ID: 960657576

View in Genome Browser
Species Human (GRCh38)
Location 3:120022868-120022890
Sequence ATCCTCTTATTGGTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960657572_960657576 -1 Left 960657572 3:120022846-120022868 CCTGAGAAATAAAATGAGACTAA 0: 1
1: 0
2: 2
3: 46
4: 636
Right 960657576 3:120022868-120022890 ATCCTCTTATTGGTGGGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 112
960657571_960657576 11 Left 960657571 3:120022834-120022856 CCTTTATCACTGCCTGAGAAATA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 960657576 3:120022868-120022890 ATCCTCTTATTGGTGGGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960657576 Original CRISPR ATCCTCTTATTGGTGGGTCA TGG Intronic
910684552 1:89902812-89902834 ATCCTTTTATTGGCTGGGCACGG - Intronic
911745291 1:101435158-101435180 ATCCTCATATTGCTGGTTCAGGG + Intergenic
916425340 1:164674858-164674880 ATCCTCTTGGTGGTGGGTGGGGG - Intronic
917447547 1:175119377-175119399 ATCTTCGTTTTGGTGGGTCTTGG + Intronic
919918198 1:202152199-202152221 ATCCTATTATTGGCCGGGCACGG - Intronic
920806519 1:209239481-209239503 AAGCTCTGATTGGTGGGTGATGG - Intergenic
1064000416 10:11659239-11659261 ATCCTCTTGGTTGTAGGTCATGG + Intergenic
1065111790 10:22447548-22447570 ATACTCTTGGGGGTGGGTCAGGG - Intronic
1065281270 10:24141164-24141186 ATCCCCTTATTTCTGGCTCAAGG + Intronic
1066576888 10:36835495-36835517 ATCCTCTAATTGCAGGGTGAAGG - Intergenic
1070186723 10:74070747-74070769 ATTATCTAATTGATGGGTCAAGG + Exonic
1071514302 10:86286986-86287008 ATGCTCTTATAGGCTGGTCAGGG + Intronic
1080682121 11:34486936-34486958 AGCCTCTCATTTTTGGGTCAGGG + Intronic
1083643446 11:64158199-64158221 ATCCTCTCCTTGGTGACTCAAGG - Intronic
1084058254 11:66651636-66651658 ATCCTCCTGTTGGCGGGGCATGG - Intronic
1087896064 11:103587821-103587843 ATCCTCTTATTAGTCTTTCATGG - Intergenic
1090786190 11:130049523-130049545 ATTCTCATTTGGGTGGGTCATGG - Intergenic
1096905466 12:54931621-54931643 ATCCTTTTACTTGTGGGTCTAGG - Intergenic
1098013227 12:66076442-66076464 ATCCTTTGACTGGTGGGCCAAGG + Intergenic
1099083675 12:78218361-78218383 AGCCTCTTACTGGTGGGGCTAGG + Intergenic
1099204013 12:79707729-79707751 AGCCTATTATTGATGGCTCAGGG + Intergenic
1101736754 12:107469040-107469062 ATCCCCTTGTTGATGGGTGAGGG + Intronic
1106055125 13:26230249-26230271 ATACTCTTCTTGGTGGGAGAGGG + Intergenic
1110147289 13:72207143-72207165 AACCTTTTAGTGGTGGGACATGG - Intergenic
1111270551 13:85877521-85877543 ATCCTTTTATTGGTGTATAAAGG - Intergenic
1113154318 13:107300670-107300692 ATTTCCTTATTGATGGGTCATGG + Intronic
1113640433 13:111953345-111953367 GTCCTGTGATTGGTGGCTCAGGG - Intergenic
1120243891 14:81983177-81983199 ATCTTCTGATTTGTGTGTCAAGG - Intergenic
1125983466 15:44025972-44025994 TTCCTTTTTTTGGTGGGGCAGGG + Intronic
1129201783 15:74006899-74006921 ATCCTCTCTTTGGTAGTTCAAGG - Intronic
1132806791 16:1778696-1778718 ATCCTTTCCTGGGTGGGTCAGGG - Intronic
1133690627 16:8211029-8211051 ATCCTCTTAGTGTTGAGTGAGGG - Intergenic
