ID: 960672691

View in Genome Browser
Species Human (GRCh38)
Location 3:120167925-120167947
Sequence CTCTTTCTGGTAGGAGACTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960672686_960672691 3 Left 960672686 3:120167899-120167921 CCTCTGTCTCTGGGGATCTGAGC 0: 1
1: 1
2: 4
3: 20
4: 257
Right 960672691 3:120167925-120167947 CTCTTTCTGGTAGGAGACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 175
960672681_960672691 22 Left 960672681 3:120167880-120167902 CCTCTGAGTTCTCCAGATGCCTC 0: 1
1: 0
2: 3
3: 21
4: 237
Right 960672691 3:120167925-120167947 CTCTTTCTGGTAGGAGACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 175
960672685_960672691 10 Left 960672685 3:120167892-120167914 CCAGATGCCTCTGTCTCTGGGGA 0: 1
1: 0
2: 1
3: 45
4: 310
Right 960672691 3:120167925-120167947 CTCTTTCTGGTAGGAGACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960672691 Original CRISPR CTCTTTCTGGTAGGAGACTC TGG Exonic
901337916 1:8467440-8467462 CTCTTTCTAACAGAAGACTCCGG + Intronic
901943828 1:12684885-12684907 CTGTTTCTGGTGGGAGACCCAGG + Intergenic
904659750 1:32075546-32075568 CCCTTCCTGGTAGGATTCTCAGG + Intronic
904746981 1:32717360-32717382 CTCTTTAAGGCAGGAGGCTCTGG - Intergenic
905989882 1:42327287-42327309 CTCTTTCTGCTAGGATAGTTGGG - Intronic
909311528 1:74156271-74156293 CTGTTTCTGGTAAGGGCCTCAGG - Intronic
911144849 1:94541926-94541948 CTCCTCCCGGTAGGAAACTCCGG + Intergenic
914505560 1:148286288-148286310 AACTTGCTGGTCGGAGACTCAGG + Intergenic
914507001 1:148297863-148297885 AACTTGCTGGTCGGAGACTCAGG - Intergenic
914954229 1:152146672-152146694 CTCTTTCTGGTGAGACCCTCAGG + Intergenic
916311721 1:163405930-163405952 CTATTCATGGTAGGGGACTCAGG + Intergenic
917522041 1:175755943-175755965 ATCTAGCTGGTAGGAGACTGAGG - Intergenic
918175953 1:182045398-182045420 GTCTTGCTGGTCTGAGACTCCGG - Intergenic
918452171 1:184669987-184670009 CTCTGACTGGTAGGGGTCTCAGG + Intergenic
920966752 1:210707394-210707416 CTCTATCTGGGAGGAGACTCTGG - Intronic
1062942917 10:1438260-1438282 CTCTGTCTTGGGGGAGACTCAGG - Intronic
1062943007 10:1438670-1438692 CTCTATCCGGGGGGAGACTCAGG - Intronic
1063954136 10:11250363-11250385 CTCTCTCTAGGAGGAGACTTTGG + Intronic
1069987435 10:72293927-72293949 CTTTTTTAGGTAGGAGACTGGGG - Intergenic
1073799333 10:107024257-107024279 CTTCTTCTGGTAAGAGAATCAGG + Intronic
1081606436 11:44530019-44530041 CTTTTTCAGGTAGGAGAAACAGG - Intergenic
1083178310 11:60967110-60967132 TTCCTTCTGGTGGGAGAGTCGGG + Intergenic
1083560595 11:63670844-63670866 CCCTCTCTGGTCGGAGAATCGGG - Intronic
1084361312 11:68670122-68670144 CTCTTCCTGGGAGGGGCCTCAGG - Intergenic
1086368606 11:86133799-86133821 TTCTTGCTGGTAAGGGACTCAGG - Intergenic
1086943901 11:92826139-92826161 GTCTTTCTTGCAGGAGACACAGG - Intronic
1087074813 11:94119317-94119339 GTCTTTCTGGTTGGTGAGTCTGG - Intergenic
