 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1098298443 12:69028603-69028625 ATTTCAGCCTGGGTTACCAAGGG - Intergenic
1098466345 12:70790807-70790829 ATTCCAGCCTGGGTGACAGAAGG + Intronic
1099234801 12:80070853-80070875 ATTCTAGCCTGGGTGACAGAGGG + Intergenic
1099392646 12:82099718-82099740 ACTCAAGCCTGGGTGACAAAGGG - Intergenic
1099554569 12:84095109-84095131 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
1100007881 12:89916098-89916120 ATTTTGTCATTGATGACAAAGGG + Intergenic
1100362403 12:93890789-93890811 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1100460758 12:94797087-94797109 ACTTCAGCCTGGGTGACAGATGG - Intergenic
1100479315 12:94962520-94962542 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1100484178 12:95008833-95008855 ACTGTGGCCTGGGTGACAGAGGG + Intergenic
1100485903 12:95027085-95027107 ATTCTAGCCTGGGTGACAGAGGG - Intronic
1100844762 12:98646055-98646077 ATTTTGTTGTGGGTTACAAAAGG + Intronic
1101247711 12:102900468-102900490 ATTATGCCCGGGCTGACAAATGG + Intronic
1102046768 12:109834307-109834329 ACTTCAACCTGGGTGACAAAGGG - Intergenic
1102166874 12:110813762-110813784 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1102226825 12:111234749-111234771 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1102327885 12:112004315-112004337 ACTCTAGCCTGGGTGACAGAAGG - Intronic
1102498848 12:113337521-113337543 ATTCTAGCCTGGGTGACAGAAGG - Intronic
1102877925 12:116462027-116462049 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1102915024 12:116746202-116746224 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1102928161 12:116842604-116842626 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1103029952 12:117605131-117605153 ATTTTGGCCTCTGTGAGGAATGG + Intronic
1103058460 12:117840129-117840151 ACTCTGGCCTGGGTGACAGAGGG - Intronic
1103081524 12:118027637-118027659 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1103117754 12:118351904-118351926 AGTCTGGCCTGGGTGAAAGAGGG - Intronic
1103129204 12:118452233-118452255 ATTATGGCATGGGTGAAAACCGG - Intergenic
1103444621 12:120986415-120986437 ATATTGGCACAGGTGACAAATGG - Intronic
1103624891 12:122210715-122210737 ATTTTGTACCAGGTGACAAAAGG - Intronic
1104617519 12:130283104-130283126 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1104695369 12:130859564-130859586 ACTCTGGCCTGGGTGATAGAGGG - Intergenic
1104823292 12:131691127-131691149 ACTTTGGCCAGGGTGGGAAAAGG - Intergenic
1105379796 13:19876353-19876375 ATTCCGGCCTGGGTGACAGAGGG - Intergenic
1105850108 13:24327057-24327079 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1105861006 13:24413461-24413483 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1106249550 13:27973054-27973076 ACTGTAGCCTGGGTGACAGAGGG + Intergenic
1106284215 13:28305254-28305276 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1106744498 13:32685676-32685698 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1106758772 13:32847846-32847868 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1107853637 13:44593527-44593549 ACTTCAGCCTGGGTGACACAGGG + Intergenic
1107893615 13:44936641-44936663 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1107978474 13:45713112-45713134 ACTTGGGGCTGGCTGACAAAGGG - Intronic
1108148469 13:47504952-47504974 ATTCTAGCCTGTGTGACAGAGGG - Intergenic
1108443576 13:50482073-50482095 TTTTTTGCCTGGTTGACCAAAGG - Intronic
1108902073 13:55424242-55424264 ACTTCAGCCTGGGTGACAAAGGG - Intergenic
1108964356 13:56277615-56277637 ACGCTGGCCTGGGTGACACAGGG + Intergenic
1109065655 13:57686054-57686076 ACTCTAGCCTGGGTGACACAGGG + Intronic
1109443799 13:62407133-62407155 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1109454434 13:62566088-62566110 ATTCTAGCCTGGGTGACAGAGGG - Intergenic
1109826660 13:67730250-67730272 AGTCTAGCCTGGGTGACAGAGGG + Intergenic
1109993230 13:70086538-70086560 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1110243639 13:73296599-73296621 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
1110719517 13:78745734-78745756 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1110873461 13:80479905-80479927 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1110897102 13:80768120-80768142 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1110933145 13:81248804-81248826 ACTCTGGCCTGGGAGACAGAGGG - Intergenic
1111222804 13:85226848-85226870 ACTGTAGCCTGGGTGACAAGAGG - Intergenic
1111581919 13:90233520-90233542 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1111645630 13:91028367-91028389 ACTCTAGCCTGGATGACAAAGGG + Intergenic
1111799997 13:92969603-92969625 ATTGTGGCATGTGTGACAATTGG - Intergenic
1111854415 13:93619483-93619505 ACTCTATCCTGGGTGACAAAGGG - Intronic
1112004905 13:95245678-95245700 GTTTTGGCCAGGGTGCCAGATGG - Intronic
1112285581 13:98101342-98101364 ATTTCAGCCTGGGCGACAGAGGG - Intergenic
1112322234 13:98418305-98418327 ATTCTATCCTGGGTGACAGAGGG - Intronic
1112346615 13:98595244-98595266 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1112479879 13:99765574-99765596 ATTCCAGCCTGGGTGACACAGGG - Intronic
1112814378 13:103254136-103254158 AATCTAGCCTGGGTGACAGAGGG + Intergenic
1112964256 13:105167418-105167440 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1113024964 13:105930059-105930081 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1113045320 13:106148594-106148616 ACTCCAGCCTGGGTGACAAAAGG + Intergenic
1113097076 13:106677464-106677486 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1113516211 13:110902008-110902030 ACTTTAGCCTGGACGACAAAGGG + Intronic
1114239134 14:20849885-20849907 ACTGTAGCCTGGGTGACAGAGGG - Intergenic
1114258749 14:21023207-21023229 ATTTGGGCATGGGAGTCAAACGG + Intronic
1114273566 14:21120663-21120685 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1114296043 14:21330083-21330105 ACTCTGGCCTGAGTGACAGAGGG + Intronic
1114518527 14:23318203-23318225 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1114726724 14:24945535-24945557 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1114899495 14:27038958-27038980 ATTCCAGCCTGGGTGACAAAGGG + Intergenic
1115136432 14:30114453-30114475 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1115160790 14:30391338-30391360 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1115199614 14:30839059-30839081 ATTTTAGCTTGGGCAACAAAAGG + Intergenic
1115208612 14:30941656-30941678 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1115218726 14:31037917-31037939 ACTCTGGCCTGGGTGACAGAGGG + Intronic
1115327674 14:32160245-32160267 ATTCCAGCCTGGGAGACAAAGGG + Intergenic
1115608557 14:35030320-35030342 ACTTCAGCCTGGGTGACAGAAGG - Intergenic
1116812701 14:49554762-49554784 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1116821015 14:49627820-49627842 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1117030856 14:51668697-51668719 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1117066688 14:52018523-52018545 ATGTTGGGCTGGGTTACAGAGGG + Intronic
1117248770 14:53914551-53914573 GCTTTGGCCTTGGTGACAACTGG - Intergenic
1117352120 14:54891440-54891462 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1117555577 14:56879804-56879826 ACTCCGGCCTGGGTGACAGAGGG + Intergenic
1117595810 14:57326173-57326195 ATTCCAGCCAGGGTGACAAAGGG + Intergenic
1118201132 14:63674322-63674344 ATTCCAGCCTGGGTGACAAGAGG + Intergenic
1118252835 14:64179167-64179189 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1118435113 14:65764043-65764065 AATCTCACCTGGGTGACAAATGG + Intergenic
1118638800 14:67772925-67772947 ACTCTGGCCTGGATGACAGAGGG + Intronic
1118799379 14:69175441-69175463 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1119212899 14:72846141-72846163 ATTCCGGCCTGGGTGACAGAAGG - Intronic
1119447399 14:74677461-74677483 ATTCTAGCCTGTGTGACAAAGGG + Intronic
1119897160 14:78230055-78230077 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1120025910 14:79584135-79584157 ACTTTGGTCAGGGTGACAAATGG + Intronic
1120203830 14:81566971-81566993 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1120434429 14:84462941-84462963 ATTCTACCCTGGGTGACAAAGGG - Intergenic
1121010095 14:90514850-90514872 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1121083432 14:91127087-91127109 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1121219206 14:92273158-92273180 ATTCCAGCCTGGGTGACAAGAGG + Intergenic
1121337894 14:93088370-93088392 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1121610793 14:95277658-95277680 ACTCTGGCCTGGGTGACAGAGGG - Intronic
1121765398 14:96481377-96481399 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1121804908 14:96809603-96809625 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1122028599 14:98896034-98896056 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1122286937 14:100657927-100657949 ACTTTGTCCTGGGTGTGAAAGGG + Intergenic
1122330433 14:100908561-100908583 ACTTTAGCCTGGATGACAGAGGG + Intergenic
1122610464 14:102978972-102978994 ATTCCAGCCTGGGTGACAGAAGG + Intronic
1122645970 14:103194281-103194303 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1123496087 15:20828368-20828390 AGTCTGGCCAGGGTCACAAAAGG + Intergenic
1123553321 15:21401934-21401956 AGTCTGGCCAGGGTCACAAAAGG + Intergenic
1123589566 15:21839322-21839344 AGTCTGGCCAGGGTCACAAAAGG + Intergenic
1124091519 15:26607537-26607559 ATTCCAGCCTAGGTGACAAAGGG + Intronic
1124172774 15:27391053-27391075 ACTCTAGCCTGGGTGACAGATGG + Intronic
1124949425 15:34302915-34302937 ACTTCAGCCTGGGTGACAGACGG + Intronic
