ID: 960672449

View in Genome Browser
Species Human (GRCh38)
Location 3:120166445-120166467
Sequence GTGTAGGGGTGGCTCTGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960672444_960672449 -7 Left 960672444 3:120166429-120166451 CCATCAAGAAATAGTGGTGTAGG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 960672449 3:120166445-120166467 GTGTAGGGGTGGCTCTGAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 259
960672442_960672449 12 Left 960672442 3:120166410-120166432 CCATAATGGTGGAAAGACACCAT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 960672449 3:120166445-120166467 GTGTAGGGGTGGCTCTGAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960672449 Original CRISPR GTGTAGGGGTGGCTCTGAGC TGG Exonic
900252518 1:1678513-1678535 GCGTCTGGGTGGCACTGAGCTGG - Intronic
900603027 1:3511271-3511293 GTGAAGGGGTGGTACTGAGGAGG + Intronic
900719325 1:4165138-4165160 GTGCAGGGGTGGAGCTGTGCAGG - Intergenic
901000459 1:6146532-6146554 GAGTTGGGGTGGTGCTGAGCGGG - Intronic
901005789 1:6170955-6170977 GTGTGGGGGTGGCTCTGCCCAGG - Intronic
901916531 1:12504706-12504728 GAGGAGGGGTGACTCTGAGCTGG - Intronic
902512010 1:16971764-16971786 GGGTGGGGTTGGCTCTGCGCTGG + Intronic
902736480 1:18404758-18404780 GTGTAGGGGCAGCTGTGAGCTGG + Intergenic
903283415 1:22262985-22263007 GTGTAGGGGTGAGGCAGAGCAGG + Intergenic
903944144 1:26951288-26951310 GAGTAGGGGAGGCTCTGGCCAGG - Intronic
906286080 1:44588729-44588751 GCTTAGGGCTGGCTATGAGCAGG + Intronic
906645349 1:47470596-47470618 AAGAAGGGGTGGCTCTGGGCCGG + Intergenic
906971732 1:50521873-50521895 GTGGAGGGCTGGCTCTGAACAGG + Intronic
907519839 1:55015939-55015961 GTGGTGGGGTGGCTCAGGGCTGG - Intergenic
909476687 1:76088903-76088925 GTGTATGGCTGGCATTGAGCTGG + Intronic
909486597 1:76180806-76180828 TGGTGGAGGTGGCTCTGAGCAGG - Intronic
911008533 1:93253579-93253601 GTGTGTGAGTAGCTCTGAGCTGG + Intronic
911605934 1:99905200-99905222 GTGGGGGGGTGGGTCTGAGATGG + Intronic
913032846 1:114928804-114928826 TTGTAGGGGTTGCTCTAAGGAGG - Intronic
913329079 1:117652517-117652539 GTGCAGGGGTGGCTAAGAGAAGG - Intergenic
915822992 1:159045396-159045418 GTGTGGGGATGGCTCTCAGCTGG - Exonic
915823352 1:159049531-159049553 GTGTGGGGATGGCTCTCAGCTGG - Intronic
916772143 1:167920615-167920637 GTGTAGGGGTTGGTGTGTGCTGG - Exonic
918067388 1:181110442-181110464 GTGGAGGGGAGGGGCTGAGCTGG + Intergenic
920209478 1:204317509-204317531 GTGTTGGTGGGGCTCTGAGATGG - Intronic
921848380 1:219907793-219907815 GTTTAGGGGTGGCTGGGAGCTGG + Intronic
922228520 1:223666055-223666077 TTGGAGGCATGGCTCTGAGCAGG + Intergenic
923242461 1:232098979-232099001 GTGACGGGATGGCACTGAGCAGG + Intergenic
924953546 1:248906737-248906759 GGGGCGGGGTGGCTCTGTGCCGG + Intronic
1064101921 10:12471419-12471441 GGGTAGGGCTGGCTGTGTGCTGG + Intronic
1064237836 10:13592954-13592976 GTGTAAGGGTGGCTCCGTTCTGG - Intronic
1067046270 10:42986988-42987010 GTGTACGGTGGCCTCTGAGCAGG + Intergenic