1090599255 11:128353435-128353457 CTCCTTCTGGTGAGGGACTCAGG - Intergenic
1091124168 11:133081745-133081767 CTCCTTCTAGAAGGAGATTCTGG - Intronic
1091548345 12:1519163-1519185 CTCTGCCTGGGAGGAGCCTCAGG - Intergenic
1095705730 12:45235176-45235198 CTCCTTCCTGTAGCAGACTCTGG + Intronic
1095892735 12:47249897-47249919 CTCTTCCTGGAAACAGACTCAGG + Intergenic
1096418765 12:51437585-51437607 CTGCTTCTGGTAAGAGAGTCAGG - Intronic
1097222099 12:57457003-57457025 CACTTTCTTGTCTGAGACTCTGG + Exonic
1100287474 12:93181320-93181342 CTCCTTTTGATAGGAGACTGAGG - Intergenic
1101266340 12:103092249-103092271 CGCTTTCTGGTAGGATGTTCCGG + Intergenic
1102302268 12:111779577-111779599 TTCTTTATGGTCCGAGACTCTGG + Intronic
1104140602 12:125983444-125983466 CTCTTTCTGGGAGGAGCCTGGGG - Intergenic
1104182042 12:126391040-126391062 CTCTTCCTGGCAGGATCCTCAGG - Intergenic
1110237401 13:73231105-73231127 CTATTTTTGGAAGGAGAATCAGG - Intergenic
1110945590 13:81411508-81411530 ATCTTTCTGGCAGGACACTGTGG + Intergenic
1111796947 13:92933579-92933601 CCCTTTCTGGTTGGAGAATAAGG - Intergenic
1112100228 13:96180324-96180346 CTCTTCCTGGTAGGAAAAACTGG - Intronic
1113865382 13:113518922-113518944 CTCTTTCTGGATAGAGATTCAGG - Intronic
1114875125 14:26707127-26707149 CTCTGTCTCCTAGGAGACTATGG - Intergenic
1115111445 14:29828236-29828258 CTGTTTCTGGTAAGGGCCTCAGG + Intronic
1116864113 14:50017483-50017505 TTCTTTCTGCAAGGAGTCTCAGG + Intergenic
1118721762 14:68599465-68599487 CTCTTCCAGGTTGCAGACTCAGG + Intronic
1121289744 14:92764294-92764316 CTCTTTGGTGTTGGAGACTCAGG + Intergenic
1121291449 14:92779206-92779228 CTCTTTGGTGTTGGAGACTCAGG - Intergenic
1121621901 14:95356142-95356164 GTCATTCTGGTGGGGGACTCAGG - Intergenic
1121780897 14:96621929-96621951 CTCTCTCTGGAAGGAAACTCTGG - Intergenic
1122458950 14:101879531-101879553 CTATGCCTGGCAGGAGACTCTGG - Intronic
1125860337 15:42993092-42993114 CTCTTTCTGGTCAGAGGATCAGG - Intronic
1126758427 15:51947004-51947026 CTGTCTCTGGTAGGTCACTCCGG - Intronic
1127305228 15:57699156-57699178 CTCTTTCTGATTGGAGAAACAGG - Intronic
1128222363 15:65978279-65978301 CTCTCCCTGGGAGGAGCCTCAGG + Intronic
1128414979 15:67436676-67436698 CTCTGCCTGGAAAGAGACTCGGG + Intronic
1130786392 15:87101232-87101254 TTCTTTCTGGTAGAAGTTTCTGG - Intergenic
1131061329 15:89406433-89406455 CTCTTTGGCGCAGGAGACTCAGG + Intergenic
1131339749 15:91586881-91586903 CTCTCTCTTGCAGGAGAGTCTGG + Intergenic
1131657962 15:94481614-94481636 CTCTTTGGGGCAGGAGACTTTGG - Exonic
1132455999 16:23254-23276 TTCTTTCTGGGAAGAGACCCTGG + Intergenic
1136671590 16:31863402-31863424 CCCATTCTTGTAGGAAACTCTGG - Intergenic
1137601416 16:49758899-49758921 TTCTTTCTGGAAGGAGAAACAGG + Intronic
1137700876 16:50496847-50496869 CTATTTCTGGTGAGAGCCTCAGG - Intergenic