1125405266 15:39346472-39346494 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1125634580 15:41176599-41176621 ACTTTAGCCTGGCTGACAGAGGG - Intergenic
1125713025 15:41802504-41802526 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1125992362 15:44121960-44121982 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1126040149 15:44582513-44582535 ACTCTGGCCTGGGCGACAGAGGG + Intronic
1126160100 15:45603680-45603702 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1127066429 15:55244280-55244302 ATTCCGGCCTGGGAGACAGAGGG + Intronic
1127119878 15:55762315-55762337 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1127270178 15:57393959-57393981 ACTCCAGCCTGGGTGACAAAAGG - Intronic
1127305083 15:57697486-57697508 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1127449345 15:59101469-59101491 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1127505884 15:59597367-59597389 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1127515052 15:59685466-59685488 ACTACAGCCTGGGTGACAAAGGG + Intronic
1127764426 15:62171249-62171271 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1127906931 15:63382763-63382785 ATTTCAGCCTGGGCGACAGAGGG - Intergenic
1128059456 15:64725494-64725516 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1128125177 15:65186820-65186842 ACTTCAGCCTGGGTGACAGATGG - Intergenic
1128493110 15:68170671-68170693 ACTCCGGCCTGGGTGACAGAGGG - Intronic
1129017527 15:72481651-72481673 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1129064858 15:72893571-72893593 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1129255540 15:74331995-74332017 ACTCCGGCCTGGGTGACAGAGGG + Intronic
1129621354 15:77149780-77149802 TTTGCAGCCTGGGTGACAAAGGG - Intronic
1129645803 15:77431242-77431264 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1129853357 15:78808267-78808289 ATTCTAGCCTGGGTGACACAGGG - Intronic
1130333655 15:82940698-82940720 ACTCTAGCCTGGGTGACAGAAGG + Intronic
1130344965 15:83034579-83034601 ACTCCGGCCTGGGTGACAGAGGG + Intronic
1131540973 15:93274993-93275015 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1131857216 15:96610009-96610031 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1132199653 15:99942589-99942611 ACTCTAGCCTGGGTGACAATGGG - Intergenic
1132310269 15:100852506-100852528 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1202961669 15_KI270727v1_random:129154-129176 AGTCTGGCCAGGGTCACAAAAGG + Intergenic
1132610859 16:815656-815678 ACTCTGGCCTGGGTGACTAAGGG - Intergenic
1132908071 16:2294034-2294056 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1132927540 16:2438963-2438985 ACTTTGGCCTGGGTGACAGAGGG + Intronic
1132988579 16:2781020-2781042 ACTCTGGTCTGGGTGACAGAAGG - Intergenic
1133035829 16:3033752-3033774 ACTATAGCCTGGGTGACAGAGGG + Intronic
1133118663 16:3592990-3593012 ACTCTAGCCTGGGTGACAAGGGG - Intronic
1133242210 16:4421640-4421662 ACTCCAGCCTGGGTGACAAATGG - Intronic
1133313232 16:4864956-4864978 ATTTTGAGCTGGGTGCTAAAAGG + Intronic
1133351276 16:5102250-5102272 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1133959409 16:10480019-10480041 ATTCTAGCCTGGGTGACAGAGGG - Intronic
1134104112 16:11473081-11473103 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1134236643 16:12471495-12471517 ATTCTGGCCTCAGTGAGAAATGG - Intronic
1134353680 16:13461644-13461666 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1134447799 16:14343990-14344012 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1134449132 16:14353220-14353242 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1134487333 16:14668801-14668823 ACTTCAGCCTGGGTGACAGAGGG + Exonic
1134583222 16:15389326-15389348 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1135132744 16:19866387-19866409 ATCCCAGCCTGGGTGACAAAGGG - Intronic
1135193919 16:20379044-20379066 ACTCTAGCCTGGGTGACAGAAGG - Intronic
1135411905 16:22241604-22241626 ACTTTAGCCTGGGTGACAGAGGG + Intronic
1135645982 16:24162479-24162501 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1135771230 16:25220000-25220022 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1136342178 16:29651500-29651522 ACTGCAGCCTGGGTGACAAAGGG - Intergenic
1137011185 16:35321908-35321930 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1137246303 16:46708485-46708507 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1137266192 16:46870995-46871017 ATTCCAGCCTGGGTGACACAGGG + Intergenic
1137294180 16:47074531-47074553 ACTCCAGCCTGGGTGACAAAAGG + Intergenic
1137481145 16:48852858-48852880 ACTTTGTCCTTGGTGACAAATGG + Intergenic
1137516270 16:49147276-49147298 ACTGTAGCCTGGGTGACAGAAGG + Intergenic
1137519469 16:49179824-49179846 TTCTTGGCCAGGGTAACAAAAGG - Intergenic
1137818852 16:51424599-51424621 ACTCTAGCCTGGGTGACAGATGG - Intergenic
1138366469 16:56482396-56482418 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1138990843 16:62389010-62389032 ACTTTAGCCTGGGTGACAGAGGG + Intergenic
1139116531 16:63961188-63961210 ATTTTGGCTTGGGTGGGGAATGG - Intergenic
1139462873 16:67136613-67136635 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1139508916 16:67415424-67415446 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1139595939 16:67958372-67958394 ACTTTGGCTTGGGTGACTTAGGG - Intronic
1139670106 16:68486967-68486989 AGCTTTGCCTGGCTGACAAAGGG - Intergenic
1139858906 16:70004475-70004497 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1139945651 16:70639923-70639945 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1140053716 16:71506593-71506615 ATTCTAGCCTGGGTGACAGCAGG - Intronic
1140077946 16:71719678-71719700 CTATGGGCCTGGGTGACACAAGG + Intronic
1140123972 16:72105316-72105338 ATTTTGGCCTGGAGGTCAGAAGG - Exonic
1140159111 16:72466717-72466739 ATTTTATCCTGGTTCACAAAAGG - Intergenic
1140267275 16:73431506-73431528 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1140393783 16:74610052-74610074 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1140420367 16:74814215-74814237 ATTTCAGCCTGGGGGACAATTGG + Intergenic
1141010541 16:80393398-80393420 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1141591239 16:85070136-85070158 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1141973501 16:87497848-87497870 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1142003545 16:87678206-87678228 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1142324540 16:89406075-89406097 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1142532111 17:587093-587115 ACTTTAGCCTGGGTGACAGAGGG - Intronic
1142681045 17:1548857-1548879 ACTTTGTCCTGGGAGGCAAATGG - Intronic
1143151290 17:4808737-4808759 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1143222554 17:5274754-5274776 ACTCCGGCCTGGGTGACAGAGGG + Intergenic
1143654184 17:8283848-8283870 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1143854843 17:9841047-9841069 ATTCTAGCCTGGGTGACAGAGGG - Intronic
1143975435 17:10825993-10826015 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1144016833 17:11204193-11204215 ACTCTAGCCTGGGGGACAAAAGG + Intergenic
1144274446 17:13652112-13652134 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1144532269 17:16050864-16050886 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1144805240 17:17961540-17961562 ACTCTAGCCTGGGTGACAGAAGG + Intronic
1145049783 17:19650312-19650334 ACTTCAGCCTGGGTAACAAAGGG - Intronic
1145082192 17:19903245-19903267 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1145202985 17:20963485-20963507 ACTCTGGTCTGGGTGACAGAGGG + Intergenic
1145757383 17:27402647-27402669 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1146031794 17:29372688-29372710 ACTTTAGCCTGAGTGACAGAGGG - Intergenic
1146118289 17:30163712-30163734 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1146169764 17:30623995-30624017 TTTATGGCCTTGGTGACAAATGG - Intergenic
1146318466 17:31827579-31827601 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1146343212 17:32040029-32040051 TTTATGGCCTTGGTGACAAATGG - Intronic
1146375575 17:32291802-32291824 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1146711704 17:35047782-35047804 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1146734083 17:35222411-35222433 ATTCCAGCCTGGGTGACAAGAGG + Intergenic
1146762990 17:35494936-35494958 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1146792111 17:35757116-35757138 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1146828303 17:36044010-36044032 ACTTTAGCCTGGGTGACAGAAGG - Intergenic
1147196352 17:38769422-38769444 TTTTTAACCTGGGTGTCAAATGG + Exonic
1147751936 17:42741250-42741272 ACTCTAGCCTGGGCGACAAAGGG - Intronic
1147805532 17:43127989-43128011 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1147942316 17:44057724-44057746 ATTATAGCCTGGGAGACAGACGG + Intronic
1148086549 17:44997082-44997104 ACTCTAGCCTGGGTGACAAAGGG - Intergenic
1148118739 17:45194582-45194604 ACGTCAGCCTGGGTGACAAAGGG + Intergenic
1148176850 17:45573431-45573453 ATTCCCGCCTGGGTGACAGAGGG + Intergenic
1148294528 17:46489516-46489538 ATTCCCGCCTGGGTGACAGAGGG - Intergenic
1148718393 17:49732370-49732392 ACTCCAGCCTGGGTGACAAAAGG + Intronic
1148909292 17:50931910-50931932 ATTCCAGCCTGGGTGGCAAAAGG + Intergenic
1148956934 17:51361873-51361895 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1149488924 17:57067985-57068007 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1149588351 17:57808834-57808856 ATTTCAGCCTGAGTGACAGAGGG + Intergenic
1149675120 17:58453000-58453022 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1149771343 17:59324299-59324321 ACTCTAGCCTGGGTGACAGACGG - Intergenic