1068403810 10:56564197-56564219 TGGTAGAGGTGGCTCTCAGCAGG - Intergenic
1069801083 10:71081999-71082021 GTGTAGTGAAGGCTCTGAGAAGG + Intergenic
1069806882 10:71131841-71131863 GGGAAGAGGTGGCTCTGTGCTGG - Intergenic
1071396105 10:85225574-85225596 AGGTAGGGGTGGCTCTGTGGAGG + Intergenic
1075207318 10:120458197-120458219 GCTGCGGGGTGGCTCTGAGCTGG - Intronic
1076166192 10:128284659-128284681 GTGTTGGGGTGGTTCTGAATGGG + Intergenic
1076663277 10:132069398-132069420 GTGGTGGGGTGGGTCTGAGCAGG + Intergenic
1076900083 10:133333958-133333980 CTGAAGGGGAGGCTCTGAGGGGG + Intronic
1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG + Intronic
1077534898 11:3119382-3119404 GTGTAGGCCTGACTCCGAGCCGG + Intronic
1077539755 11:3140927-3140949 GGGAAGGAGTGGCTCTGAGGTGG - Intronic
1077902071 11:6497698-6497720 GTGTATGGGTGGCTATGATTAGG + Intronic
1078544373 11:12236082-12236104 GCATAGGGCTGGCTTTGAGCTGG - Intronic
1079009727 11:16818053-16818075 GTGTAGGGGTGACCCTGAGATGG - Intronic
1080667123 11:34345638-34345660 GGGTAGGGCTGCCTCTGAGAAGG - Intronic
1081546879 11:44077951-44077973 GGGTGTGGGTGGGTCTGAGCAGG + Intronic
1083683074 11:64360121-64360143 GTGGAGGGTGGGCTGTGAGCGGG - Intronic
1083725644 11:64626728-64626750 GGGTGGGGCTGGCTCTGAACCGG - Intronic
1083954762 11:65977223-65977245 GGGAAGGAGTGGCTCTGGGCCGG - Intronic
1084205117 11:67586578-67586600 GGGTTGGGGGGACTCTGAGCGGG + Exonic
1084860099 11:72012621-72012643 GTGCAGGTGTGCCTCTGAACAGG + Intronic
1085013753 11:73159290-73159312 GGGCAGGGGTGGCTGTGAGAGGG - Intergenic
1086920948 11:92585973-92585995 GGGTAGGGTTAGGTCTGAGCTGG + Intronic
1088593395 11:111422219-111422241 GTGCACGGTTGGCTCAGAGCTGG - Intronic
1090210895 11:124920574-124920596 GTGCAGGGGCTGTTCTGAGCTGG - Exonic
1092151407 12:6251446-6251468 GGGTTGAGGAGGCTCTGAGCTGG - Intergenic
1093180382 12:15960682-15960704 GTGTAGTTGCGGTTCTGAGCAGG + Intronic
1096071944 12:48780338-48780360 GAGTAGGGGTGGATCTGGGAAGG + Intronic
1096227350 12:49874649-49874671 GCCTGCGGGTGGCTCTGAGCTGG - Intronic
1096838049 12:54363662-54363684 GTGTGAGGTTGGCTATGAGCAGG + Exonic
1100608576 12:96171597-96171619 GTGTACCGGTGGCTTAGAGCAGG - Intergenic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103948361 12:124539331-124539353 GTGTGTGGGTGGCCCCGAGCCGG - Intronic
1104290251 12:127460011-127460033 GAGCAGGCTTGGCTCTGAGCTGG + Intergenic
1104662110 12:130618613-130618635 GTTCAGGTGTGGCTGTGAGCAGG - Intronic
1104706303 12:130950059-130950081 GCGTATGGGAGGGTCTGAGCTGG + Intergenic
1104728523 12:131092621-131092643 GCCTTGGGGTGGCTCTGACCTGG + Intronic
1105024654 12:132839886-132839908 GTGCAGGGGTGAGGCTGAGCAGG - Intronic
1105024681 12:132839996-132840018 GTGTAGGGGCGAGGCTGAGCAGG - Intronic
1105302797 13:19150930-19150952 GGGTGAGGGTGGCGCTGAGCTGG + Intergenic
1106788233 13:33128937-33128959 GTGTAGGGGCCTCTCTGACCAGG - Exonic
1108552692 13:51562400-51562422 GTGTATGGGTGGGTCTGTGGTGG + Intergenic
