ID: 960662018

View in Genome Browser
Species Human (GRCh38)
Location 3:120070822-120070844
Sequence CAGTGCCAACGTAGTTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960662016_960662018 21 Left 960662016 3:120070778-120070800 CCTAAGGAGTAAAGTCTAATAGA 0: 1
1: 0
2: 1
3: 16
4: 173
Right 960662018 3:120070822-120070844 CAGTGCCAACGTAGTTCAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960662018 Original CRISPR CAGTGCCAACGTAGTTCAAA AGG Intronic
900895668 1:5481363-5481385 AAGTGCCAACATAGTTTAAGTGG + Intergenic
900953376 1:5872217-5872239 CTGTGCCAATGTAGCACAAAGGG - Intronic
903264986 1:22152764-22152786 CACTGTCAACGTAATACAAATGG + Intergenic
908282846 1:62560422-62560444 AAGTGCCTACGTACTTCAGATGG - Intronic
911017052 1:93345218-93345240 CAGTTCCAACATAGTGGAAATGG - Intergenic
916246705 1:162695655-162695677 CTGTGCCAATGTCTTTCAAATGG + Intronic
916300869 1:163272674-163272696 CAGTGCCAAGACAATTCAAAGGG - Intronic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
922426490 1:225501021-225501043 CAGTGCCAATGGAGTCCAGACGG - Exonic
1063035064 10:2278648-2278670 CGGAGACAACGTAGGTCAAATGG + Intergenic
1075268192 10:121024263-121024285 AAATGCCAAGGTAATTCAAAGGG + Intergenic
1077305539 11:1867167-1867189 AAGTTCCAAGGGAGTTCAAAGGG - Intronic
1079582320 11:22080913-22080935 CAGTGGCAATGTAGTTAAAGAGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1088946815 11:114522234-114522256 CAGGGCCATCGGTGTTCAAAAGG - Exonic
1101124413 12:101616150-101616172 CAGTGCCATATGAGTTCAAACGG + Intronic
1103423111 12:120806377-120806399 CGGTGCCAAGGTAATTCAACTGG + Intronic
1121346894 14:93142938-93142960 CAGTGCCAAGCTTTTTCAAAAGG - Intergenic
1126560569 15:50038916-50038938 CAGTGACAACACAGTTTAAATGG - Intronic
1129039455 15:72673470-72673492 CATTGTCAACTGAGTTCAAATGG + Intergenic
1135601560 16:23788155-23788177 CAGTGCCAATTAAGTTCAATTGG + Intergenic
1149547097 17:57511684-57511706 CAGTGCCAACTGAGGTCAAGGGG - Intronic
1152832656 17:82508019-82508041 TAGTGCCAAGGTTGTTCAATAGG - Intergenic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1158153181 18:54394786-54394808 TATTGCCAATGTAGTGCAAAAGG - Intergenic
1158270221 18:55705055-55705077 AAGTGTCAATGTAGTTCAATGGG - Intergenic
1159165632 18:64695605-64695627 AAGTGTAAACATAGTTCAAAGGG + Intergenic
930055278 2:47247173-47247195 CAGTGCCCACTTAGTTACAAAGG + Intergenic
940801522 2:158137876-158137898 CAGTGCAAATCTAGTTCTAAAGG - Intergenic
945440544 2:209873835-209873857 AAGTGCCAAAGTTATTCAAAAGG + Intronic
1172887913 20:38244160-38244182 CAGTGCAAATGAAGTTTAAATGG + Intronic
1178901357 21:36601483-36601505 CAGTGGCAACAGAGATCAAATGG - Intergenic
1184081864 22:42227318-42227340 AAGTGCAAAAATAGTTCAAAGGG + Intronic
949395421 3:3609854-3609876 CAGTGCCTACCTAGTTATAAGGG + Intergenic
952246306 3:31596386-31596408 CAGTGCCAAACCAGTTCAATGGG - Intronic
960662018 3:120070822-120070844 CAGTGCCAACGTAGTTCAAAAGG + Intronic
961931267 3:130535881-130535903 CAGTGATAAAGTAGTACAAATGG - Intergenic
963662029 3:148139009-148139031 CAGTGCCAAGGAAGTATAAAAGG - Intergenic
966088827 3:176105205-176105227 CAGGGTCAATATAGTTCAAAGGG + Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
974926037 4:68298821-68298843 GAGTGCCAAAGCAGTTCAATAGG + Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
988678075 5:33454767-33454789 CATAGCCAAAGTAATTCAAAAGG - Intronic
989539492 5:42602299-42602321 ATGTGAAAACGTAGTTCAAATGG - Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
999288543 5:150408491-150408513 AAGCGCCAAAGTATTTCAAATGG + Intronic
1000928255 5:167220114-167220136 CAGTACCAGTATAGTTCAAAGGG - Intergenic
1007075756 6:39065204-39065226 CAGTGCCAACCTTGTTCCCAGGG + Intronic
1008353489 6:50521700-50521722 TAGTACCAAGGTAGTACAAAGGG + Intergenic
1016049503 6:139515892-139515914 CAGTGGCAAAATAGGTCAAATGG - Intergenic
1016202549 6:141430186-141430208 CAGTGCCAGGGCAGTGCAAAAGG - Intergenic
1023343788 7:39250495-39250517 CAGGGCCAAAGTAGGTTAAATGG - Intronic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1033399690 7:141010295-141010317 TAGAGCCCAGGTAGTTCAAAAGG - Intronic
1037136340 8:15466293-15466315 CAGTGCCAAAGAAATTCACAAGG - Intronic
1037653189 8:20859516-20859538 CTGTGTCCACCTAGTTCAAAAGG - Intergenic
1041673962 8:60519065-60519087 CAGTCCCCACGCAATTCAAAGGG + Intronic
1042864579 8:73345988-73346010 GAGTTCCTATGTAGTTCAAATGG + Intergenic
1042972533 8:74426178-74426200 AAGTGCAAACATAGTGCAAATGG + Intronic
1049049015 8:140177405-140177427 ATGTGCCAAGGTAATTCAAAGGG - Intronic
1052158462 9:25225506-25225528 CAGTGACAACATGGTTCAATAGG + Intergenic
1052676053 9:31626132-31626154 CAGTAACCACGGAGTTCAAAAGG + Intergenic
1056149434 9:83770411-83770433 GAGTCCCAACGCAGTTAAAAGGG - Intronic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1060447118 9:123700023-123700045 AGGTGCCAAGGTAATTCAAAGGG - Intronic
1196431766 X:115634608-115634630 TAGTGCCAGCATACTTCAAAAGG + Intronic
1197886475 X:131223227-131223249 CAGTGCCTACTTAGCTCAACAGG - Intergenic