1134295658 16:12943168-12943190 GTGCTCTGATTGGTTGGTCAGGG + Intronic
1137872958 16:51968264-51968286 ATCCTCTTAAGAGTGGGACAGGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1141197313 16:81869793-81869815 ATCAAGTTATTGGTGGGTCTGGG + Intronic
1141275618 16:82585283-82585305 TTCCTCTTATTTTTGGGGCAAGG - Intergenic
1142174273 16:88637996-88638018 ACCCTCTTATAGGAGGTTCAAGG + Intergenic
1143023427 17:3928202-3928224 ATCACCTTGTGGGTGGGTCAAGG - Intronic
1143292183 17:5839790-5839812 TTCCTCTCAGTGGTGGGGCATGG + Intronic
1144357194 17:14457577-14457599 ATCCTCTTATTCTTGTTTCATGG + Intergenic
1145713496 17:26997121-26997143 ATCCTCTTGCTGGTGGGTGGAGG + Intergenic
1147026242 17:37586815-37586837 ATACTCTGATTGGTGTGTTATGG + Intronic
1149016434 17:51913812-51913834 ATCCTCTTGTTGGTGTGACTTGG + Intronic
1149676282 17:58465439-58465461 ATGCTCTTGTTTGTGGGTCCAGG - Intronic
1150090616 17:62321721-62321743 ATCATTTTGTTGGTGGGACATGG - Intergenic
1153634467 18:7101635-7101657 ATCCACTTTTTGGTGGATAATGG - Intronic
1155274966 18:24178134-24178156 ATGCACTGATTGGTGGGTGATGG + Exonic
1156404302 18:36769961-36769983 ATCCTCTATTTGGTGGGAAAAGG - Intronic
1162232396 19:9278552-9278574 GTCCTCTTCCTGGTGGGGCATGG - Intergenic
1163983655 19:20924859-20924881 ATCAGAATATTGGTGGGTCAAGG + Intronic
1164576082 19:29405929-29405951 ATCCTCTTGTTGCAGGCTCAGGG - Intergenic
1166793075 19:45409337-45409359 TTCCTCTTCTTGGTGGATCCCGG - Exonic
930563081 2:52984963-52984985 ATTCTCTAATTGGTCAGTCATGG - Intergenic
932334862 2:70924484-70924506 ATACTCTTATTGGCTGGGCATGG - Intronic
933770923 2:85743485-85743507 ATCCTCTTTTGAGTGGGGCAGGG - Intergenic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
940606418 2:155928861-155928883 ATCCACTTATTGGTGCTCCAGGG - Intergenic
941169367 2:162118472-162118494 ATCCTATTATGGGTGGCCCAAGG - Intergenic
941775579 2:169389648-169389670 ATCCTTTATTTGGTGGGTCTAGG - Intergenic
942013138 2:171784803-171784825 ATTCTCTTATTGGTGACTTATGG - Exonic
944411260 2:199445204-199445226 ATCTTTTTATTGGGGGGCCAAGG + Intronic
948660956 2:239506137-239506159 CTCCTCTGCTTGGTGGCTCAGGG - Intergenic
1171970529 20:31562194-31562216 ATCCTCATCTTGGTGGGAGAAGG - Intronic
1173549387 20:43921906-43921928 AGCCTCTTATTGGAGTGTCCAGG + Intronic
1174178956 20:48662931-48662953 AACCTCTCATTTGTGGGTGAGGG - Intronic
1176240393 20:64073212-64073234 ATCCTATTTTTGGGGGGTTAGGG + Exonic
1182076012 22:27495940-27495962 ATCCCTTTAAAGGTGGGTCAGGG + Intergenic
1183357036 22:37365081-37365103 CTCCTGTCATTGGTGGGTCCAGG - Intergenic
950923975 3:16721920-16721942 CTTCTCTTATTGGTGGGTTTGGG - Intergenic
954364514 3:50138980-50139002 AGCCTCTCACTGGTAGGTCAGGG + Intergenic
960657576 3:120022868-120022890 ATCCTCTTATTGGTGGGTCATGG + Intronic
962501743 3:136001468-136001490 ATCCACTTACTGGTGGGACTTGG - Exonic
963416687 3:145004365-145004387 ATCCTCTCATTTGTGTGACATGG - Intergenic
966749302 3:183306763-183306785 GTCATCTTGTTGGAGGGTCATGG - Intronic
968131416 3:196194807-196194829 CTCCCCTTATCAGTGGGTCAAGG + Intergenic
