ID: 960659379

View in Genome Browser
Species Human (GRCh38)
Location 3:120041328-120041350
Sequence TATTGTAGTTGGGCCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960659371_960659379 25 Left 960659371 3:120041280-120041302 CCTGAGTAAGTGGTAGATAACCT 0: 1
1: 1
2: 2
3: 7
4: 82
Right 960659379 3:120041328-120041350 TATTGTAGTTGGGCCAGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 92
960659374_960659379 1 Left 960659374 3:120041304-120041326 CCAGCTGATATATCCACCGGCAT 0: 1
1: 0
2: 2
3: 3
4: 34
Right 960659379 3:120041328-120041350 TATTGTAGTTGGGCCAGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 92
960659372_960659379 5 Left 960659372 3:120041300-120041322 CCTTCCAGCTGATATATCCACCG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 960659379 3:120041328-120041350 TATTGTAGTTGGGCCAGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960659379 Original CRISPR TATTGTAGTTGGGCCAGTGC TGG Intronic
907750855 1:57261950-57261972 TATTTTCATTGGCCCAGTGCAGG - Intronic
913235538 1:116778276-116778298 CAGTGTAGTTGGTCCAGTGGTGG - Intergenic
915052868 1:153094608-153094630 CATTTTAGTTGGGACATTGCTGG - Intronic
921183233 1:212647430-212647452 TATTATGGTCGGGCCAGTGCTGG + Intergenic
924123128 1:240823273-240823295 TATTATGGTTGGGCCAGTGTCGG - Intronic
1062826243 10:571035-571057 TCGTGTCGTTAGGCCAGTGCCGG - Intronic
1064929769 10:20612432-20612454 TATTATAGTTAGGTCAATGCTGG + Intergenic
1072503910 10:96044670-96044692 GATGGTAGTTGGGCCAGGGAAGG + Intronic
1074603466 10:114937715-114937737 AATTGTAGTGGGGTCAGTGGGGG + Intergenic
1078896452 11:15601208-15601230 TAATGAAGTTTGGGCAGTGCTGG + Intergenic
1080569146 11:33540725-33540747 TATTTGAGGTGGGCCAGTGGAGG + Intergenic
1082801851 11:57420664-57420686 TAATGTGCTTGGGCCAGTGTTGG - Intronic
1086433457 11:86758489-86758511 TATTGTAGTAGAGACATTGCAGG - Intergenic
1087974781 11:104531341-104531363 TATTGTTGCTGGGACATTGCTGG - Intergenic
1091382290 12:69737-69759 TGTTGAAGTTGGGCCACTGTGGG - Intronic
1093874751 12:24336940-24336962 TAATGTAGTTTGGCAAATGCAGG - Intergenic
1095498368 12:42809245-42809267 CATTGTTGGTGGGCCAGTGGGGG + Intergenic
1096424299 12:51488279-51488301 TATTGCAGTAAAGCCAGTGCAGG - Intronic
1099899164 12:88685438-88685460 TATTGTCTATGGGCCAGTGGAGG - Intergenic
1100280729 12:93115839-93115861 AATTGGAGATTGGCCAGTGCGGG - Intergenic
1102952738 12:117041122-117041144 GATGGTGGTTAGGCCAGTGCTGG - Intronic
1104429687 12:128706097-128706119 TCTTGGAGGTGGGCGAGTGCAGG - Exonic
1107368850 13:39718862-39718884 TATTATAGTTGGAATAGTGCTGG + Intronic
1108079675 13:46721963-46721985 TATTGTAGTTAGGCGAGCACAGG + Intronic
1112781260 13:102903444-102903466 TTTTGAAGTTGTGCCTGTGCCGG - Intergenic
1114413873 14:22525988-22526010 TATTGTGGGTGGACCAGAGCAGG - Intergenic
1118630018 14:67694378-67694400 TATGGGAGTCGGGCCAGAGCTGG - Intronic
1123678019 15:22731956-22731978 TATGGATGGTGGGCCAGTGCAGG + Intergenic
1125870638 15:43098630-43098652 TAGTGTAGATGTGCTAGTGCTGG - Intronic
1125874679 15:43133690-43133712 TATTGTCGCAGGGCCAGAGCTGG - Exonic
1127129142 15:55843853-55843875 TATTGTAGTAGGGCCAACGATGG + Intronic
1131532128 15:93202759-93202781 TCTTGCAGTGGGGCCAGTGTTGG + Intergenic
1132617211 16:847636-847658 GATTGTCGTTGGCCCATTGCTGG - Intergenic
1136026524 16:27472340-27472362 TAGACTAGATGGGCCAGTGCAGG - Intronic
1140665606 16:77224452-77224474 TACTGTAACTAGGCCAGTGCTGG + Intergenic
1141034932 16:80618609-80618631 TATTGTAGCTGGGTCACTGAAGG - Intronic
1142258843 16:89032797-89032819 TCTTTCAGTTGGGCCAGAGCCGG + Intergenic
1146247940 17:31307307-31307329 TATTGTAATTGGGCCAGGCGTGG - Intronic
1150836593 17:68569519-68569541 TATTGCATATTGGCCAGTGCAGG - Intronic
1153291732 18:3508490-3508512 TACTTTAGTTGGGCCAGTCTTGG + Intronic
1153985131 18:10344451-10344473 TGCTGTAGATGGGACAGTGCAGG - Intergenic
1157797447 18:50588162-50588184 TTTTGTAATTTGGGCAGTGCTGG + Intronic
1164558812 19:29274415-29274437 TATTGTAGTTTGGCTGCTGCAGG - Intergenic
