ID: 960673463

View in Genome Browser
Species Human (GRCh38)
Location 3:120173378-120173400
Sequence CTGGGTATGGAAGCTTTTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960673450_960673463 26 Left 960673450 3:120173329-120173351 CCATGGAGCTTTTCTCTCCCCTC 0: 1
1: 3
2: 3
3: 26
4: 378
Right 960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 155
960673456_960673463 7 Left 960673456 3:120173348-120173370 CCTCGGGTGGCAGTTCTCCTCCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 155
960673455_960673463 8 Left 960673455 3:120173347-120173369 CCCTCGGGTGGCAGTTCTCCTCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 155
960673459_960673463 -10 Left 960673459 3:120173365-120173387 CCTCCTCACCATACTGGGTATGG 0: 1
1: 0
2: 1
3: 19
4: 109
Right 960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 155
960673454_960673463 9 Left 960673454 3:120173346-120173368 CCCCTCGGGTGGCAGTTCTCCTC 0: 1
1: 0
2: 1
3: 2
4: 84
Right 960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960673463 Original CRISPR CTGGGTATGGAAGCTTTTGT TGG Exonic
901881058 1:12194063-12194085 CTTGTTCAGGAAGCTTTTGTGGG + Intronic
905852038 1:41281687-41281709 CTGGGTTTGGAGGCTTGTGGGGG + Intergenic
907658515 1:56370066-56370088 CTCGGTTTGGTAGCTTTTATCGG + Intergenic
908675269 1:66596374-66596396 CTGGGTCTGGGACCTTTTATGGG + Intronic
909630456 1:77764896-77764918 CTGGGTATGGAGGCTCATGCCGG - Intergenic
910511466 1:88011202-88011224 CTGGTTATGGAAACTTTTTTAGG + Intergenic
912129423 1:106583061-106583083 CTGGTTCTGGAAGCTTCTCTGGG - Intergenic
914414824 1:147469708-147469730 CTGGGTAGGGAAGGTTCTCTTGG + Intergenic
920101416 1:203519326-203519348 CTGGGAAGGTAAGCTTTTGGGGG - Intergenic
920539604 1:206768272-206768294 CTTGGAATGGAAGCTTCTGTTGG + Exonic
920790949 1:209091262-209091284 CTGTATATAGAAACTTTTGTAGG + Intergenic
921466892 1:215499095-215499117 CTGGATTTGGAAGTTTTAGTGGG + Intergenic
924047362 1:240045448-240045470 GTTGGTATGCAAGCTTTGGTTGG - Intronic
1065734688 10:28740912-28740934 GTGGGTATGGAGGAGTTTGTGGG + Intergenic
1066192960 10:33072592-33072614 TTGGGTCTGGAAGCAGTTGTGGG - Intergenic
1070160024 10:73860799-73860821 CTGGGCATGGAGCATTTTGTGGG - Intronic
1081274998 11:41137325-41137347 CTGGGTATAGAATCTTTTAAGGG - Intronic
1081379112 11:42393345-42393367 CTCTGGATGGAAGCTGTTGTGGG + Intergenic
1081909624 11:46692524-46692546 CTGGTTAGGGAAGCTGTTGGGGG + Intronic
1082631376 11:55546083-55546105 CTGGGTATGGCAGCACTTGCTGG - Intergenic
1083266808 11:61550650-61550672 CTGGAAATGGAGGCTTTTGCTGG - Intronic
1088727672 11:112653940-112653962 CTGTGTAAGGAAGCCTTAGTAGG + Intergenic
1089350497 11:117819229-117819251 CTGGGCCTGCAAGCTTTTGAGGG - Intronic
1089472753 11:118734045-118734067 CTGGGTATGGTTGCTTCTGCCGG + Intergenic
1092926996 12:13280314-13280336 CTGGGCATGGAAGGTTTGGGGGG + Intergenic
1093213483 12:16335034-16335056 CTTGGTAGGAAAGCCTTTGTTGG + Intergenic
1095989381 12:48023998-48024020 TTGGGTCTGGAGCCTTTTGTAGG - Intronic
1096474736 12:51901402-51901424 CTGGACAGGGCAGCTTTTGTTGG - Intergenic
1096846459 12:54409681-54409703 CAGGGCTTGGAAGCGTTTGTTGG - Intronic
1100882725 12:99036388-99036410 CTGTGTAAGGAAGGTATTGTGGG - Intronic