1149784165 17:59421502-59421524 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1149813975 17:59705450-59705472 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1149828474 17:59850644-59850666 ACTATAGCCTGGGTGACAGAGGG + Intergenic
1149922008 17:60668896-60668918 ACTTCAGCCTGGGTGACCAAGGG + Intergenic
1149959860 17:61096522-61096544 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1150025615 17:61671085-61671107 ATTTTGTCCGGGGTGATAATGGG + Intergenic
1150621527 17:66811550-66811572 ACTGTAGCCTGGGTGACAGAAGG + Intergenic
1150703242 17:67466031-67466053 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1150718464 17:67593430-67593452 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1150720004 17:67606367-67606389 ATTTGGGTCTGGGTAAAAAAAGG - Intronic
1150782755 17:68136024-68136046 TTTATGGCCTTGGCGACAAATGG + Intergenic
1150800803 17:68281091-68281113 ACTCTAGCCTGGGTGACAGAAGG + Intronic
1150972891 17:70049887-70049909 ACTCTGGCCTGGGCAACAAAGGG + Intergenic
1151125479 17:71839717-71839739 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1151269315 17:72980988-72981010 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1151314756 17:73314836-73314858 ATTCTAGCCTGGGTAACAGAGGG + Intergenic
1151454996 17:74220817-74220839 ACTCCGGCCTGGGTGACAGAGGG - Intronic
1151463671 17:74270972-74270994 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1151614742 17:75202362-75202384 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1151838438 17:76599769-76599791 ACTCTAGCCTGGGTGACAAGAGG + Intergenic
1151938501 17:77278829-77278851 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1152583028 17:81176957-81176979 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1152726082 17:81946942-81946964 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1153330607 18:3869521-3869543 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1153578616 18:6548926-6548948 TTTTTGGTGTGGGAGACAAAAGG - Intronic
1153700135 18:7684261-7684283 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1154155289 18:11939572-11939594 ACTCTGGCCTGGGTGACAGAGGG - Intergenic
1154472818 18:14721588-14721610 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1155201121 18:23518459-23518481 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1155293372 18:24363672-24363694 ACTCTAGCCTGGGTGACACAGGG - Intronic
1155346865 18:24866140-24866162 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1156330500 18:36117202-36117224 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1156533985 18:37845465-37845487 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1156593753 18:38521997-38522019 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1156675452 18:39522457-39522479 ATTCTGGCCTGGGGGACAGAGGG - Intergenic
1157590221 18:48832202-48832224 ATTCCAGCCTAGGTGACAAAGGG - Intronic
1157901052 18:51518038-51518060 ATTTTTGCCTGTCTGAAAAAGGG + Intergenic
1158127290 18:54115158-54115180 CTTTGTGCCTGGGTGACACATGG - Intergenic
1158598571 18:58837928-58837950 ACTTTAGCCTGGGCGACAGAGGG - Intergenic
1158611899 18:58948598-58948620 ATTCTAGCCTGGGAGACAGAGGG - Intronic
1158651483 18:59291869-59291891 ACTCCGGCCTGGGTGACAGAGGG - Intronic
1158725428 18:59967732-59967754 ATTTCAGCCTGGGTGACAGAGGG - Intergenic
1159200967 18:65183568-65183590 ATTTTTACCTGGGTGAGAGAGGG + Intergenic
1159219248 18:65438320-65438342 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1159347485 18:67225779-67225801 ATTCCGGCCTGGGTGACAAGAGG - Intergenic
1159973459 18:74681266-74681288 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1160090560 18:75822917-75822939 ACTCTAGCCTGGGTGACAGACGG + Intergenic
1160125195 18:76165284-76165306 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1160799677 19:961884-961906 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1161033216 19:2069458-2069480 ACTGTAGCCTGGGTGACAGAGGG + Intergenic
1161047967 19:2146569-2146591 ATTCCAGCCTGGGTGACAGACGG + Intronic
1161376209 19:3940301-3940323 ACTTTAGACTGGGTGACAGAGGG + Intronic
1161417219 19:4154102-4154124 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1161531069 19:4790108-4790130 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1161549805 19:4906007-4906029 ACTCTAGCCTGGGTGACAGAAGG - Intronic
1161601511 19:5186956-5186978 ATTCCAGCCTGGGTGACAAGGGG - Intronic
1161652466 19:5493667-5493689 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1161689347 19:5721946-5721968 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1161710606 19:5845493-5845515 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1161717188 19:5882708-5882730 ACTCTAGCCTGGATGACAAAGGG + Intronic
1161902287 19:7128243-7128265 ATTCTAGCCTGGGCGACAGAGGG - Intronic
1161916570 19:7233016-7233038 ACTTTAGCCTGGGTGACAGAGGG - Intronic
1162071582 19:8155500-8155522 ACTTTAGCCTGGGTGACAGAGGG - Intronic
1162298955 19:9833160-9833182 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1162317452 19:9948268-9948290 ATTCCAGCCTGGGTGACAGACGG + Intergenic
1162350670 19:10147227-10147249 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1162380874 19:10331018-10331040 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1162433971 19:10645597-10645619 ACTGTGGCCTGGGCCACAAAGGG - Intergenic
1162467956 19:10854018-10854040 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1162474075 19:10889345-10889367 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1162492088 19:10998931-10998953 ACTCCGGCCTGGGTGACACAGGG - Intronic
1162506100 19:11086153-11086175 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1162615071 19:11792977-11792999 ATTCTAGCTTGGGTGACAGAGGG + Intergenic
1162676469 19:12302177-12302199 ACTTCAGCCTGGGCGACAAAGGG + Intergenic
1162726647 19:12693856-12693878 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1162821129 19:13224289-13224311 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1163009776 19:14417823-14417845 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1163170248 19:15526130-15526152 ATTCTAGCCTGGGTGACCTAGGG + Intronic
1163253804 19:16142803-16142825 ACTTTAGCCTGGATGACAGAGGG - Intronic
1163464272 19:17457402-17457424 ACTCTAGCCTGGGTGACAGATGG - Intronic
1163599847 19:18242441-18242463 ACTCTGGCCTGGGCAACAAAGGG + Intronic
1163734579 19:18971599-18971621 ACTCCAGCCTGGGTGACAAAAGG + Intergenic
1163751851 19:19082848-19082870 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1163759385 19:19126835-19126857 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1163775226 19:19213394-19213416 ATTGTGGCCTTGGTGACCGATGG - Intronic
1163776558 19:19221856-19221878 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1164083371 19:21879771-21879793 ATCTTGGCCTAGCTTACAAACGG + Intergenic
1164577165 19:29412254-29412276 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1165019449 19:32911617-32911639 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1165163987 19:33837914-33837936 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1165171291 19:33893854-33893876 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1165175922 19:33929702-33929724 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1165371424 19:35408845-35408867 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1165411950 19:35667524-35667546 ACTTCAGCCTGGGTGACAAAGGG - Intronic
1165413577 19:35677491-35677513 ACTGTAGCCTGGGTGACAGAGGG + Intronic
1165846505 19:38821273-38821295 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1165896098 19:39142006-39142028 ACTTCAGCCTGGGTAACAAAGGG - Intronic
1165946001 19:39442733-39442755 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1166573098 19:43811651-43811673 CCTCTAGCCTGGGTGACAAAGGG + Intronic
1166989520 19:46683029-46683051 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1167133597 19:47603491-47603513 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1167341174 19:48917354-48917376 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1167388582 19:49179381-49179403 ATTCCAGCCTGGGTGAGAAAGGG - Intronic
1167839029 19:52098777-52098799 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1167920588 19:52779981-52780003 ACTCCAGCCTGGGTGACAAAAGG + Intronic
1168248936 19:55129908-55129930 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1168264116 19:55212181-55212203 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1168493968 19:56835127-56835149 ACTTGGGCCTGGGTGAGAGATGG - Intronic
1168537660 19:57184757-57184779 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1168564903 19:57414741-57414763 ACTCTGGCCTGGGCGACAGAGGG - Intronic
925642245 2:5996805-5996827 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
925668013 2:6282258-6282280 ATTTAGGACTGGGGCACAAAAGG - Intergenic
926673986 2:15604096-15604118 ATTTTGGAGGGGATGACAAATGG - Intronic
927551878 2:24008657-24008679 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
927631557 2:24778682-24778704 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
927654865 2:24936573-24936595 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
927744933 2:25610141-25610163 ATTTCAGCCTGGGCGACAGAGGG - Intronic
927775429 2:25899238-25899260 ATTCCAGCCTGAGTGACAAAGGG + Intergenic
927837931 2:26415897-26415919 ACTCTAGCCTGGGTGACAGAGGG + Intronic
928142572 2:28743048-28743070 ACTCCGGCCTGGGTGACAGAGGG + Intergenic
928181631 2:29072363-29072385 TTTATGCCCTGGGTGCCAAAGGG - Exonic