1109653989 13:65366139-65366161 GGTTGGGGGTGGCTCTCAGCAGG - Intergenic
1110003715 13:70238639-70238661 GTGTGGAGGTGGCTCTCAGTGGG - Intergenic
1110999949 13:82165620-82165642 GTGTACGGGTGGCCATGGGCAGG + Intergenic
1111650327 13:91082306-91082328 GATGATGGGTGGCTCTGAGCAGG - Intergenic
1111870411 13:93825117-93825139 GTAGAAGGGTGGCTCTCAGCAGG + Intronic
1113471697 13:110551470-110551492 GTGCTGGAGGGGCTCTGAGCAGG + Intronic
1117803976 14:59470936-59470958 GTGTGGGGGTGGCTGGGGGCGGG + Intronic
1118317872 14:64736844-64736866 GTGTTTGGTTGGCTCTGAGGAGG - Exonic
1119485523 14:74984464-74984486 GGGGAGGGGTGGCTCAGAGAGGG + Intergenic
1119666197 14:76486772-76486794 GTGCAGGGGTGTCCCTGTGCCGG - Intronic
1121773066 14:96569044-96569066 TTGTAGGTGTGACTCTTAGCTGG - Intergenic
1122799980 14:104224659-104224681 ATGGATGGGTGGGTCTGAGCCGG - Intergenic
1123062344 14:105599927-105599949 GTGTACCTGGGGCTCTGAGCAGG + Intergenic
1123111343 14:105868350-105868372 GTGAGGGGCTGGCTCTGGGCTGG + Intergenic
1125031472 15:35079983-35080005 CTGTTGGGGTGGTTCAGAGCTGG + Intergenic
1128078923 15:64844755-64844777 GTTTGGGGAGGGCTCTGAGCAGG - Intronic
1128603827 15:69019300-69019322 ATGTAGGTGTGGCTGTGAACCGG + Intronic
1129168966 15:73796441-73796463 GAGGAGGGGGGCCTCTGAGCTGG - Intergenic
1132077566 15:98835118-98835140 GTGTAGGGGTGGGTGTGTGTGGG - Intronic
1132077573 15:98835140-98835162 GTGTAGGGGTGGGTGTGTGTGGG - Intronic
1132479959 16:162497-162519 TTGTAGGGGACACTCTGAGCCGG - Intronic
1132484548 16:183756-183778 GTGTAGGAGTGGCTTTGAAAAGG - Intergenic
1134251726 16:12578779-12578801 GTGTAGGGCTGGCATGGAGCAGG - Intergenic
1137589153 16:49682854-49682876 GTGTATTGGCGGCTCTGAGTGGG + Intronic
1139078129 16:63480305-63480327 GCTTGGGGGTGGCTCTGAGAGGG - Intergenic
1139959658 16:70710310-70710332 GTGAAGGGGTGTCTCTGCCCTGG - Intronic
1140045747 16:71439481-71439503 ATTTGGGGGTGGTTCTGAGCTGG + Intergenic
1140423170 16:74837458-74837480 GTATAGGGGTGGCTCTAAAAAGG - Intergenic
1140878024 16:79171228-79171250 GTTTAGGGGTTGCTCAGAGGAGG + Intronic
1141145233 16:81524682-81524704 GTCGCTGGGTGGCTCTGAGCAGG - Intronic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1143709829 17:8726622-8726644 CTGTAGGGGTGGTGCTGAGGGGG + Intergenic
1143917989 17:10308858-10308880 TTATAGGTGTGGCGCTGAGCCGG + Intronic
1147400698 17:40178450-40178472 GCGTAGGGGTGGCGCCGTGCCGG + Intronic
1147656653 17:42094975-42094997 GTGTCAGGGTGGGTCTGACCTGG + Intergenic
1149559331 17:57596957-57596979 GTGTAGGGGTTGCGCTGAAATGG + Intronic
1149623736 17:58065011-58065033 GGGTTGGGGTGCCCCTGAGCTGG + Intergenic
1149659547 17:58327142-58327164 GGGTTGGGGTGGGTGTGAGCAGG - Intronic
1150292066 17:63987845-63987867 GTGTTGGGGTGGTTCTGAAAAGG - Intergenic
1151391631 17:73791186-73791208 GGGGAGGGGTAACTCTGAGCTGG - Intergenic
1152780148 17:82223965-82223987 GTGTAGGGGTGTCTGTGCACAGG - Intergenic