1101184403 12:102259069-102259091 CTAGGTCTGGAAGAGTTTGTGGG + Intergenic
1104568625 12:129905949-129905971 TTTGGTATGGAAGATTTTTTGGG + Intergenic
1105478783 13:20754237-20754259 CTGGGTATAGAATCTTTTGTTGG + Intronic
1106366766 13:29089224-29089246 CTGGGTATGAAATTCTTTGTTGG + Intronic
1107485709 13:40825482-40825504 CTGGGAGTGGAAGCCTTTATTGG - Intergenic
1109271992 13:60266296-60266318 CTGAGTATGGAGGCAATTGTGGG + Intergenic
1109378702 13:61528665-61528687 CAAGGTATGAAACCTTTTGTTGG + Intergenic
1114887672 14:26874013-26874035 CTTGGTATGGAAGATGGTGTTGG - Intergenic
1120263431 14:82218231-82218253 CTGGGGATGGGAGCTTTTTCAGG - Intergenic
1121168206 14:91829650-91829672 CTGGTTTTTCAAGCTTTTGTAGG + Intronic
1121304868 14:92899754-92899776 CTCGGGATGTAAGCATTTGTGGG + Intergenic
1122085784 14:99302305-99302327 CTGGATATGGAATTTTTTGTTGG - Intergenic
1125872733 15:43116960-43116982 CTGGCTTTGGAAATTTTTGTGGG - Intronic
1131307738 15:91260131-91260153 CTGGGGATGGAAGCTTGTCCTGG + Intronic
1132765201 16:1530990-1531012 CTGGGTCTGGACGCTTCTGGCGG - Intronic
1134266795 16:12699994-12700016 CTGGGCTTGGAAGCTCATGTAGG - Intronic
1135385614 16:22036983-22037005 CTGATTTTGGAAGCTATTGTAGG + Intronic
1139155690 16:64438897-64438919 ATGGGTATGGATTCTTTTGGGGG + Intergenic
1140890979 16:79285070-79285092 ATAGGTATGGAAGGTTTTCTGGG - Intergenic
1145104785 17:20105870-20105892 CTGGGGATGGAGGCTGTGGTGGG + Intronic
1145127266 17:20312232-20312254 CTGGGTCTGGTATCTTTTGGAGG + Intronic
1146929920 17:36769550-36769572 CTGGGTCTGGAATCTTTGTTCGG - Intergenic
1147644588 17:42026314-42026336 CTGGTTCTGAAAGCTTTTGGGGG - Intronic
1148445034 17:47732565-47732587 CAGGGTAGGGGAGCTTTTGTGGG + Intergenic
1150986414 17:70202777-70202799 CTGAGTAGGAAACCTTTTGTGGG + Intergenic
1151488710 17:74419031-74419053 CTGAGTATGGAATCCTTGGTGGG - Intergenic
1154388024 18:13913128-13913150 CCGAGAATGGAAGCTTTTGCAGG + Intronic
1155131746 18:22941720-22941742 CAGAGTATAGAAACTTTTGTGGG - Intronic
1155889234 18:31246046-31246068 CGGGGAATGGAAGCTTCTTTTGG + Intergenic
1157164440 18:45345465-45345487 CTTTGTAGGGAAGCTTTTGCAGG - Intronic
1157956848 18:52108211-52108233 GAGGGTATGGAAGATTTTTTTGG - Intergenic
1158020957 18:52840997-52841019 CTGGGTGTGGAAGCTGATTTAGG + Intronic
1158174426 18:54638378-54638400 CTTGGTAGTGAAGCTTTAGTTGG - Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1160978067 19:1803517-1803539 CTGAGCAAGGAGGCTTTTGTGGG - Intronic
1164635443 19:29787948-29787970 CTAGGAATGGAGGCTTCTGTGGG + Intergenic
1165801295 19:38552227-38552249 CTGGGCATGGTAGCTTATGCTGG - Intronic
927860184 2:26555861-26555883 ATAGGTATGGAAGAGTTTGTGGG - Intronic
930442316 2:51424775-51424797 AGGGGTATTAAAGCTTTTGTGGG + Intergenic
930750246 2:54927560-54927582 CTGAATATGGAAGCTTTTTCTGG + Intronic
932560000 2:72859121-72859143 CTGGGCATGGTAGCATGTGTTGG - Intergenic
941950771 2:171154045-171154067 CTGGGTATGGTGGCATATGTCGG - Intronic
944945702 2:204682171-204682193 CTGGGTACGTATGCTTATGTAGG + Intronic
946718430 2:222578236-222578258 CTGGGTAAAGAACCATTTGTTGG - Intronic
947947063 2:234114059-234114081 CTTTGTATGGTAACTTTTGTTGG + Intergenic