928570580 2:32603689-32603711 ACTCTAGCCTGGGTGACAGAGGG + Intronic
928814349 2:35273158-35273180 ATTTCAGCCTGGGTGACAAGAGG + Intergenic
928993060 2:37255975-37255997 ACTTCAGCCTGGGTGACAGAGGG + Intronic
929586334 2:43117188-43117210 ATCCTAGCCTGGGTGACAGAAGG + Intergenic
929643148 2:43601812-43601834 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
930004296 2:46883577-46883599 ACTCTGCCCTGGATGACAAAGGG - Intergenic
930122432 2:47770859-47770881 ACTCCGGCCTGGGTGACAGAGGG - Intronic
930389473 2:50742573-50742595 ACTTCAGCCTGGGTGACAGACGG + Intronic
930836901 2:55803497-55803519 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
930962799 2:57281591-57281613 ATTTTGACCAGAGTGATAAAAGG - Intergenic
931313573 2:61105331-61105353 ATTCCAGCCTGGGTGACAGAGGG + Intronic
931455031 2:62403226-62403248 ATGCTAGCCTGGGTGACAAAGGG - Intergenic
931609342 2:64081840-64081862 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
931769153 2:65482618-65482640 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
932031486 2:68190531-68190553 ACTCTAGCCTGGGCGACAAAAGG + Intronic
932157509 2:69431894-69431916 AATTTTACCTGGGTGATAAAAGG + Exonic
932392232 2:71404682-71404704 ACTTCAGCCTGGGTGACAGAGGG + Intronic
932547699 2:72732178-72732200 CTCTCAGCCTGGGTGACAAAGGG - Intronic
932880170 2:75493956-75493978 GTTTTGGCCTAGGTGAAAAGAGG - Intronic
932939164 2:76141589-76141611 ACTTCAGCCTGGGGGACAAAGGG - Intergenic
933579706 2:84110517-84110539 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
933683728 2:85126362-85126384 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
933697776 2:85232965-85232987 ACTCTAGCCTGGGTGACAGAGGG - Intronic
933746577 2:85576141-85576163 ACTCTAGCCTGGGTGACAGAGGG + Intronic
933862632 2:86485223-86485245 TTTTAGGCCTGGCTGACTAATGG + Intronic
934090366 2:88545761-88545783 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
934614498 2:95762841-95762863 ATGGTGGCCTGGGAGGCAAAGGG - Intergenic
934839810 2:97617740-97617762 ATGGTGGCCTGGGAGGCAAAGGG + Intergenic
935034397 2:99354833-99354855 ACTACGGCCTGGGTGACAGACGG - Intronic
935161257 2:100531453-100531475 AGATGGGCCTGGGGGACAAAAGG + Intergenic
935305350 2:101731716-101731738 ATTCCAGACTGGGTGACAAAGGG + Intronic
935980285 2:108619649-108619671 ACTCTAGCCTGGGTGACAGAGGG + Intronic
936293099 2:111242287-111242309 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
936386160 2:112031058-112031080 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
936588328 2:113778486-113778508 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
936717698 2:115208230-115208252 ACTCTAGCCTGGGCGACAAAGGG - Intronic
936789287 2:116131683-116131705 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
936906725 2:117544690-117544712 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
937324306 2:120980911-120980933 ACTCTAGCCTGGGTGACAGAGGG - Intronic
937520816 2:122711027-122711049 ACTTTAGCCTGGGAGACAGAGGG + Intergenic
937545820 2:123019164-123019186 ACTTTGGCCTATGTGACAAGAGG - Intergenic
937660728 2:124427487-124427509 ACTCTAGCCTGGGTGACAGAGGG - Intronic
937943794 2:127312626-127312648 ACTCTAGCCTGGGTGACAGAGGG + Intronic
938019588 2:127895206-127895228 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
938652682 2:133400210-133400232 ATGTTGCTCTGGGTGACAATGGG - Intronic
938700182 2:133870877-133870899 ACTCCAGCCTGGGTGACAAACGG - Intergenic
938735502 2:134182817-134182839 ACTCTAGCCTGGGCGACAAAGGG - Intronic
938891055 2:135706094-135706116 ACTCCAGCCTGGGTGACAAAGGG + Intronic
938897760 2:135769033-135769055 ATTCCAGCCTGGGTGACAAAGGG - Intronic
939186793 2:138870530-138870552 ATTTGGGTATGGTTGACAAATGG - Intergenic
939310646 2:140470610-140470632 AGTCTGGCCTGGGTGAAAGAGGG + Intronic
939323031 2:140649055-140649077 ATATTGGCCTGAATTACAAAGGG - Intronic
940291034 2:152077696-152077718 ATTCTAGCCTGGGCGACAGAGGG + Intronic
940479240 2:154206749-154206771 ATTCCAGCCTGGGTGACAGAGGG + Intronic
940635750 2:156294571-156294593 ACTTCAGCCTGGGTGACAGAAGG - Intergenic
940714072 2:157198523-157198545 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
940850532 2:158684078-158684100 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
941133635 2:161685573-161685595 ATTCCAGCCTGGGTGACAGAGGG + Intronic
941588568 2:167389876-167389898 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
941882588 2:170496675-170496697 ACTCTAGCCTGGGTGACACAAGG - Intronic
943096509 2:183435735-183435757 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
943244796 2:185433225-185433247 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
943335024 2:186602842-186602864 ACTCTAGCCTGGGTGACAGAGGG + Intronic
943585733 2:189737039-189737061 ACTCTAGCCTGGGTGACAGAGGG + Intronic
943662681 2:190576005-190576027 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
943672908 2:190683141-190683163 ACTCCAGCCTGGGTGACAAAGGG - Intronic
943742148 2:191421503-191421525 ACTCTGACCTGGGTGACAGAGGG - Intronic
943819858 2:192306673-192306695 ACTCTGGCCTGGGTGACAGAGGG + Intergenic
944045775 2:195410140-195410162 ATTATGGCCTGGCTCAAAAATGG + Intergenic
944769276 2:202897299-202897321 GATGTGGCCTGGGTGAAAAAAGG - Exonic
944829615 2:203520297-203520319 ACTCCAGCCTGGGTGACAAAGGG + Intronic
945080001 2:206079103-206079125 ACTTCAGCCTGGGTGGCAAAGGG - Intronic
945277096 2:207999018-207999040 ATTCCAGCCTGGGTGACAGAGGG - Intronic
945295235 2:208163803-208163825 ATTATGACCTTGGAGACAAAGGG + Intergenic
945313253 2:208341038-208341060 ATTCCAGCCTGGGTGACAGAGGG - Intronic
946042093 2:216791222-216791244 ACTCTGGCCTGGGTGACAGAGGG + Intergenic
946301282 2:218825613-218825635 ACTTTAGCCTGAGTGACAGAGGG + Intronic
946814967 2:223567548-223567570 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
947496386 2:230640498-230640520 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
947546033 2:231011038-231011060 AATCCAGCCTGGGTGACAAAAGG + Intronic
947842754 2:233218921-233218943 ACTCCAGCCTGGGTGACAAAGGG + Intronic
947865125 2:233392055-233392077 ACTTCAGCCTGGGTGACAAAGGG - Intronic
948294354 2:236849520-236849542 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
948915416 2:241032315-241032337 ACTCCGGCCTGGGTGACAGAGGG + Intronic
1168777568 20:461395-461417 ACTCCGGCCTGGGTGACAGATGG - Intronic
1168814935 20:729814-729836 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1168986023 20:2049791-2049813 ACTCTAGTCTGGGTGACAAAGGG - Intergenic
1169374135 20:5052823-5052845 ATTTCAGTCTGGGTGACAGAAGG - Intergenic
1169438625 20:5615360-5615382 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1169553681 20:6727190-6727212 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1169955682 20:11100320-11100342 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1170961555 20:21029840-21029862 ACTATGGCCTGAGGGACAAACGG + Intergenic
1171449906 20:25228280-25228302 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1172152392 20:32799550-32799572 ACTCTAACCTGGGTGACAAAGGG - Intronic
1172476920 20:35245791-35245813 TTTTTGGCCCAGGTGACAATTGG - Intronic
1172912933 20:38423382-38423404 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1173091933 20:39980495-39980517 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1173174112 20:40751432-40751454 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1173650962 20:44663821-44663843 AGTCTAGCCTGGGTGACAGAGGG + Intergenic
1173708173 20:45129724-45129746 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1173832034 20:46096292-46096314 ATTCCAGCCTGGGTGACAGATGG - Intergenic
1173848778 20:46204636-46204658 ATCTTGCCCTGGGTCACACAGGG + Intronic
1174013743 20:47471399-47471421 ATTCCAGCCTGGGCGACAAAGGG + Intergenic
1174232773 20:49060150-49060172 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1174247282 20:49191058-49191080 ACTTTAGCCTGGGTGACTGAGGG - Intergenic
1174324071 20:49765057-49765079 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1174484977 20:50855469-50855491 ATTGTGGCCTGGGGGACAGGGGG - Intronic
1174730047 20:52907207-52907229 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1174772310 20:53312046-53312068 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1174881526 20:54284451-54284473 ACTCCAGCCTGGGTGACAAACGG - Intergenic
1175076004 20:56373907-56373929 ACTTCAGCCTGGGTGACAGAAGG + Intronic
1175588122 20:60162550-60162572 ATGTTGGCCAGTGTGGCAAATGG + Intergenic
1176801668 21:13436267-13436289 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1177091996 21:16780706-16780728 ACTATAGCCTGGGTGACAGAGGG + Intergenic
1177782252 21:25633904-25633926 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1177838856 21:26214750-26214772 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1178118208 21:29439079-29439101 ATTCCAGCCTGGGTGACAGAAGG + Intronic
1178285921 21:31325252-31325274 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1178368143 21:32004800-32004822 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1178421551 21:32447334-32447356 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1178426328 21:32481791-32481813 ATTTTTGGCTGGTTGAAAAAAGG - Intronic
1178430064 21:32511005-32511027 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1178515447 21:33243114-33243136 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1179246687 21:39639510-39639532 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1179532940 21:42032569-42032591 ACTCTAGCCTGGGTGACAAGAGG - Intergenic
1179559610 21:42206315-42206337 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1179719454 21:43306957-43306979 ATGATGGCCTGGTTGTCAAAGGG + Intergenic