1138387961 16:56648996-56649018 CCCTTTCTGGTAAGTGATTCTGG + Intronic
1141838176 16:86556414-86556436 CTTTCTCTGCTGGGAGACTCAGG - Intergenic
1142200360 16:88758161-88758183 CTCCTTGTGGGAGGAGAGTCCGG - Intronic
1143427705 17:6853407-6853429 CTATGTCTGATAGGGGACTCAGG + Intergenic
1143681902 17:8481964-8481986 CTCTTTCTTGAAGGGGACTGTGG + Intronic
1146015534 17:29230339-29230361 CCCTTTCTGGAAGGTGATTCTGG - Intergenic
1146885451 17:36467594-36467616 CTCTTTTTCCCAGGAGACTCAGG - Intergenic
1151802886 17:76387988-76388010 GTCATTCTGGTGGGGGACTCAGG + Intergenic
1152844441 17:82591204-82591226 GTCTTCCTGGAAGGTGACTCTGG + Intronic
1153777455 18:8466516-8466538 TTCTTTCTGTTAGGATACTTTGG - Intergenic
1156487268 18:37474411-37474433 GTTCTTCTGGCAGGAGACTCTGG - Intronic
1164127361 19:22330733-22330755 TTCATACAGGTAGGAGACTCAGG + Intergenic
925397848 2:3549535-3549557 CTCATTCTTTTAGGAAACTCTGG - Intronic
927872003 2:26629616-26629638 CTCTTTGAGGAAGGAGACTTGGG + Intronic
928410425 2:31050027-31050049 CTCTTTGTGGTCAGAGAATCTGG - Intronic
928470868 2:31574176-31574198 CTCTTTCTGGTGTGAAACTTGGG - Intronic
929789280 2:45011699-45011721 CACTTCCTGGTATGAGACCCTGG + Intergenic
930105493 2:47635839-47635861 CTCTCTGAGGCAGGAGACTCAGG - Intergenic
932301699 2:70671894-70671916 CTCTGTCTGGTGGGGGTCTCCGG + Intronic
932422237 2:71608102-71608124 GTCCTTCGGGTAGGGGACTCTGG + Intronic
933490380 2:82978554-82978576 CTGTTTCTGGTATGGGTCTCAGG - Intergenic
935529122 2:104211393-104211415 CTGCATCTGGTAGGAAACTCAGG + Intergenic
941953566 2:171181551-171181573 CTGCTTCTGGTAAGAGCCTCAGG + Intronic
942643304 2:178083591-178083613 CACTTTCTGGTAGGGGTCTTTGG - Intronic
942864707 2:180659335-180659357 CTCTTACTGGTAGGTGTATCAGG - Intergenic
944656046 2:201877562-201877584 ATCTCTCTGGAAGGAGACTCAGG - Intronic
944745800 2:202654341-202654363 CTCTATCTGTTTGGAGGCTCTGG + Intronic
945703242 2:213198065-213198087 CTCCATCTTGAAGGAGACTCTGG - Intergenic
945920426 2:215749724-215749746 CTCTTTCTGCTTGGAAGCTCAGG - Intergenic
948627690 2:239279198-239279220 CTGTTTCTCCCAGGAGACTCTGG + Intronic
948905741 2:240978760-240978782 GTCTCTGTGGTAGGAGCCTCAGG + Intronic
948906217 2:240980695-240980717 GTCTCTGTGGTAGGAGCCTCAGG + Intronic
948948412 2:241233571-241233593 CATTTTCTGGAAGGAGACGCAGG + Intronic
1170718944 20:18858425-18858447 CTCATTCTGGTAAGGGCCTCAGG - Intergenic
1171390018 20:24795292-24795314 GTCTTTCTAGCAGGACACTCTGG - Intergenic
1174886965 20:54346462-54346484 CCCTTTCTGGTAGGAGAAAGAGG + Intergenic
1175422058 20:58840797-58840819 CCCTTTTTGGAAGGGGACTCCGG - Intronic
1178089637 21:29149129-29149151 CTCTTTCTTGTAGGAGTCCTTGG - Intronic
1178524619 21:33316605-33316627 TTCTTTCTGGGAGGAGAGTTTGG - Intergenic
