ID: 960675328

View in Genome Browser
Species Human (GRCh38)
Location 3:120188657-120188679
Sequence GACCAAATGAAGCTAATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960675327_960675328 8 Left 960675327 3:120188626-120188648 CCAACAATATATGAAGAGGATAA 0: 1
1: 1
2: 23
3: 161
4: 963
Right 960675328 3:120188657-120188679 GACCAAATGAAGCTAATCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960675328 Original CRISPR GACCAAATGAAGCTAATCCC AGG Intronic
900549216 1:3245656-3245678 GAGCAAATGGAGCAAATTCCAGG + Intronic
904217956 1:28939334-28939356 GACCAAATGAAATTTATCCCAGG - Intronic
904751571 1:32743744-32743766 GACCCAATGAACCCAAACCCAGG - Intronic
906134592 1:43488373-43488395 GACCAAGTGAAATTTATCCCAGG - Intergenic
906567245 1:46809992-46810014 GACCTATTCAAGCTCATCCCAGG + Intronic
907163530 1:52389578-52389600 GACCAAAATATGCTACTCCCAGG + Intronic
909782399 1:79562524-79562546 GACCAAATGGGGCTTATCTCTGG + Intergenic
909840502 1:80315712-80315734 GACTAAATGAAGATAAGCCTAGG + Intergenic
910797333 1:91111582-91111604 GACCAAGTGAGGTTTATCCCAGG + Intergenic
911810287 1:102267766-102267788 TACCAAATGAAGTTTATTCCAGG - Intergenic
912086980 1:106019858-106019880 GATCAAATGAAATTTATCCCTGG + Intergenic
912975465 1:114325450-114325472 GACCAAATGGAGCTTATCCCAGG + Intergenic
916325385 1:163552500-163552522 GACTAAATGAGGATTATCCCAGG - Intergenic
916913607 1:169381680-169381702 GACCAAGTAAAGTGAATCCCAGG + Intronic
916975963 1:170078946-170078968 GACCAAATGGGGTTTATCCCAGG + Intronic
918264059 1:182823483-182823505 GACCAAGTGAAGCTAAGAACAGG + Intronic
919980833 1:202642292-202642314 GACCAAAGGCAGCGATTCCCAGG + Intronic
1063305280 10:4893228-4893250 GACCAAGTGAAGCTTATTCCAGG - Intergenic
1064961831 10:20973703-20973725 GGCCAAATGAGGCCAATCCATGG - Intronic
1065057711 10:21863648-21863670 GACCAAATGAAGTTTATTCCAGG + Intronic
1066241548 10:33541363-33541385 GACCAAATGGAGTTAATCCCAGG + Intergenic
1066692999 10:38050301-38050323 GACCAAATGTGGTTAATCCCTGG + Intronic
1066999781 10:42598733-42598755 GACCAAGTGTGGTTAATCCCTGG - Intronic
1069505644 10:68995481-68995503 GACCAAATGGAGTTTATCCCAGG - Intronic
1069911569 10:71762878-71762900 AAGCAAATGAAGCAATTCCCTGG + Intronic
1070914971 10:80147723-80147745 GACCAAGTGAAATTTATCCCAGG - Intergenic
1071362017 10:84857477-84857499 GACCAAATGAGGCTTATCACAGG - Intergenic
1072344056 10:94485419-94485441 GACCAAGTGAGCCTTATCCCTGG - Intronic
1076287740 10:129316728-129316750 GACAAAATGGAGTTGATCCCAGG + Intergenic
1078644078 11:13122664-13122686 GACAAAATGAAATTTATCCCAGG - Intergenic
1079622902 11:22576305-22576327 GCCTAACTGAAGATAATCCCAGG + Intergenic
1079692047 11:23431416-23431438 GACCAAGTGAAGTTTAGCCCAGG + Intergenic
1083731167 11:64653489-64653511 GACCAAATGAAGCAGAGCCAAGG - Intronic
1085604433 11:77884554-77884576 GAACAAATGAAGCTTATCCTAGG + Intronic
1086503961 11:87482726-87482748 GAGCAAATGAGGCTTATCCTAGG - Intergenic
1087054130 11:93916879-93916901 AACCAAATGGAACTTATCCCAGG - Intergenic
1087056505 11:93941744-93941766 AACCAAATGGAACTTATCCCTGG + Intergenic
1088023221 11:105145620-105145642 GAACAAGCAAAGCTAATCCCTGG - Intergenic
1092667488 12:10819662-10819684 GGCCAAATGAATCTTATCCTAGG + Intergenic
1093160384 12:15740021-15740043 AACCAAAAGAAGCTACTCCGAGG + Intronic
1093965857 12:25324406-25324428 CACCAAAGGAAGCTTATCCATGG + Intergenic
1095840905 12:46691113-46691135 CACCAAGTGAAACTGATCCCAGG + Intergenic
1096588217 12:52638154-52638176 GACCAAATGGAGTTTATTCCAGG + Intergenic
1098060716 12:66558982-66559004 GACCAAGTGAAATTTATCCCAGG + Intronic