1179945848 21:44674693-44674715 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1180257334 21:46641089-46641111 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1180730484 22:17978544-17978566 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1181146781 22:20854151-20854173 ATTCTGGCTTGGGCGACAAACGG - Intronic
1181951650 22:26558012-26558034 ACTCTGGCCTGGTTGACAGAGGG + Intronic
1182170070 22:28219473-28219495 ACTCTGGCCTGGGTGACAGAGGG + Intronic
1182171486 22:28234403-28234425 ACTGTAGCCTGGGTGACAGAGGG - Intronic
1182220367 22:28753803-28753825 ACTTCGGCCTGGGTGACACAGGG + Intronic
1182462721 22:30493969-30493991 ACTCCGGCCTGGGTGACAGAGGG + Intronic
1182571036 22:31238080-31238102 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1182606199 22:31506017-31506039 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1182738620 22:32549284-32549306 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1182763555 22:32742325-32742347 ATTCTGGGCTGTGTGACTAAGGG - Intronic
1182864530 22:33591991-33592013 ACTTCAGCCTGGGTGACAAAGGG + Intronic
1182970932 22:34575833-34575855 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1183411937 22:37659814-37659836 ATCTCTGCCTGGGTGAGAAATGG + Intronic
1183560959 22:38572561-38572583 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1183824659 22:40376012-40376034 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1184056039 22:42050258-42050280 CTTCTAGCCTGGGTGACAGAGGG + Intronic
1184147199 22:42618673-42618695 ACTCCAGCCTGGGTGACAAAGGG + Exonic
1184164403 22:42719420-42719442 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1184225131 22:43125339-43125361 ATTAGGGGCTGGGTAACAAAAGG - Intronic
1184461033 22:44638150-44638172 CCTCTAGCCTGGGTGACAAAGGG + Intergenic
1184790607 22:46697481-46697503 ATTTCAGCCTGGGCGACATAGGG - Intronic
1185142668 22:49111912-49111934 ACTCCGGCCTGGGTGACACAGGG + Intergenic
949110877 3:258964-258986 ACTCCAGCCTGGGTGACAAAGGG - Intronic
949278540 3:2318679-2318701 ACTCTGGCCTGGGTGACAGTGGG - Intronic
949314522 3:2737111-2737133 ACTTCAGCCTGGGTGACAGAGGG - Intronic
949470718 3:4393363-4393385 ATTGTGGCCTGGGTGACACAGGG - Intronic
949515280 3:4801729-4801751 ACTCCAGCCTGGGTGACAAAGGG + Intronic
949561380 3:5205820-5205842 ATTTTGATCTGGGTGACTAATGG - Intronic
949631394 3:5931168-5931190 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
949704638 3:6802331-6802353 TTTTCAGCCTGGGTGACAGAGGG + Intronic
949976238 3:9463050-9463072 ACTCTAGCCTGGGTGACAGAGGG - Intronic
950021124 3:9788570-9788592 ATTCCAGCCTGGGTGACAGAAGG - Intronic
950070312 3:10146920-10146942 AATTTGGCCAGGGAAACAAAAGG - Intronic
950514845 3:13458191-13458213 ACTTTAGCCTGGGTGACAGGAGG - Intergenic
950709799 3:14806018-14806040 ATTTTCTTCTAGGTGACAAAAGG + Intergenic
950779284 3:15377136-15377158 ACTCTAGTCTGGGTGACAAAAGG + Intergenic
951108057 3:18768740-18768762 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
951349321 3:21586171-21586193 ATTCCAGCCTGGGTGACAGAGGG + Intronic
951779834 3:26350093-26350115 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
951818262 3:26779813-26779835 ATTCCAGCCTGGGTGACACAGGG + Intergenic
951903969 3:27685319-27685341 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
951998649 3:28759370-28759392 ATTTTGGACTGGGTGGCAAATGG + Intergenic
952322789 3:32293810-32293832 ACTCTAGCCTGGGTGACAGAGGG + Intronic
953200565 3:40774780-40774802 ATTCTGCCCTGGGAAACAAAGGG + Intergenic
953254013 3:41271947-41271969 ACTCCAGCCTGGGTGACAAAGGG - Intronic
953325404 3:42008555-42008577 ATTCCAGCCTGGGTGACAGAAGG - Intergenic
953935804 3:47041171-47041193 ATTTTGACCTGTGGGCCAAATGG + Intronic
954027941 3:47797865-47797887 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
954046328 3:47934333-47934355 ATTCCAGCCTGGGAGACAAAAGG - Intronic
954166335 3:48761247-48761269 ACTCTAGCCTGGGTGACAGAGGG + Intronic
954188725 3:48940760-48940782 ACTTCAGCCTGGGTGATAAAGGG + Intronic
954265008 3:49465079-49465101 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
954566375 3:51603571-51603593 ACTCTGGCTTGGGTGACAGAAGG + Intronic
954765501 3:52912211-52912233 ATTGTAGCCTGGGTGACAGAGGG - Intronic
954939615 3:54359498-54359520 GCTTAGGCCTGGATGACAAAGGG + Intronic
955461020 3:59183277-59183299 ATTCTAGCCTGGGTGACAGAGGG - Intergenic
956315009 3:67925368-67925390 ACTGCAGCCTGGGTGACAAAAGG + Intergenic
956656193 3:71554318-71554340 ATTCCAGCCTGGGTGACAGAGGG + Intronic
956656754 3:71559812-71559834 ATTCCAGCCTGGGTGACAGAAGG + Intronic
957581075 3:82074116-82074138 GTTTTGGCCTGGGAAATAAAGGG + Intergenic
958665267 3:97128904-97128926 ACTTCAGCCTGGGTGACAAAGGG - Intronic
959068247 3:101678693-101678715 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
959767215 3:110046160-110046182 ACTCTAGCCTGGGTGATAAAGGG - Intergenic
960100751 3:113740392-113740414 ACTCTAGCCTGGGTGACAGAGGG - Intronic
960347066 3:116546000-116546022 ATTCCAGCCTGGGTGACAGAGGG + Intronic
960656539 3:120010722-120010744 ATTTTGGCCTGGGTGACAAAGGG + Intronic
960904407 3:122585312-122585334 ACTCTGGCCTGGGTGACAGAGGG + Intronic
961299303 3:125912092-125912114 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
961882157 3:130069628-130069650 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
961911923 3:130326604-130326626 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
962132713 3:132698923-132698945 ACTTCAGCCTGGGTGACAGAGGG - Intronic
962164619 3:133036418-133036440 AGTTTGGCATGGTTAACAAAAGG + Intergenic
962526910 3:136245236-136245258 ATTACAGCCTGGGTGACAGAAGG + Intergenic
962534558 3:136316185-136316207 ATTCCAGCCTGGGTGACAGAGGG + Intronic
962568395 3:136687767-136687789 AATCTAGCCTGGGCGACAAAGGG - Intronic
962779380 3:138697466-138697488 ATTCTAGCCTGGGTGACAGAGGG - Intronic
963805401 3:149716347-149716369 ACTACAGCCTGGGTGACAAAGGG + Intronic
964029903 3:152125195-152125217 ACTTTGGCCTGGGAAACAAGAGG + Intergenic
964106719 3:153047788-153047810 ACTACAGCCTGGGTGACAAAAGG + Intergenic
964589899 3:158349728-158349750 ACTCCAGCCTGGGTGACAAAGGG - Intronic
964999851 3:162939999-162940021 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
965055604 3:163710401-163710423 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
965742114 3:171886380-171886402 ACTCTGGCCTGGGAGACAGAGGG + Intronic
966025047 3:175268969-175268991 ATTTCAGCCTGGGTGACAGAGGG - Intronic
966372982 3:179267750-179267772 ACTCCGGCCTGGGTGACAGAGGG - Intergenic
966696776 3:182797673-182797695 ACTCTAGCCTGGGTGACAGAGGG + Intronic
966730243 3:183144870-183144892 ACTTCAGCCTGGGTGACAGAGGG + Intronic
966801012 3:183764033-183764055 ATTTCAGCCTGGGTGACAGAGGG + Intronic
966835117 3:184043791-184043813 ATTTCAGCCTGTGTGAAAAATGG - Intergenic
967165193 3:186773865-186773887 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
967327985 3:188261179-188261201 ATTCCAGCCTGGATGACAAAGGG - Intronic
967383719 3:188889075-188889097 ATGTTAGCCTGAGAGACAAAAGG - Exonic
967468664 3:189837681-189837703 ACTTCAGCCTGGGTGACAGAAGG - Intronic
967997002 3:195174369-195174391 ACTCTAGCCTGGGTGACCAAGGG - Intronic
968095922 3:195930843-195930865 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
968147365 3:196310766-196310788 ATTCCAGCCTGGGTGACAGAGGG - Intronic
968806661 4:2777749-2777771 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
968927010 4:3554595-3554617 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
969299416 4:6288877-6288899 TTCCTGGCCTGGGTGACAAAGGG + Intronic
969618438 4:8267009-8267031 ATTTCGGGCAGGGTGACAAGCGG + Intergenic
969815996 4:9687941-9687963 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
969949479 4:10819638-10819660 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
969963246 4:10968264-10968286 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
970023518 4:11595581-11595603 ATTTTGGCATGTCTGACAAATGG + Intergenic
970125591 4:12806490-12806512 ATTTTGTCCTTGTTGGCAAAGGG - Intergenic
970429717 4:15977629-15977651 ATTCCAGCCTGGGTGACAGAGGG - Intronic
971941377 4:33220140-33220162 ATTCCAGCCTGGGTGACAAAAGG - Intergenic
972648544 4:40993414-40993436 ACTTCAGCCTGGGAGACAAAGGG - Intronic
973676747 4:53271493-53271515 ACTTCAGCCTGGGTGACAGAGGG - Intronic
973767130 4:54173038-54173060 ACTCCTGCCTGGGTGACAAAAGG - Intronic
973891870 4:55375637-55375659 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
973908668 4:55556864-55556886 ACTCTAGCCTGGGTGACAGAGGG - Intronic
974058034 4:57003808-57003830 ACTCCAGCCTGGGTGACAAAGGG + Intronic
975114758 4:70667596-70667618 ACTCTAGCCTGGGTGACAGAGGG + Intronic
975580234 4:75900442-75900464 TTTTTGTCCTTGGTGACAAAAGG - Intronic
975705907 4:77111750-77111772 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
975859065 4:78656646-78656668 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
976242393 4:82972085-82972107 ATTCTAGCCTGGGTGACTGAGGG - Intronic
976514608 4:85950702-85950724 ACTCTGGCCTGGGTGACAGAGGG - Intronic
976715096 4:88115314-88115336 ATTCCAGCCTGGGTGACAGAGGG - Intronic
976833414 4:89341749-89341771 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
976866184 4:89729892-89729914 ATTCTAGCCTGGGTGACAGAGGG + Intronic
977337287 4:95715332-95715354 ACTTTGGCCTGGTTTACAGATGG - Intergenic
977701363 4:100026901-100026923 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
977776639 4:100928796-100928818 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
977791259 4:101106325-101106347 ATTGTAGCCTGGGTGACAGAGGG + Intronic
978164057 4:105585762-105585784 ACTTCAGCCTGGGTGACAGAAGG - Intronic