1183084971 22:35481099-35481121 CTCATCCTGGGAGGAGACTGTGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1184699752 22:46162668-46162690 CTCTTGCTGGTAGGTGCTTCAGG + Intronic
1185119306 22:48956268-48956290 CCCTGTCTGGGAGGAGCCTCTGG - Intergenic
949429429 3:3958323-3958345 CTTTTTCTGGTAAGAGAACCAGG - Intronic
950539021 3:13599062-13599084 CTCTCTCTGGAGTGAGACTCAGG - Intronic
952117287 3:30198009-30198031 CTCTTTCTGGGATGAGACAGGGG + Intergenic
953476014 3:43206425-43206447 GTCTTTCTGGTAGGTGAGACGGG - Intergenic
953507551 3:43501148-43501170 CTCCATCTGGTGGGAGCCTCAGG + Intronic
955981033 3:64528223-64528245 CTCTTCCAGGTAGAAGATTCTGG - Intronic
956153791 3:66272238-66272260 CCCTTACTGGTATGAGACCCTGG - Intronic
959321208 3:104877608-104877630 CTGCTTCTGGTGGGAAACTCAGG - Intergenic
960672691 3:120167925-120167947 CTCTTTCTGGTAGGAGACTCTGG + Exonic
962899253 3:139744168-139744190 CACTTTCTGGAAGGAGAATTTGG - Intergenic
964172029 3:153782483-153782505 CTTTTTCTGCTATTAGACTCTGG + Intergenic
964670305 3:159217916-159217938 TTCTTTCTAGTGGGAGATTCAGG - Intronic
965081885 3:164043873-164043895 CTATTTATTGTAGGACACTCTGG - Intergenic
966727730 3:183122689-183122711 CACTCTCTGGAAGGAGACTGAGG - Exonic
968945020 4:3659008-3659030 CCCTTTCTGGCTGGGGACTCAGG - Intergenic
970199782 4:13592145-13592167 CTTTTTCTGGTAGTATATTCTGG - Intronic
970367091 4:15371074-15371096 CTCTTTCTAGGAAGAGACTGAGG + Intronic
972647268 4:40980982-40981004 ATCTCTCTGGGATGAGACTCAGG + Intronic
975303168 4:72815965-72815987 CCCTTGCAGGTAGGAGACTATGG - Intergenic
977198081 4:94085662-94085684 CTGGTTCTGGAATGAGACTCGGG + Intergenic
980708215 4:136527485-136527507 CTCTGTATGGTAGGATGCTCTGG - Intergenic
982586500 4:157247756-157247778 CTCATTCTGGTGTGAAACTCTGG - Intronic
982888611 4:160818385-160818407 TTCTTTCTGGTGGCAGAGTCTGG + Intergenic
985865036 5:2507909-2507931 CTCTTTCTTGCAGAACACTCTGG + Intergenic
987925422 5:24335179-24335201 CTATTTCAGGTAGGAGATGCAGG - Intergenic
988507792 5:31839019-31839041 CTCTTTCTGGTGAGAGCTTCTGG - Intronic
991210396 5:64097838-64097860 CTCTTTATGGTAGGAGGTACAGG + Intergenic
994276913 5:97849784-97849806 CTCTTTCTGTTAGGATGCTAGGG + Intergenic
1000600315 5:163266022-163266044 CTCTTTCTTCTACGAGACTGAGG - Intergenic
1000665586 5:163992285-163992307 CTCTTCCTGGTAGGATAAACAGG + Intergenic
1001548306 5:172584316-172584338 CTCTTCCTGGAAGGAGAGCCAGG + Intergenic
1002170387 5:177371238-177371260 CTCTTCCAGGTAGGGGACGCTGG + Exonic
1006101942 6:31690859-31690881 CTCTTTCAGGAAGGGGACTATGG + Intronic
1007464054 6:42039586-42039608 CTCGCTCTTGTATGAGACTCAGG - Intronic
1008179975 6:48316343-48316365 CTACTTTTGGTAGGAGAATCTGG + Intergenic
1009423906 6:63493182-63493204 CTCTATCTGTTAGGAGAATTAGG + Intergenic
1010021327 6:71163100-71163122 TTCTTTCTGGTTGGGTACTCAGG - Intergenic
1010034770 6:71312063-71312085 CTCTTTCAGGAAGAGGACTCTGG - Intergenic