1152780152 17:82223987-82224009 GTGTAGGGGTGCGTCTGCACAGG - Intergenic
1152780169 17:82224083-82224105 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780173 17:82224105-82224127 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780180 17:82224141-82224163 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780184 17:82224163-82224185 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780191 17:82224199-82224221 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780195 17:82224221-82224243 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780201 17:82224255-82224277 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780205 17:82224277-82224299 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780211 17:82224311-82224333 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780216 17:82224345-82224367 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780222 17:82224379-82224401 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780226 17:82224401-82224423 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780232 17:82224434-82224456 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780236 17:82224456-82224478 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780242 17:82224490-82224512 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780248 17:82224524-82224546 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780258 17:82224579-82224601 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780262 17:82224601-82224623 GTGTAGGGGTGTGTCTGCACGGG - Intergenic
1152780268 17:82224635-82224657 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152780274 17:82224669-82224691 GTGTAGGGGTGTGTCTGCACAGG - Intergenic
1152878556 17:82802516-82802538 GTGTCGGCGAGGCTGTGAGCTGG + Intronic
1153810114 18:8744918-8744940 GGGAGGGGGTGGCCCTGAGCAGG + Intronic
1156295017 18:35781646-35781668 GTGGAGGACAGGCTCTGAGCGGG + Intergenic
1156549807 18:38003834-38003856 GTGTGGAGGTGGCTCTCAGCAGG - Intergenic
1156760088 18:40578276-40578298 GTGAAGGGGAGGCTGTGAGCCGG - Intergenic
1157581857 18:48778355-48778377 GTGCAGGGGAGGATGTGAGCAGG + Intronic
1158310440 18:56152240-56152262 GGGTAGCCCTGGCTCTGAGCTGG - Intergenic
1159136047 18:64338000-64338022 CTGAATGGGTGGGTCTGAGCAGG - Intergenic
1160779839 19:872823-872845 GTGTAGGGGTGGGGCTGAGAAGG + Intronic
1160842542 19:1152655-1152677 GTCCAGAGGGGGCTCTGAGCTGG - Intronic
1161157364 19:2739636-2739658 GTGCCTGGGTGGCTCTGCGCTGG - Intronic
1163763080 19:19147421-19147443 GTGTAGAGTTGGCACTGAGGGGG + Intronic
1166303457 19:41924706-41924728 GTGTGGGGGTGGCTGGGAACAGG + Intronic
925628846 2:5868562-5868584 GTGTGTGGGCTGCTCTGAGCAGG + Intergenic
927608732 2:24514663-24514685 GTGTTGGTGTGCCTCTGAGGTGG + Intronic
928171987 2:29010053-29010075 GTGTTGGGGGGGCGCAGAGCGGG + Intronic
928419129 2:31124000-31124022 GTGTAGCAGTGGCTCTCTGCTGG - Intronic
933752100 2:85609512-85609534 CAGTAGTGGAGGCTCTGAGCTGG - Exonic