978509468 4:109500682-109500704 ACTCTAGCCTGGGTGACAGAAGG - Intronic
978798175 4:112729163-112729185 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
978930394 4:114303623-114303645 ACTACAGCCTGGGTGACAAAGGG + Intergenic
979290303 4:118972409-118972431 ATTCCAGCCTGGCTGACAAAGGG + Intronic
979902558 4:126240982-126241004 ATTCCAGCCTGGGTGACAAGAGG + Intergenic
980406473 4:132358812-132358834 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
980492075 4:133541388-133541410 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
981592060 4:146375171-146375193 ACTCCGGCCTGGGTGACAGAGGG + Intronic
982074319 4:151723326-151723348 AGTTTGGTCAGGGTGACACATGG + Intronic
982713275 4:158780173-158780195 ACTCTAGCCTGGGTGACAGAGGG + Intronic
982764984 4:159335801-159335823 ATTACAGCCTGGGTGACAGAGGG + Intronic
982776672 4:159448836-159448858 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
982822738 4:159964339-159964361 ATTTGTGCCTGGATGACCAATGG - Intergenic
983157752 4:164372040-164372062 ATTCCAGCCTGGGTGACAGAGGG + Intronic
983200846 4:164859222-164859244 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
983600927 4:169526456-169526478 AATTTAACCTGGGTGACAGAGGG + Intronic
983611374 4:169648992-169649014 ATTCCAGCCTGGGTGATAAAGGG + Intronic
983941801 4:173541138-173541160 TATTTGTGCTGGGTGACAAACGG + Intergenic
984152098 4:176146264-176146286 ATTCCAGCCTGGGTGACAGAGGG - Intronic
984482215 4:180319861-180319883 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
984815116 4:183828991-183829013 AGTTTGGCTTGGGTGCCAACCGG + Intergenic
985094783 4:186402668-186402690 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
986977281 5:13409344-13409366 ATTTTGACCAGAGTGACTAAAGG + Intergenic
987270550 5:16303966-16303988 ATTTTTGCCTAGATAACAAAAGG - Intergenic
987633253 5:20504798-20504820 ACTCCAGCCTGGGTGACAAAGGG - Intronic
987671694 5:21018156-21018178 ACTTTAGCCTGGGTAACAGAGGG - Intergenic
987937024 5:24479756-24479778 ACTCCGGCCTGGGTGACAGAGGG + Intergenic
988008933 5:25458073-25458095 AATTGGGGCTGGGTGCCAAAGGG + Intergenic
988297077 5:29379324-29379346 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
988475140 5:31578106-31578128 ATTCCAGCCTGGGTGACAGAAGG - Intergenic
988550733 5:32198607-32198629 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
989031709 5:37126204-37126226 ATTCCAGCCTGGGTGACAGAGGG + Intronic
989411184 5:41121786-41121808 ATTCTAGCCTGGGTGACAGAGGG - Intergenic
990048296 5:51462263-51462285 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
990405256 5:55483637-55483659 ACTCTAGCCTGGGTGACAAAGGG + Intronic
990410726 5:55538192-55538214 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
990806764 5:59671772-59671794 ACTCCAGCCTGGGTGACAAAGGG + Intronic
991333861 5:65524646-65524668 ATTCCAGCCTGGGTGACACAGGG + Intronic
991689684 5:69214117-69214139 ACTTCAGCCTGGGGGACAAAGGG - Intergenic
992458178 5:76935807-76935829 ACTTCAGCCTGGGTGACAACTGG - Intergenic
992618216 5:78566494-78566516 ACTTCAGCCTGGGTGACAGAGGG - Intronic
992707472 5:79411450-79411472 ACTCCAGCCTGGGTGACAAAGGG + Intronic
993273503 5:85825997-85826019 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
993511601 5:88777935-88777957 ACTCCAGCCTGGGTGACAAAGGG - Intronic
994111994 5:96016867-96016889 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
994168539 5:96633710-96633732 ACTTTGTCCTGGGTGAAGAAAGG - Intronic
994328579 5:98479024-98479046 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
994357426 5:98809589-98809611 ACTTTAGCCTGGGTGACAGCGGG + Intergenic
994363338 5:98881540-98881562 ACTTCAGCCTGGGTGACAGAAGG - Intronic
994577174 5:101593073-101593095 ACTCTGGCCTGGGTGACAGAGGG + Intergenic
995139843 5:108722743-108722765 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
995455064 5:112342510-112342532 AAATTGGCCTGGCTGATAAAAGG - Intronic
995555571 5:113324863-113324885 ACTCTAGCCTGGGTGACAGAGGG - Intronic
995759435 5:115548000-115548022 ACTCTAGCCTGGGTGACAACAGG - Intergenic
995795731 5:115939729-115939751 ACTCCGGCCTGGGTGACAGAGGG - Intergenic
995842862 5:116460816-116460838 ATTCCAGCCTGGGTGACAGAGGG - Intronic
996526547 5:124486346-124486368 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
996557332 5:124792521-124792543 CTCTTGGCCTGGGTGACAGAGGG - Intergenic
996561367 5:124833111-124833133 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
996748462 5:126866348-126866370 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
997117582 5:131141883-131141905 ATTGCAGCCTGGGTGACAGAGGG + Intergenic
997144110 5:131413462-131413484 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
997315001 5:132925140-132925162 ACTCCAGCCTGGGTGACAAAGGG + Intronic
997447136 5:133948723-133948745 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
997581521 5:135020168-135020190 ATTCCGGCCTTGGTGACAATAGG + Intergenic
998125456 5:139617148-139617170 ACTCTAGCCTGGGTGACAGAGGG + Intronic
998154662 5:139777848-139777870 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
998271526 5:140710746-140710768 ACTGCGGCCTGGGTGACAGAGGG + Intergenic
998300054 5:141009409-141009431 ATTTCAGCCTGGGTGACAGAGGG + Intronic
998996947 5:147876346-147876368 ATGTTGGCCTGTGTGGCACAGGG + Intronic
999164941 5:149541183-149541205 ACTCTGGCCTGGGTGACAGATGG - Intronic
999413112 5:151369825-151369847 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
999746235 5:154594546-154594568 ATTCTAGCCTGGGCGACAGAGGG + Intergenic
999796125 5:154991311-154991333 ACTGTAGCCTGGGTGACAGAGGG + Intergenic
1000011114 5:157234011-157234033 ATGCTAGCCTGGGTGACAGAGGG - Intronic
1000091042 5:157929939-157929961 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
1000668593 5:164030765-164030787 TTTTTTGCCTGGTTGACTAATGG - Intergenic
1000932493 5:167268626-167268648 ACTGTGGCCTGGGGGTCAAATGG + Intergenic
1001084369 5:168690167-168690189 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1001417891 5:171560706-171560728 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1001482697 5:172099506-172099528 ACTTCAGCCTGGGTGACAAAGGG + Intronic
1001507081 5:172288255-172288277 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1001528867 5:172448381-172448403 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1001625288 5:173127193-173127215 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1001671681 5:173478954-173478976 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1002052963 5:176582051-176582073 ACTGCAGCCTGGGTGACAAAGGG - Intronic
1002118148 5:176981175-176981197 AGTCTAGCCTGGGTGACAGAGGG - Intronic
1002122116 5:177013046-177013068 ACTCTAGCCTGGGTGACAGACGG + Intronic
1002548431 5:179968631-179968653 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1003423769 6:5982761-5982783 ATCCTAGCCTGGGTGACAGAGGG + Intergenic
1004201215 6:13549690-13549712 ATTTTTGCCTGGATAACTAAGGG - Intergenic
1004573909 6:16874229-16874251 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1004651385 6:17613145-17613167 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1004741663 6:18467671-18467693 ACTCCGGCCTGGGTGACAAAGGG - Exonic
1004775205 6:18836428-18836450 ACTCCGGCCTGGGTGACAGAAGG + Intergenic
1004938966 6:20535962-20535984 ACTCTGGCCTGGGTGGCATAGGG - Intronic
1005023960 6:21445165-21445187 AGTTTGGCCAGGGAGAGAAATGG - Intergenic
1005248877 6:23920903-23920925 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1005585250 6:27270037-27270059 ACTTCAGCCTGGGTGACAAGAGG + Intergenic
1005982474 6:30846784-30846806 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1006021981 6:31122744-31122766 ACTCCAGCCTGGGTGACAAAAGG + Intronic
1006140337 6:31925323-31925345 ACTTCAGCCTGGGTGACATAGGG - Intronic
1006225577 6:32534339-32534361 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1006318099 6:33302676-33302698 ACTCCAGCCTGGGTGACAAAAGG - Intronic
1006539140 6:34725340-34725362 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1006591219 6:35159281-35159303 ATTCTAGCCTGGGTAACAGAGGG - Intergenic
1006633224 6:35444033-35444055 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1007578572 6:42941515-42941537 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1007673752 6:43578046-43578068 ACTTCAGCCTGGGTGACAGACGG + Intronic
1007680834 6:43632292-43632314 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1007826776 6:44606749-44606771 ATATTGGCCTGAGTGATAATAGG + Intergenic
1007854503 6:44840805-44840827 ATTTCAGCCTGGGTGGCTAAAGG - Intronic
1008117191 6:47565630-47565652 ATTTTGGCCTGAGTAAAAGAAGG - Intronic
1008249842 6:49226537-49226559 AGTCCGGCCTGGGCGACAAAGGG - Intergenic
1009498433 6:64380182-64380204 ATTTTGGCTTGAGTACCAAAAGG + Intronic
1009971835 6:70632873-70632895 ACTGTAGCCTGGGTGACAGAGGG + Intergenic
1010850127 6:80764680-80764702 ATTTTCTCCTGGGTAACAAGAGG - Intergenic
1011054511 6:83191924-83191946 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1011130716 6:84049390-84049412 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1011282032 6:85687195-85687217 ACTTCAGCCTGGGTGACACAGGG - Intergenic
1011357121 6:86483124-86483146 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1011658114 6:89570111-89570133 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1011725971 6:90211092-90211114 ACTGTAGCCTGGGTGACAGAGGG + Intronic
1011878304 6:91990731-91990753 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1012281429 6:97332320-97332342 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1012568017 6:100684837-100684859 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1013239313 6:108228665-108228687 ATTTCAGCCTGGGTGACAGAGGG + Intronic