968856114 4:3124310-3124332 ATCCTCTTCTGGCTGGGACATGG + Intronic
980685049 4:136216798-136216820 AACTTCTTATTGGTCTGTCAAGG + Intergenic
984613239 4:181865503-181865525 ATCCTCTTAGTGTTTGATCATGG + Intergenic
984993919 4:185409550-185409572 ATTCTCTAATTGTTGGGTGAGGG - Intronic
989597629 5:43171424-43171446 ATCCTGTTATTGGCTGGGCACGG + Intronic
990964535 5:61431079-61431101 ATCATCTTATGGGTCGGGCATGG + Intronic
995492641 5:112708398-112708420 TTCCTCTACTTGGTGGGTCAAGG - Intronic
998309161 5:141109521-141109543 ATCCTTTTATGGGTGGTTAAAGG - Intronic
1003883768 6:10502265-10502287 ATTCTCATATTGTTGGGTGAAGG + Intronic
1004384739 6:15162992-15163014 ATGCTCTTATTGGCCGGGCATGG + Intergenic
1004636007 6:17468349-17468371 ATCCTTTTTTCTGTGGGTCAAGG - Intronic
1005529346 6:26687143-26687165 ATCTTCTCATTGATGGGCCAGGG - Intergenic
1005541450 6:26814503-26814525 ATCTTCTCATTGATGGGCCAGGG + Intergenic
1009012256 6:57856565-57856587 ATCTTCTCATTGATGGGCCAGGG + Intergenic
1010225065 6:73481242-73481264 ATCCTATTATTGGCTGGGCAAGG - Intronic
1013465213 6:110412004-110412026 ATCCTCCCACTGGTGGGGCATGG - Intronic
1013655982 6:112246882-112246904 ATCCTCCTATTGCTGGGGAAAGG + Intronic
1014746638 6:125208596-125208618 ATTTTCTTATTGGTGGCTCCAGG + Intronic
1021054415 7:16029172-16029194 ATCTTCTTATTGCTGAGTGAAGG - Intergenic
1026166372 7:67913458-67913480 ATCCACTTCTTAGTTGGTCAAGG - Intergenic
1026387151 7:69861346-69861368 ATTCTCTTTTTGGAGGGACATGG + Intronic
1027435465 7:78159686-78159708 TTCCTTTTATGGGTTGGTCAGGG - Intronic
1032372879 7:131377284-131377306 ATCCTCTTAATGGTTGTTTATGG + Intronic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1035544128 8:466363-466385 CTCCTCTGTGTGGTGGGTCATGG - Intronic
1038987042 8:32822669-32822691 ATTCTTTTAATGGTGGGGCAGGG + Intergenic
1042076135 8:64997250-64997272 ATTTTCTTTTCGGTGGGTCAGGG + Intergenic
1042221648 8:66480102-66480124 ATCTTTTTATTGGTGGGTAATGG + Intronic
1044446695 8:92285853-92285875 ATTCTCTTTTTGTTGGGTAAGGG + Intergenic
1045847997 8:106659499-106659521 ATCCTCTTAAAGGTGGGACCAGG + Intronic
1052589004 9:30466659-30466681 TTCCTCTTTTTTGTGGTTCAGGG - Intergenic
1054981171 9:71208412-71208434 TTCCTGTTTTTGGTGGGTAAAGG - Intronic
1055684617 9:78757894-78757916 ATTCCTTTCTTGGTGGGTCATGG - Intergenic
1057411924 9:94824211-94824233 ATCCTCTTTTTGGGGGCTTAAGG - Intronic
1058328525 9:103728267-103728289 ATCCACTTATAGGATGGTCATGG - Intergenic
1058821567 9:108735429-108735451 ACCCTCTTATTGGTCTGTCCAGG - Intergenic
1186530949 X:10295058-10295080 ATCATCCTTCTGGTGGGTCAAGG - Intergenic
1187189511 X:17020329-17020351 ATCCTCTTATGGGTAGATCAGGG + Intronic
1188751477 X:33910600-33910622 ATCCTTCTATTGCTGGGTAAGGG + Intergenic
1189353816 X:40296731-40296753 ATCCTTCTGTTGCTGGGTCATGG + Intergenic
1192343384 X:70281861-70281883 TTCCTCTTCCTGGAGGGTCACGG + Intergenic
1199616112 X:149657526-149657548 ACCCTCTTATTGTTGAGTCATGG + Intergenic
1199626528 X:149745722-149745744 ACCCTCTTATTGTTGAGTCATGG - Intergenic