935376117 2:102399513-102399535 GTCTAGGACTGGCTCTGAGGAGG + Intergenic
936154464 2:110039369-110039391 CTGTAGGGGTGCCCCTGACCTGG + Intergenic
936190218 2:110332045-110332067 CTGTAGGGGTGCCCCTGACCTGG - Intergenic
937392146 2:121498308-121498330 GTGGTGGGGTGGCCCTGAGGTGG - Intronic
938263326 2:129910235-129910257 GGCTTGGGGTGCCTCTGAGCTGG - Intergenic
944250006 2:197572419-197572441 ATGTGGAGGTAGCTCTGAGCTGG - Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945059487 2:205896335-205896357 GTGTAGGGGCTGATGTGAGCAGG - Intergenic
947160653 2:227210734-227210756 GTGGTGGGGTGGCTGTGAGAAGG - Intronic
947537302 2:230948277-230948299 GAGTGGGGGAGGCTCTGAGTGGG - Intronic
948643128 2:239387912-239387934 GTGGGGGTGTGGATCTGAGCTGG - Intronic
948921261 2:241066972-241066994 ATGTGCGGGTGGCACTGAGCAGG + Intronic
949023308 2:241753306-241753328 GTGTTGGCGAGGCTCTGGGCAGG + Intronic
949023317 2:241753357-241753379 GTGTTGGCGAGGCTCTGGGCAGG + Intronic
949023337 2:241753469-241753491 GTGTTGGCGAGGCTCTGGGCAGG + Intronic
949049145 2:241887919-241887941 GACTGGGGGTGGCTCTGAGGGGG + Intergenic
1169803237 20:9532773-9532795 GTGTAGGGGTGGGTTTTACCAGG + Intergenic
1172474373 20:35226449-35226471 GTCTGGGGGTAGCCCTGAGCAGG - Intergenic
1172955567 20:38755736-38755758 CTGGAGGCGTGGCTCTGGGCAGG + Intronic
1173256616 20:41398343-41398365 GTGTTGGGAGGCCTCTGAGCTGG - Intergenic
1173648003 20:44645690-44645712 GTGCAGGCCTGGCTCAGAGCAGG - Intronic
1173750054 20:45469679-45469701 GGGTAGGGGTGGAGCCGAGCGGG - Intergenic
1176035949 20:63036495-63036517 TAGGAGGAGTGGCTCTGAGCCGG + Intergenic
1177647453 21:23917723-23917745 TTGTGGAGGTGGCTCTCAGCAGG - Intergenic
1178699404 21:34820308-34820330 GGGTAGGTGTGGCTTTGAGGAGG + Intronic
1178891786 21:36526023-36526045 GTGAAGGGATATCTCTGAGCTGG - Intronic
1179164017 21:38921099-38921121 GTCTGGGGCTGGCTCTGGGCTGG - Intergenic
1179544698 21:42106266-42106288 GTGAAGGTGGGGCTCTCAGCGGG - Intronic
1180593330 22:16958349-16958371 GTCTAGAGGTGGTTCTGAGAGGG - Intergenic
1181314854 22:21964422-21964444 GGGTGACGGTGGCTCTGAGCAGG + Intronic
1182276714 22:29194371-29194393 TTGTAGGAGTGGATCAGAGCTGG + Intergenic
1183604334 22:38859951-38859973 GTGCAGCAGTGGCACTGAGCAGG + Intergenic
1184436888 22:44484672-44484694 GTGTTGGGATGGCTCAGAGAGGG + Intergenic
1184521947 22:44999841-44999863 GTGGGGCGCTGGCTCTGAGCAGG - Intronic
1185318919 22:50191268-50191290 GAGCAGGGACGGCTCTGAGCAGG - Intronic
1185377922 22:50490740-50490762 GTGGAGGGGCTGCTCTGTGCGGG - Intergenic
1185383846 22:50522646-50522668 GGGAAGGGGTAGCTGTGAGCTGG - Intronic
949535556 3:4993450-4993472 GTGTAGGGCTGGCCCTGCCCAGG - Intergenic
949873415 3:8608157-8608179 GTGTAGTTCTGGCTCTGGGCTGG - Intergenic
950499733 3:13355990-13356012 GTTTAGGGGTGGAACTCAGCTGG + Intronic
950816105 3:15704074-15704096 GTATAGGGCTGTCTTTGAGCAGG - Intronic
951670978 3:25181626-25181648 GGGTAGGGGTGGTTCTTAACAGG - Intronic