1014019911 6:116575117-116575139 ACTTTAGCCTGGGCAACAAAGGG - Intronic
1014051547 6:116961467-116961489 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1015168418 6:130224649-130224671 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1015530255 6:134214545-134214567 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1015985247 6:138877882-138877904 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1016414327 6:143817114-143817136 ATTTTGGGTTGGATAACAAAGGG - Intronic
1016436225 6:144040494-144040516 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1016451663 6:144189054-144189076 ACTTCAGCCTGGGTGACAAAGGG - Intergenic
1017069528 6:150562008-150562030 ACTTCAGCCTGGGTGACAGAAGG + Intergenic
1017545494 6:155447076-155447098 ACTCTGGCCTGGGTGACAGAGGG - Intronic
1018003155 6:159597300-159597322 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1018016589 6:159718023-159718045 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1018437449 6:163775688-163775710 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1018796972 6:167193530-167193552 ACTCCGGCCTGGGTGACACAGGG + Intronic
1019349281 7:546180-546202 ATTCCAGCCTGGGTGGCAAATGG + Intergenic
1019378454 7:708823-708845 ACTCTGGCCTGGGCGACAGAGGG - Intronic
1019453433 7:1111767-1111789 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1019678117 7:2327893-2327915 ACTCCAGCCTGGGTGACAAATGG - Intronic
1020033810 7:4951630-4951652 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1020198839 7:6063512-6063534 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1020199666 7:6069709-6069731 ATTCTAGCCTGGGCGACAGAGGG + Intergenic
1020222991 7:6255794-6255816 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1020271028 7:6596082-6596104 ATTCTAGCCTGGGCGACAGAGGG - Intronic
1020432193 7:8125802-8125824 TTGTTGGCCTGAGTAACAAATGG + Intronic
1020480609 7:8655350-8655372 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1020537640 7:9421848-9421870 ACTTTGGCCTGGGTGATAAAAGG - Intergenic
1020661947 7:10993974-10993996 ACTTTGGCCTGGGTGACAGAGGG + Intronic
1020675797 7:11183487-11183509 ATTCTGGCTTGGGTGACAATTGG - Intergenic
1021414788 7:20370641-20370663 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1021651264 7:22836026-22836048 ACTCCAGCCTGGGTGACAAACGG + Intergenic
1021719051 7:23488445-23488467 ACTCTGGTCTGGGTGACAGATGG + Intergenic
1022836118 7:34116955-34116977 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1023063466 7:36351911-36351933 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1023426517 7:40042814-40042836 ATTCCAGCCTGGGTGACAGAAGG - Intronic
1023783165 7:43677766-43677788 ACTCTAGCCTGGGTGAGAAAGGG + Intronic
1023823543 7:43993582-43993604 ATGGCAGCCTGGGTGACAAAGGG - Intergenic
1023864065 7:44230497-44230519 ACATTGGCCTGGGTGAGCAAGGG + Intronic
1023902409 7:44492469-44492491 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1024267196 7:47615871-47615893 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1024451156 7:49544456-49544478 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1024630893 7:51246245-51246267 ATTTGGACCAGGGAGACAAATGG + Intronic
1024793417 7:52993318-52993340 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1025140536 7:56459829-56459851 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1025608941 7:63059688-63059710 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1025677550 7:63655376-63655398 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1025699187 7:63801012-63801034 ATTCTAGCCTGGGCGACAGAGGG - Intergenic
1025721174 7:64016169-64016191 ACTGCAGCCTGGGTGACAAAGGG - Intergenic
1025899582 7:65732900-65732922 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1025937513 7:66049090-66049112 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1025990731 7:66494650-66494672 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1026034236 7:66819621-66819643 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1026074334 7:67152632-67152654 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1026521440 7:71121590-71121612 ATTCTAGCCTGGGTGACAGAGGG + Intergenic
1026525987 7:71153873-71153895 ATTCCAGCCTGGGTGACAAAGGG + Intronic
1026601241 7:71778930-71778952 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1026667991 7:72360759-72360781 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1026985369 7:74551901-74551923 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1027174596 7:75895264-75895286 ATTCCAGCCTGGGTGACAAAGGG - Intergenic
1027213390 7:76167639-76167661 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1027315050 7:76980438-76980460 ACTGCAGCCTGGGTGACAAAGGG + Intergenic
1027356612 7:77362452-77362474 ATTCCAGCCTGGGTGACAAAGGG + Intronic
1027552945 7:79621906-79621928 ATTCCAGCCTGGGTGACAAAGGG - Intergenic
1027725011 7:81793553-81793575 ACTCTGGCCTAGGTGACAAAGGG - Intergenic
1029051452 7:97692941-97692963 ACTCCGGCCTGGGTGACACAGGG + Intergenic
1029094561 7:98074734-98074756 ACTCGAGCCTGGGTGACAAAGGG + Intergenic
1029096523 7:98089293-98089315 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1029180192 7:98695122-98695144 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1029498675 7:100913858-100913880 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1029604796 7:101592013-101592035 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
1029644615 7:101845973-101845995 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1029751808 7:102547036-102547058 ATGGCAGCCTGGGTGACAAAGGG - Intronic
1029769760 7:102646127-102646149 ATGGCAGCCTGGGTGACAAAGGG - Intronic
1030029189 7:105353370-105353392 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1030212274 7:107008307-107008329 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1030335165 7:108317874-108317896 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1030501486 7:110364705-110364727 ATTTTGACCAGAGTGACTAAAGG - Intergenic
1031842305 7:126758928-126758950 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1032106530 7:129035984-129036006 ATTCCTGCCTGGGTGACAGAAGG - Intronic
1032136278 7:129281527-129281549 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1032269347 7:130389299-130389321 AGTGTAGCCTGGGTGACAGAGGG + Intergenic
1032421355 7:131782460-131782482 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1032516953 7:132513703-132513725 ACTCTAGCCTGGGTGACAGATGG - Intronic
1033209328 7:139449071-139449093 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1033255932 7:139801794-139801816 ACTCTAGCCTGGGTGACAAAAGG - Intronic
1033351098 7:140562627-140562649 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1033403786 7:141052549-141052571 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1034126732 7:148678320-148678342 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1034869779 7:154673907-154673929 ACTCCGGCCTGGGTGACAGAGGG - Intronic
1035989681 8:4475647-4475669 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1036515130 8:9436818-9436840 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1036864904 8:12387863-12387885 AATGTGAGCTGGGTGACAAATGG + Intergenic
1036968668 8:13329412-13329434 ATTCTGGCCTGTGGGATAAATGG + Intronic
1037031450 8:14111019-14111041 ATTCTAGCCTGGGCAACAAACGG + Intronic
1037304504 8:17491323-17491345 CTTTTTGTCTGGGTCACAAAAGG + Intergenic
1037508277 8:19554883-19554905 ATTGCAGCCTGGGTGACAGAGGG + Intronic
1037937271 8:22923532-22923554 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1037972405 8:23182227-23182249 ACTCCAGCCTGGGTGACAAATGG + Intergenic
1037996403 8:23355640-23355662 ATTCCAGCCTGGGTGACAACAGG - Intronic
1038135670 8:24782965-24782987 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1038189310 8:25304610-25304632 ATTTTGGCATTGCTGACACAAGG - Intronic
1038698536 8:29827990-29828012 GCTATGGCCTGGGTGACAATGGG - Intergenic
1038767155 8:30439686-30439708 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1038784031 8:30594288-30594310 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1038807269 8:30806078-30806100 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1038833606 8:31092975-31092997 ACTCTAGCCTGGGTGACAGAAGG - Intronic
1039970203 8:42315691-42315713 ACTCTAGCCTGGGTGACAAGAGG - Intronic
1040026972 8:42790664-42790686 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1040112348 8:43572087-43572109 ATTCTGGCCTGGGGGACACAGGG + Intergenic
1040414909 8:47187548-47187570 ATTCTGGCCTTAGTGACAAGAGG + Intergenic
1040885317 8:52256393-52256415 ATTTCAGCCTGTGTGACAGAGGG - Intronic
1041118363 8:54562639-54562661 ACTCTAGCCTGGGTGACAAGAGG + Intergenic
1041260570 8:56017861-56017883 ATTCTAGCCTGGGCGACAGAGGG - Intergenic
1041652441 8:60314313-60314335 ACTTCAGCCTGGGTGACAGAGGG - Intergenic
1041685184 8:60637584-60637606 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1041703149 8:60814476-60814498 ATTCAAGCCTGGGTGACAGAGGG - Intronic
1042043384 8:64620151-64620173 ACTCCAGCCTGGGTGACAAAAGG + Intronic
1042451260 8:68949689-68949711 ACTCTAGCCTGGGTGACAGACGG - Intergenic
1042503830 8:69538723-69538745 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1042587138 8:70353280-70353302 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1042717289 8:71788144-71788166 TTGTTGGACTGAGTGACAAAGGG + Intergenic