925145508 2:1580836-1580858 GATTGTTGTTAGGCCACTGCAGG - Intergenic
926636660 2:15187408-15187430 TATTGTAATGGGGTCAGGGCAGG + Intronic
927742815 2:25587719-25587741 TATTCTAGTTGGGCCTGTGAAGG - Intronic
928436345 2:31257068-31257090 GATTTTAGCTGTGCCAGTGCAGG - Intronic
928855323 2:35796499-35796521 AATAGAAGTTGGGCCATTGCTGG + Intergenic
935151532 2:100440957-100440979 CATTGGAGTTGGGACAGTGTAGG + Intergenic
935151681 2:100442558-100442580 TGTTGGAGTTGGGACAGTGTAGG - Intergenic
937606868 2:123811109-123811131 TATTTTGGTTGGGTCAGTGGTGG - Intergenic
942408336 2:175679738-175679760 TGTTTTACATGGGCCAGTGCTGG + Intergenic
1174350320 20:49962741-49962763 TTTTGCAGTTGGGCCAGTGGAGG + Intergenic
1174366834 20:50061591-50061613 TTTTGAAGTTGGCCCAGGGCAGG + Intergenic
1176282909 20:64325096-64325118 TGTTGAAGTTGGGCCACTGTGGG + Intergenic
1182422807 22:30256780-30256802 TTTTGGCCTTGGGCCAGTGCAGG - Intergenic
1183003142 22:34878286-34878308 TATGGTACTTGGTGCAGTGCAGG + Intergenic
1183876710 22:40789085-40789107 TATTATGGTTGGGCCAGTGCTGG - Intronic
1183972630 22:41489333-41489355 TATTATTATTTGGCCAGTGCAGG - Intronic
1184667442 22:45996440-45996462 TATGGCAGTGGGGCCAGGGCAGG + Intergenic
950632428 3:14291643-14291665 TATTGAAGTTAGGCCAATGATGG + Intergenic
950935325 3:16833769-16833791 TATGGTACTTGGGTCAGTACAGG - Intronic
952345306 3:32478362-32478384 TAATGTAGGCGGGCCAGTGGTGG + Intronic
956382634 3:68681880-68681902 GGTTGTAATTGAGCCAGTGCGGG + Intergenic
959287134 3:104429033-104429055 TATGGAAGATGTGCCAGTGCTGG + Intergenic
959289609 3:104457140-104457162 TATTGTTGGTGCGCCAGTTCAGG + Intergenic
959712479 3:109398856-109398878 ATTTGTACCTGGGCCAGTGCTGG + Intergenic
960659379 3:120041328-120041350 TATTGTAGTTGGGCCAGTGCTGG + Intronic
962393506 3:134993547-134993569 CCTTGTACTGGGGCCAGTGCAGG - Intronic
967225215 3:187284532-187284554 TATTGTAAATGGGACATTGCAGG + Intronic
967273707 3:187752526-187752548 TATTGTAGTTGTGTGGGTGCTGG + Intergenic
971001552 4:22328537-22328559 TTTGGTAGCTGGGCCAGTACAGG - Intergenic
973954316 4:56048648-56048670 TATTGTGGTTGGGACTCTGCAGG + Intergenic
980847600 4:138342678-138342700 TGTTGTCGGTGGGCCAGTTCAGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
990337951 5:54793642-54793664 GATGGTGGTTGGGCCAGAGCAGG - Intergenic
998045245 5:138981688-138981710 AATTGTATGTGGGCCAGTGATGG + Intronic
1003244006 6:4369171-4369193 GAATGAAGTTGGGGCAGTGCTGG - Intergenic
1013890728 6:115023482-115023504 TGTTGTAGTTGGAGAAGTGCTGG - Intergenic
1013892692 6:115044063-115044085 TACTGTAGCTGGGCCAGGGGCGG - Intergenic
1017413580 6:154195435-154195457 TATTGTAGCTGGGCCAGGCACGG - Intronic
1026416277 7:70184003-70184025 TATTGTAGTTTGGCCAGTGAAGG + Intronic
1028257521 7:88618178-88618200 TATTGTAGTTAAGCCACTGATGG + Intergenic
1032635254 7:133700049-133700071 GATTGTAGCTGGGCAAATGCAGG - Intronic
1033192068 7:139290341-139290363 TATTGTGGTTGGCACAGTACAGG + Intronic
1033682160 7:143605092-143605114 TCTTGGAACTGGGCCAGTGCAGG - Intergenic
1033702729 7:143856821-143856843 TCTTGGAACTGGGCCAGTGCAGG + Intronic
1040751542 8:50714772-50714794 GATTGTGGTTGAGCCTGTGCTGG - Intronic
1040936027 8:52782917-52782939 TGTTGTTGGTGGGCCAGTTCGGG + Intergenic
1054826382 9:69577934-69577956 TTCTCCAGTTGGGCCAGTGCTGG - Intronic
1055446793 9:76392491-76392513 TACTATGGTTGGGCCAGTGTTGG - Exonic
1059229897 9:112710245-112710267 TATTGATTTTGGGCCAGTCCAGG - Intronic
1061694511 9:132362198-132362220 TATTGTTGGTGGGCCAGTTTAGG + Intergenic
1189636536 X:43016700-43016722 TATTGTATTGTGGCCAGTACTGG + Intergenic
1192210550 X:69125145-69125167 TCTTGTAGTTGTGCCACTGTGGG - Intergenic
1195831154 X:109060636-109060658 TCTTGTAGTTGGTCTAGTGGTGG + Intergenic
1199106292 X:143873179-143873201 TACTGTAGTGGGCCCAGTACTGG - Intergenic
1199339544 X:146660786-146660808 TAGTGTAGTTGGGACTGAGCAGG + Intergenic
1200386777 X:155900130-155900152 GACTGTAGTTGGGGCAGTGGGGG - Intronic