952884474 3:38003975-38003997 GGGTAGGGGAGGGCCTGAGCTGG - Intronic
954218860 3:49140077-49140099 GTATTGGGGTGACCCTGAGCAGG - Intergenic
954472202 3:50707662-50707684 CTGTAGTTGTGGGTCTGAGCTGG + Intronic
956219380 3:66885447-66885469 ATGCAGTGGTGACTCTGAGCAGG - Intergenic
956279063 3:67537201-67537223 GGGTAGGGGAGGGTCTGAGAGGG - Intronic
959206051 3:103308457-103308479 GTGTAGGGGAGGCATTGAGGTGG + Intergenic
959575024 3:107925120-107925142 TGGTAGAGGTGGCTCTCAGCAGG + Intergenic
960509526 3:118531651-118531673 GGCTTGGGGTGGCTCTGAGATGG - Intergenic
960672449 3:120166445-120166467 GTGTAGGGGTGGCTCTGAGCTGG + Exonic
961332878 3:126153395-126153417 GAGCATGGGTGGCTTTGAGCAGG + Intronic
961520376 3:127464289-127464311 GAGCCGGGGTGGCTCAGAGCCGG - Intergenic
961533113 3:127552031-127552053 GTGTGGGGGCTGCTCTGAGATGG - Intergenic
961591059 3:127982351-127982373 GAGGAGGTGTGGCTCTGGGCTGG - Intronic
962748340 3:138414249-138414271 TTGTGGGGCAGGCTCTGAGCTGG + Intergenic
966677971 3:182609794-182609816 GTGTACGGGTGGCTGAGAGTGGG - Intergenic
966994977 3:185270637-185270659 GTTTAGGGTTGGCTCTTAACAGG + Intronic
967819906 3:193831004-193831026 CTGTAGGGCTGTTTCTGAGCAGG + Intergenic
967900723 3:194449026-194449048 GTGTAGGGGTGGATCGGGGTAGG - Intronic
968652217 4:1764795-1764817 GTGCAGGGGAGGCTCTAAGGAGG - Intergenic
968926401 4:3550862-3550884 GTGGTGGGGTGGGTCTGGGCAGG + Intergenic
969299185 4:6287467-6287489 GTTGAGGGGTGGCACTGAGCAGG - Intronic
969532768 4:7739038-7739060 GTGTCTGGGAGGCGCTGAGCTGG - Intronic
972750474 4:41982833-41982855 GGGAAGGGATGGTTCTGAGCAGG - Exonic
974811960 4:66956722-66956744 GTGTAGTGGAGGCTCTGTGTGGG + Intergenic
976859078 4:89641015-89641037 TTGTGGAGGTGGCTCTCAGCGGG - Intergenic
978257147 4:106705985-106706007 GTGTAGGCCTGGCTCAGAGATGG + Intergenic
979727596 4:123982819-123982841 GTGTGGAGGTGGCTCTCAGCAGG + Intergenic
980175737 4:129341718-129341740 GTGTATGAGTGGCTGAGAGCAGG + Intergenic
983390460 4:167124292-167124314 GTGTAGGGGAGAATCTGAGTTGG - Intronic
983928477 4:173428080-173428102 GTGGAGGGGTGGAACAGAGCAGG + Intergenic
985037271 4:185853100-185853122 GTCTAGTGGTGACCCTGAGCTGG + Intronic
985487659 5:160808-160830 GAGTGGGGGTGGCGCAGAGCTGG - Intronic
986327501 5:6687268-6687290 GTGCAGCGCTGGCTCCGAGCTGG - Intergenic
986846538 5:11762981-11763003 GTGTTGGGGTGGATCTGAGTAGG + Intronic
987137394 5:14912729-14912751 GTGTGGGGGTGGCTCGTAGCCGG - Intergenic
987612312 5:20222008-20222030 GTGTAAGGGTGGTACTGATCTGG - Intronic
992571739 5:78065783-78065805 GTGGAGGGGTTGCTCTGTGCGGG - Intronic
993036931 5:82769142-82769164 GAGCAGGGGTGGCCCTGGGCTGG - Intergenic
996648075 5:125841139-125841161 TGGTGGGGGTGGCTCTCAGCAGG - Intergenic
997303684 5:132823948-132823970 GCCCAGGGGTGGCTCTGGGCTGG + Exonic
998781149 5:145658303-145658325 GTCTAGGGCTGGGTCTGTGCAGG - Intronic
999420443 5:151437186-151437208 GTTTAGGGGAGGCTCTGAGTTGG + Intronic