948362838 2:237434972-237434994 CTGGGTCTGGAAGGATGTGTGGG + Intergenic
948403451 2:237701068-237701090 CTGAGCATTGAAGCTTTTCTGGG - Intronic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1172583930 20:36069314-36069336 CTGGTTATGGCATCTTTTGGGGG - Intergenic
1176844235 21:13864463-13864485 CTGAGAATGCAAGCTATTGTTGG - Intergenic
1178259938 21:31089370-31089392 CTGGGTGTGGTAGCTCATGTCGG - Intergenic
1178873641 21:36395859-36395881 CTGGGTAGGGCAGTTGTTGTTGG + Intronic
1179478357 21:41662254-41662276 CTGGGGACAGAGGCTTTTGTAGG - Intergenic
1182448180 22:30402081-30402103 GATGGTATGGAAGCTTTTTTGGG - Intronic
1184387853 22:44186479-44186501 CTGGGTATGGAAGATGGTGTAGG - Intronic
952886619 3:38016399-38016421 TTGGGTATGGAAGCTGGTTTAGG - Intronic
955336249 3:58088657-58088679 CTGGACAGGGGAGCTTTTGTTGG - Intronic
956474095 3:69600890-69600912 CTGGGTATGGAAGAATGCGTAGG + Intergenic
957445463 3:80309356-80309378 CTGAGTATGGAGGCAATTGTGGG - Intergenic
957791177 3:84942889-84942911 CTGTGTATAGCAGCTTATGTTGG + Intergenic
958014664 3:87925309-87925331 CTGGTTGTGGAGGCTGTTGTGGG + Intergenic
959128584 3:102322086-102322108 CTGGGTATAAAATTTTTTGTTGG + Intronic
960173430 3:114490052-114490074 CTAGGTCTGGAAGCTGTTTTTGG + Intronic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
962154677 3:132933678-132933700 CTGGATATGGAAGGTGATGTCGG - Intergenic
962969675 3:140387283-140387305 CTGGATTTTGAAGCTTGTGTAGG + Intronic
964917031 3:161851627-161851649 CTGAGTATGGATGCAATTGTGGG + Intergenic
965903841 3:173678064-173678086 CTGTATATGGAAGCATTTATGGG + Intronic
970431579 4:15993671-15993693 CTGAGTATAGACGTTTTTGTGGG - Intronic
973151375 4:46892612-46892634 CTGATTATGGAAGTTTATGTGGG - Intronic
973186726 4:47338361-47338383 TTGGGAATGTAAGCTTTTGACGG - Intronic
973735822 4:53870652-53870674 CTGGGGATGGAAATTTTTATTGG + Intronic
974968974 4:68802303-68802325 CTGAGTATGGAGGCAATTGTGGG - Intergenic
975267351 4:72386125-72386147 CTGAGTATGGAAGCTTTTCAAGG - Intronic
976025008 4:80676165-80676187 CTTGGAATGGAATCTTTTATGGG + Intronic
976741175 4:88359114-88359136 GTTGGTATTTAAGCTTTTGTGGG - Intergenic
979696713 4:123621163-123621185 CTGCGTAGGGTAGCTTTTTTAGG - Intergenic
979754927 4:124328417-124328439 CTGAAAATGGAAGCTTTTCTGGG + Intergenic
980868198 4:138578463-138578485 CTGGGTATGGTATTTTCTGTTGG - Intergenic
981514066 4:145588072-145588094 CTGGGGATTGAGGCTGTTGTTGG - Intergenic
982222779 4:153139275-153139297 CGGGGTATGGAATCTTCTGGGGG - Intergenic
983700718 4:170590511-170590533 CTGGGTTTTTAAGATTTTGTTGG + Intergenic
986221163 5:5770333-5770355 CTGGGTGTGGAGGGTTTGGTGGG + Intergenic
991370456 5:65913898-65913920 CTGTGAATGGAAACTTCTGTTGG + Intergenic
991971767 5:72148349-72148371 CTGGGTATGGGCCCTTCTGTGGG - Intronic
992570959 5:78056926-78056948 TTGGCTATGGCAGCATTTGTTGG + Intronic
992589122 5:78275237-78275259 CTGGGTATGGAATTCTATGTTGG - Intronic
994550418 5:101227724-101227746 CTGGTCCTGGAAGTTTTTGTTGG + Intergenic
998494839 5:142579436-142579458 CTGGGTATGGAAATTTCAGTTGG - Intergenic
1001927232 5:175647208-175647230 CTGGGAATGGAAGCATGGGTTGG - Intergenic
1002308132 5:178296404-178296426 CTGGGCATGGTAGCCTTTCTGGG - Intronic