1042892626 8:73629797-73629819 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1043226785 8:77743114-77743136 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1043255014 8:78124112-78124134 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1043389457 8:79778032-79778054 AGTGTGGCCTGGGCAACAAAGGG - Intergenic
1043858011 8:85284162-85284184 ATTCTAGCCTGGGTGACAGAGGG - Intergenic
1044080319 8:87874566-87874588 ACTTCAGCCTGGGCGACAAAGGG + Intergenic
1044436734 8:92172793-92172815 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1044567150 8:93676952-93676974 ACTTCAGCCTGGGTGACAGAAGG - Intergenic
1045191236 8:99886355-99886377 ACTACGGCCTGGGTGACAGAGGG + Intronic
1045195334 8:99924839-99924861 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1045528847 8:102965027-102965049 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1045531289 8:102987789-102987811 ACTTGAGCCTGGGTGACAGAGGG - Intergenic
1045753837 8:105517877-105517899 ATTCTAGCCTGGGTGACAGAGGG + Intronic
1045843432 8:106605764-106605786 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1046479745 8:114800323-114800345 ACTTCCGCCTGGGTGACAGAGGG + Intergenic
1046920311 8:119720867-119720889 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1047025135 8:120815603-120815625 AGTTTGGGCTGGGTGGGAAATGG - Intergenic
1047126842 8:121972271-121972293 ACTGTAGCCTGGGTGACAGACGG - Intergenic
1047280352 8:123439919-123439941 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1047423355 8:124725459-124725481 ATGTTAGGCTGGGTGAGAAAAGG - Intronic
1047950623 8:129931657-129931679 ATTCTAGCCTGGGTGACAGAGGG - Intronic
1048040434 8:130722624-130722646 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1048479510 8:134775468-134775490 ATTTTTGCCTGGGACCCAAAAGG - Intergenic
1048490033 8:134883958-134883980 GTTTTGTCCTGGGTGGCGAAGGG + Intergenic
1048566831 8:135609325-135609347 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049511289 8:143028089-143028111 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1049520962 8:143090426-143090448 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1049881010 8:145063208-145063230 ACTTTCCCCTGGGTGACAAGTGG - Intergenic
1050022156 9:1295384-1295406 AGTTTTGCCTGAGTGACATAAGG - Intergenic
1050051877 9:1610668-1610690 ACTCTAGCCTGGGAGACAAAGGG + Intergenic
1050071242 9:1817092-1817114 CCTCTAGCCTGGGTGACAAAGGG - Intergenic
1050677716 9:8075250-8075272 ACTCCAGCCTGGGTGACAAAAGG - Intergenic
1051209534 9:14726955-14726977 ACTCTAGCCTGGGCGACAAAGGG + Intergenic
1051254220 9:15195635-15195657 ACTCCAGCCTGGGTGACAAAGGG + Intronic
1051288726 9:15524116-15524138 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1051587326 9:18740507-18740529 ACTGTAGCCTGGGTGACAGAGGG - Intronic
1051624934 9:19090395-19090417 ATTTCAGCCTGGGTGACTGAGGG - Intronic
1051917704 9:22228078-22228100 TCTCTGGCCTGGGTGAAAAAGGG - Intergenic
1052221728 9:26032278-26032300 ATTTTGAGATGGGTGCCAAATGG - Intergenic
1052615946 9:30842273-30842295 CTTTTTGCCTGGCTAACAAATGG + Intergenic
1052961445 9:34301278-34301300 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1053298606 9:36933109-36933131 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1053316548 9:37056930-37056952 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1053349501 9:37403713-37403735 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1054805168 9:69390670-69390692 ACTTTAGCCTGGGTGACAGACGG - Intronic
1055396300 9:75878361-75878383 ATTCCAGCCTGGGTGACAGAAGG + Intergenic
1055511874 9:77003039-77003061 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1055756494 9:79563776-79563798 ATGCCAGCCTGGGTGACAAAGGG + Intergenic
1056002289 9:82230167-82230189 ATTTCAGCCTGGGTGACAGAGGG + Intergenic
1056662423 9:88554236-88554258 ACTCCCGCCTGGGTGACAAAGGG - Intronic
1056951021 9:91040800-91040822 ACTGTAGCCTGGGTGACAGAGGG - Intergenic
1056961354 9:91126715-91126737 AGTTTGCCCTGGGTCACACATGG - Intergenic
1057100818 9:92358273-92358295 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1057123624 9:92599447-92599469 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1057167037 9:92936734-92936756 ATTCCAGCCTGGGTGACAAAGGG - Intergenic
1057185493 9:93055361-93055383 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1057198065 9:93126162-93126184 ATTCCAGCCTGGGTGACAGAGGG + Intronic
1057276766 9:93680319-93680341 AGTTTGGCCTGGGTCACCCAAGG + Intergenic
1057827059 9:98379299-98379321 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1057908768 9:99002304-99002326 ATTTTCTCCAGGGAGACAAAAGG - Intronic
1058455699 9:105136162-105136184 ATTCTAGCCTGGGTGACAGATGG - Intergenic
1058688663 9:107500778-107500800 ACTTCAGCCTGGGTGACAGAGGG + Intergenic
1058691517 9:107524302-107524324 AGTTTAGCCTGGGCGACAGAGGG + Intergenic
1058734500 9:107881956-107881978 GTTTTGTCTTGGGTGAGAAAAGG - Intergenic
1058965399 9:110032901-110032923 ACTGTAGCCTGGGTGACAGAAGG + Intronic
1059128956 9:111724370-111724392 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1059173782 9:112150965-112150987 AATTTAGCCTGGGTGACAGAGGG - Intronic
1059189198 9:112307417-112307439 ACTCTGGCCTGGGTGACAAAGGG + Intronic
1059224999 9:112663774-112663796 AATTTGCCCTGGCTGATAAATGG + Exonic
1059313211 9:113402395-113402417 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1059477234 9:114557319-114557341 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1060493905 9:124104040-124104062 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1060750506 9:126165463-126165485 ATATAGGCCTTGGTGACAGAGGG + Intergenic
1061063529 9:128263284-128263306 ACTTCAGCCTGGGTGACAGAGGG - Intronic
1061102018 9:128499316-128499338 ATTCCAGCCTGGGTGACACAGGG - Intronic
1061105121 9:128524110-128524132 ACTCCAGCCTGGGTGACAAAGGG - Intronic
1061249469 9:129418074-129418096 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1061579340 9:131527293-131527315 ACTTGGGCCTGGGTGGCAGAGGG + Intronic
1061788815 9:133047552-133047574 ATTCCAGCCTGGGTGACAAGAGG - Intronic
1062100964 9:134728370-134728392 GTTCTGGCCTGGGTTCCAAAGGG + Intronic
1062150711 9:135017448-135017470 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1062659338 9:137620446-137620468 ATTCCAGCCTGAGTGACAAAGGG - Intronic
1203416390 Un_KI270591v1:2018-2040 CTTTTGGCCTGGGTTAGAAAAGG - Intergenic
1185544566 X:933341-933363 ACTCTGGCCTGGGTGACAGAGGG - Intergenic
1185628391 X:1498548-1498570 ACTCTAGCCTGGGTGACAAGAGG - Intronic
1185986631 X:4842332-4842354 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1186358332 X:8811197-8811219 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1186371721 X:8953882-8953904 ATTTTGGATACGGTGACAAATGG - Intergenic
1186392932 X:9179571-9179593 ATTGAAGCATGGGTGACAAAAGG + Intergenic
1187175459 X:16892287-16892309 ACTCGAGCCTGGGTGACAAAGGG + Intergenic
1187405562 X:19000759-19000781 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1187781302 X:22828627-22828649 ATTCTTGCCTGGGTGACAGAGGG + Intergenic
1187809161 X:23156715-23156737 ACTGTGGCCTGGGCGACAGAGGG - Intergenic
1187930079 X:24285878-24285900 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1188226168 X:27600968-27600990 ATTCTGGCCTGGGTGACAGATGG - Intronic
1188963845 X:36526696-36526718 GAAATGGCCTGGGTGACAAAAGG + Intergenic
1189396437 X:40627221-40627243 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1189568685 X:42272149-42272171 ATTTTGGCCAAGGAGATAAAAGG - Intergenic
1190134218 X:47780237-47780259 ATTTTAGCCTGGGCTACAAGAGG - Intergenic
1190228920 X:48566393-48566415 ATTCCAGCCTGGGTGACAGATGG + Intergenic
1191692678 X:63957174-63957196 AATGTGGGCTGGGTGGCAAAAGG + Intergenic
1192120684 X:68452596-68452618 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1192426653 X:71083192-71083214 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1192443190 X:71190246-71190268 ATTCCAGCCTGGGTGACAGAGGG - Intergenic
1192959167 X:76108922-76108944 ATTCCAGCCTGGGTGACAGAGGG + Intergenic
1193955525 X:87856251-87856273 ATTTTTGCCTGTGTAAGAAATGG + Intergenic
1194237907 X:91407712-91407734 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1195429918 X:104777607-104777629 ATTCCAGCCTGGGTGACAGAGGG - Intronic
1195696295 X:107669965-107669987 ATTTTGGCCTGGGTGCCTCGAGG + Intergenic
1196395285 X:115254819-115254841 ACTCTAGCCTGGGTGACAGAGGG - Intergenic
1196826240 X:119742519-119742541 ATTACAGCCTGGGTGACAGAGGG + Intergenic
1196849319 X:119922692-119922714 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1197084983 X:122461605-122461627 AGATTGGACTGGGTTACAAATGG + Intergenic
1197193548 X:123675608-123675630 ACTTCAGCCTGGGTGACAGAGGG + Intronic
1197230567 X:123999474-123999496 ACTCTAGCCTGGGTGACAGAGGG - Intronic
1197781932 X:130168245-130168267 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1197878288 X:131135281-131135303 ATTCCAGCGTGGGTGACAAAGGG - Intergenic
1198077318 X:133205911-133205933 ACTCCAGCCTGGGTGACAAAGGG + Intergenic
1198203617 X:134445763-134445785 ACTCTAGCCTGGGTGACAGAGGG + Intergenic
1198212403 X:134528671-134528693 ACTCTAGCCTGGGTGACAGAAGG + Intergenic
1198893850 X:141429195-141429217 ACTCCAGCCTGGGTGACAAAAGG + Intergenic
1199268060 X:145850279-145850301 ATTTTGGCCTGGCAGTCAGAGGG - Intergenic
1200167641 X:154048272-154048294 ATTCCAGCCTGGGTGACAAAGGG + Intronic
1200397970 X:156002315-156002337 ACTCTAGCCTGGGTGACAGAGGG + Intronic
1201268989 Y:12236215-12236237 ACTCCAGCCTGGGTGACAAAGGG - Intergenic
1201319445 Y:12681855-12681877 ATTTTGTCCTAGCTGACATATGG + Intergenic
1202300327 Y:23407083-23407105 ACTCTAGCCTGGGTGACAGAAGG - Intergenic
1202570484 Y:26263515-26263537 ACTCTAGCCTGGGTGACAGAAGG + Intergenic