1013144573 6:107375702-107375724 CTCTTTCTGGTTTTAGTCTCAGG - Intronic
1013218317 6:108052075-108052097 CTATTTCTTGTAGCAGACTAAGG - Intronic
1016331728 6:142959723-142959745 CTCTTTCAGGTTGCAGACTCTGG - Intergenic
1016803470 6:148189783-148189805 CACTGTCTGGTAGGACACTCTGG + Intergenic
1019834695 7:3371101-3371123 CTCTTCCTGCTCTGAGACTCAGG - Intronic
1019898273 7:3999926-3999948 CTCTTTGTTGTACAAGACTCGGG - Intronic
1021142275 7:17041570-17041592 CTCTTCCTGGAATGAGACACTGG + Intergenic
1023618348 7:42044127-42044149 TTCTTTCTAGTCCGAGACTCAGG + Intronic
1026329735 7:69341373-69341395 CTCATTCTGGAATGAGCCTCAGG - Intergenic
1026510231 7:71021334-71021356 CTCTTTCTGGTAGGAGAACAGGG + Intergenic
1028907729 7:96173832-96173854 CTATTTTTGGTAGCAGGCTCAGG - Intronic
1029819745 7:103134798-103134820 CTCTCTTTGGTTGGAGACACAGG - Intronic
1034996589 7:155581149-155581171 ATTGTTCTGGGAGGAGACTCAGG + Intergenic
1036668831 8:10766273-10766295 CTGTTTCTGATGGGAGATTCTGG - Intronic
1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG + Intronic
1040848567 8:51873750-51873772 CTCATGCTGGAAGGTGACTCGGG - Intronic
1041152983 8:54955541-54955563 TTCTTTGTGGTAGGAGATGCAGG + Intergenic
1041884906 8:62797506-62797528 CACTGTCTGGCAGGAGACACAGG - Intronic
1044182348 8:89211470-89211492 CACTTGCTGGTCTGAGACTCAGG + Intergenic
1046117476 8:109801352-109801374 ATCTTTCTGGTTGGAGATTATGG + Intergenic
1048328924 8:133459211-133459233 ATCTTTGGGGTAGGAGCCTCTGG + Exonic
1051183959 9:14439586-14439608 CTCTTTCTGGCCTGAGGCTCAGG - Intergenic
1051229695 9:14943065-14943087 CTGTTTCTGGTAAGGGCCTCAGG + Intergenic
1051724474 9:20074695-20074717 CTCTTTCCGGTAGAAGACACAGG + Intergenic
1053466121 9:38309939-38309961 CTCCTTCTGGTTGGAGAGGCTGG + Intergenic
1058387254 9:104452140-104452162 CTGTCTCTGTTAGCAGACTCTGG + Intergenic
1058743776 9:107969735-107969757 CTCTTTCTGGGAGGAGGGTTTGG - Intergenic
1059435027 9:114270844-114270866 GTGTTTCTGGGAGGAGACTTAGG - Intronic
1062708443 9:137958042-137958064 CTCTATCTGGTACCAGATTCTGG + Intronic
1186090144 X:6038149-6038171 CTGTTCCTGGTAGGAGAGTCTGG + Intronic
1187473879 X:19592595-19592617 CTCTTACTGGGAGGAGTATCAGG - Intronic
1187677941 X:21736800-21736822 CTCTTTCTCCTAGGAGACCCTGG - Intronic
1189711508 X:43817515-43817537 CTCTGACTGCTAGGAGATTCTGG - Intronic
1190644183 X:52509710-52509732 CCCATTCTTGTAGGACACTCTGG - Intergenic
1191226295 X:58048054-58048076 AACTTGCTGGTATGAGACTCAGG + Intergenic
1193980245 X:88173953-88173975 ATCTTGCTGGTCTGAGACTCAGG - Intergenic
1195754637 X:108188668-108188690 CTTTTTCTCCCAGGAGACTCAGG - Exonic
1200400370 X:156016471-156016493 TTCTTTCTGGGAAGAGACCCTGG - Intergenic
1200838254 Y:7754022-7754044 AACTTTCTGGTCTGAGACTCAGG + Intergenic
1201506981 Y:14712613-14712635 CTGTTTCTGGTAGGCCAGTCTGG - Intronic