1000120156 5:158189653-158189675 TTGTAGGTGTGAGTCTGAGCAGG + Intergenic
1001209456 5:169796470-169796492 GTGTAGGGCTGGTCCTGAACTGG + Intronic
1002320290 5:178371479-178371501 GTGTAGGGGCGACTTTGAGGTGG - Intronic
1002535406 5:179873047-179873069 GGGTTGGGGTGGCTATGGGCAGG - Intronic
1005862231 6:29910716-29910738 GAGCAGGGGTGGCTCTCACCTGG - Intergenic
1007135324 6:39515463-39515485 GTGAAGGGGTGGCTGTAAGCCGG - Intronic
1007396169 6:41578949-41578971 GAGTATGGTTGGTTCTGAGCTGG + Intronic
1014696040 6:124622657-124622679 TAGTAGAGGTGGCTCTCAGCAGG + Intronic
1014825811 6:126047475-126047497 TGGTAGAGGTGGCTCTCAGCGGG - Intergenic
1016152518 6:140760381-140760403 CTGCAGAGATGGCTCTGAGCTGG + Intergenic
1017781316 6:157717508-157717530 GTGGAGCCATGGCTCTGAGCAGG - Intronic
1018050859 6:160006363-160006385 GTGTCTGGGAGGCACTGAGCAGG - Intronic
1018100807 6:160438036-160438058 GTTTAGAGATGGCTATGAGCAGG + Intronic
1018980581 6:168598922-168598944 GTGGAGGGGTGGCACTGCACTGG - Exonic
1019015879 6:168879007-168879029 GGGGAGGGGTAGCTCTGACCTGG - Intergenic
1019051470 6:169186833-169186855 GTCCAGGGGTAGCTCTGAGGTGG + Intergenic
1019636973 7:2081205-2081227 GAGGTGGGGAGGCTCTGAGCCGG + Intronic
1022220418 7:28308673-28308695 TTGTAGGGGTGGCTGTGAAGGGG - Intronic
1026635156 7:72075669-72075691 GTGCAGGGATGGAGCTGAGCAGG - Intronic
1032145979 7:129381224-129381246 GTGTAGGGGAGAGACTGAGCTGG - Intronic
1035341330 7:158164504-158164526 GCGTAGGGAGGGCTCAGAGCGGG + Intronic
1035436479 7:158863702-158863724 GTGTGGGGGGGGCGGTGAGCGGG + Intronic
1037262788 8:17027148-17027170 GTGTAGGGGTCGCTCTCGGCCGG + Intergenic
1039542108 8:38381511-38381533 GAGTCGGAGTGGCGCTGAGCTGG - Intronic
1040047053 8:42975037-42975059 GGGAAGGGGTGGCTCTGGGGTGG + Intronic
1041509033 8:58633853-58633875 GTGTCGGGCTGGTTTTGAGCTGG + Intronic
1047795582 8:128251963-128251985 GTGCACGGGTGGCTGTGAGTGGG - Intergenic
1053255063 9:36609964-36609986 GAGTTGGGGTGGCTCTGGGAGGG + Intronic
1054143872 9:61548580-61548602 GTGGTGGGGTGGGTCTGGGCAGG - Intergenic
1054463650 9:65479919-65479941 GTGGTGGGGTGGGTCTGGGCAGG - Intergenic
1054648757 9:67610195-67610217 GTGGTGGGGTGGGTCTGGGCAGG - Intergenic
1059359784 9:113733088-113733110 GTGAAGAGGTGGCTCTGTGGAGG + Intergenic
1061279990 9:129592370-129592392 GTGCAGGGGTGACTCTAAGAGGG + Intergenic
1061682728 9:132250898-132250920 GGGTTGGGGAGGCCCTGAGCAGG + Intergenic
1062384201 9:136302644-136302666 ATGAAGGGGTGCTTCTGAGCTGG - Intronic
1062535418 9:137019077-137019099 GTGGAGGGGCGGCTCAGAGGGGG + Intronic
1062590909 9:137274242-137274264 GGGTATGGGAGTCTCTGAGCTGG + Intergenic
1062631602 9:137465480-137465502 GGGCAGAGGTGGCTCCGAGCCGG - Intronic
1185547675 X:958519-958541 ATGTAGGGGTGTCTCTGTGTAGG + Intergenic
1187527909 X:20070583-20070605 GGGAAGGGGTGGCTCTGACATGG - Intronic
1192285087 X:69727070-69727092 GTGGTGGAGTGGCTCTCAGCAGG + Intronic
1199445078 X:147911958-147911980 GTGGAGGGCCGCCTCTGAGCGGG + Intronic