1002815103 6:672540-672562 CTAGGAATGGAAGTTTCTGTGGG - Intronic
1003291851 6:4786695-4786717 CTGGTTGTGGGAGCATTTGTAGG + Intronic
1008073001 6:47116681-47116703 CTGGGTAGGGAAACTATTGCAGG + Intergenic
1009333296 6:62453292-62453314 CTGGGTCTGGAGCTTTTTGTAGG + Intergenic
1014202154 6:118619476-118619498 CTGAGTATGGAGGCAATTGTGGG - Intronic
1015365717 6:132395175-132395197 CTGGGTATGGTATCCTTGGTTGG - Intronic
1015499861 6:133920863-133920885 CTAGGTGTGGCACCTTTTGTGGG - Intergenic
1018472336 6:164107925-164107947 CTGGTCTTGGAAGCTTTTGTGGG + Intergenic
1019016051 6:168880235-168880257 CTGGATATGGAACCTATTCTGGG - Intergenic
1021565645 7:22014144-22014166 ATGGGAATGGAAGTTTTTATGGG + Intergenic
1022045702 7:26620631-26620653 CTGGGTCTGGAAGGCTTTGAGGG - Intergenic
1022811126 7:33870003-33870025 CGGGGTGTGGAACCATTTGTGGG - Intergenic
1023693085 7:42812487-42812509 CTGGTTAAGGAAGATTTGGTGGG - Intergenic
1026344746 7:69464376-69464398 CTGGGAAAGGAAGGTCTTGTGGG + Intergenic
1029201273 7:98840700-98840722 CTGGGAATGGAAGATTCTATAGG - Intergenic
1029318417 7:99735588-99735610 CTGGGTATGAAAGGATGTGTAGG - Intergenic
1029323336 7:99784587-99784609 CTGGGTTTGGAAGGATGTGTAGG - Intergenic
1031529106 7:122854712-122854734 TTTTGTATGGAAGCTTTTGCTGG - Intronic
1032267203 7:130378031-130378053 ATGGGGAAGGAAGGTTTTGTAGG - Intergenic
1035632494 8:1119232-1119254 GTAGGTTTGGAATCTTTTGTAGG + Intergenic
1037697281 8:21235242-21235264 CTGGTCATGGAAACTTTTGATGG - Intergenic
1041895864 8:62924154-62924176 CTGGGTATGAAAGCTCTTGGTGG - Intronic
1045116183 8:98983293-98983315 CTGGCTATTCAACCTTTTGTTGG + Intergenic
1046724819 8:117662986-117663008 CTGGGTAGGGATGATTTTCTAGG - Intergenic
1047550665 8:125869162-125869184 CTTGCTATGGAGGCTTTTGGGGG + Intergenic
1047615245 8:126557872-126557894 CTGGGGATGGATGCGTTGGTGGG - Intronic
1048400630 8:134065540-134065562 TTGCGTATGTAAGCCTTTGTCGG - Intergenic
1051320608 9:15900776-15900798 CTGGGTTTGGAAGCTTCCTTAGG + Intronic
1051933667 9:22417194-22417216 CTGGTTATGTAAGTTTTTGTAGG + Intergenic
1052739245 9:32377516-32377538 CTGGCTTTGCTAGCTTTTGTTGG - Intergenic
1054767987 9:69058573-69058595 GTGAGTATGGAAGTTTTTATTGG - Intronic
1056539960 9:87562409-87562431 CTGGGTCTTGAGGCTTTCGTCGG + Intronic
1056911711 9:90707017-90707039 CTGGATATGGCAGCCTGTGTTGG + Intergenic
1059510551 9:114841130-114841152 CTAGGTATGAAATCTTTGGTTGG - Intergenic
1059590234 9:115651086-115651108 TGGGTGATGGAAGCTTTTGTTGG - Intergenic
1185875895 X:3702171-3702193 TTGGGTATGCATGCTTATGTTGG - Intronic
1187242524 X:17526703-17526725 CTGGGTTTGGGAGAATTTGTAGG + Intronic
1187483243 X:19677551-19677573 CTGGATTTGGAAGTTCTTGTGGG - Intronic
1188565823 X:31525039-31525061 CTGGGTAGGCAAGCTATTTTCGG - Intronic
1190875823 X:54459378-54459400 CTTGGTTTGGAAGCGTTAGTGGG + Intronic
1194488800 X:94521080-94521102 ATAGGTATGGAAGTTTTTGTGGG + Intergenic
1194867319 X:99085460-99085482 CTGGGTAGGGAAGGTTCTCTTGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1199082804 X:143595367-143595389 CTGGGTTTGGAAGCTGGGGTGGG - Intergenic
1199498040 X:148475884-148475906 CTGGGTATGGAAACTGATTTGGG - Intergenic
1200789683 Y:7288254-7288276 TTGGGTATGCATGCTTATGTTGG + Intergenic