1099264509 12:80428361-80428383 GACAAAAAGAAAATAATCCCTGG - Intronic
1100805261 12:98276957-98276979 GACGAAATTAAGCCAATTCCTGG + Intergenic
1100928179 12:99574586-99574608 GACCAAGTGAGGTTTATCCCTGG + Intronic
1105445648 13:20454256-20454278 GACCAACTGGAGTTTATCCCAGG + Intronic
1105783664 13:23726214-23726236 TACCAAATCAGGCTAAACCCTGG + Intergenic
1106031265 13:26006853-26006875 GACCAAATGAGATTTATCCCTGG - Intronic
1107527451 13:41247421-41247443 GAGCAAATTAACATAATCCCTGG - Intronic
1108467940 13:50737281-50737303 GACCAAATGGAGTTTATCCTAGG + Intronic
1110032377 13:70632015-70632037 AAGCAAATAAAGATAATCCCAGG - Intergenic
1111116565 13:83786332-83786354 GACCAACTGAAGATAATCTCTGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112070478 13:95845128-95845150 GACCACATGAACTTTATCCCAGG - Intronic
1112136837 13:96588568-96588590 GATCAAATGAAATTTATCCCAGG - Intronic
1112418211 13:99222689-99222711 GACCAAATAATGCTTATCCTGGG - Intronic
1113729655 13:112631651-112631673 GACCAAATAGAATTAATCCCAGG + Intergenic
1118660800 14:68008652-68008674 AACCAAAGGAAGAAAATCCCAGG - Intronic
1120528981 14:85609523-85609545 GACTAAATGAAACAAATTCCCGG - Intronic
1121810968 14:96889797-96889819 AACCAAATGAAACCAAACCCTGG - Intronic
1122260034 14:100511939-100511961 GATCAAGTGAAGTTTATCCCAGG - Intronic
1123135484 14:106023647-106023669 GACCAAGTGCAGTTTATCCCAGG - Intergenic
1123821798 15:24037660-24037682 GGCCAAATGAAGCAAAGCTCAGG + Intergenic
1124496532 15:30191036-30191058 GACCAAAGGCAGCGATTCCCAGG + Intergenic
1124747043 15:32347612-32347634 GACCAAAGGCAGCGATTCCCAGG - Intergenic
1126282640 15:46973943-46973965 GACCAAATGGAATTTATCCCTGG + Intergenic
1127779618 15:62299748-62299770 GAGCAAATGAAGCGGATCCAAGG + Intergenic
1128523955 15:68396190-68396212 GACCAAATGAGGTTTATCCCAGG + Intronic
1129562107 15:76581462-76581484 GACCAAATGAGATTTATCCCAGG + Intronic
1130033589 15:80337823-80337845 AAACAAATGAAGCTAATCATTGG - Intergenic
1131320863 15:91389402-91389424 GACCAAATGGAATTTATCCCAGG - Intergenic
1138321816 16:56120470-56120492 CACCAAAAGAAGGGAATCCCTGG - Intergenic
1138996793 16:62464474-62464496 GACCAATTGTACCTAATACCAGG + Intergenic
1140669255 16:77259129-77259151 GATCAAATGGAACTTATCCCAGG - Intronic
1144967145 17:19084420-19084442 AACCAACTGCAGTTAATCCCTGG + Intergenic
1144980775 17:19167647-19167669 AACCAACTGCAGTTAATCCCTGG - Intergenic
1144987447 17:19210586-19210608 AACCAACTGCAGTTAATCCCTGG + Intergenic
1150055704 17:62013341-62013363 GACCAAATGAAGTTAATTCTGGG + Intronic
1151413053 17:73943709-73943731 GACCAGATCAACCTAATCCAAGG - Intergenic
1154183923 18:12163851-12163873 GACCAAGTGAAATTTATCCCAGG - Intergenic
1155192633 18:23444281-23444303 GACCAAATGGGACTTATCCCAGG + Intergenic
1156412686 18:36848894-36848916 GACCAAATGAGGCTTAAGCCAGG - Intronic
1156640527 18:39090279-39090301 GATCAAAAGCAGCTAAACCCTGG + Intergenic
1157153480 18:45242161-45242183 GAGCAGATGACGCTAAGCCCAGG + Intronic
1157467904 18:47963907-47963929 GACAAAGTAAAGCTAATTCCCGG - Intergenic
1158262083 18:55618298-55618320 GACCAAATGAGATTTATCCCTGG - Intronic
1158353115 18:56585073-56585095 GACCAAAAGCAGTTAATCCAAGG + Intergenic
1158923488 18:62223731-62223753 GACCAAATGAGGTTTATCTCAGG + Intronic
1159097239 18:63918190-63918212 GACCACATGAAGATTGTCCCTGG - Intronic
1160062726 18:75547552-75547574 GACAAAATGAAGCTCAGCCGTGG - Intergenic
1165563736 19:36704548-36704570 GACCAAGTGGAGTTTATCCCAGG - Intronic
1165566719 19:36735761-36735783 GATCAAATGAAATTCATCCCAGG + Intronic
926998605 2:18768328-18768350 GACAAAATAAAGATATTCCCAGG - Intergenic
927281924 2:21316494-21316516 GAACAAATGAACCTGTTCCCAGG - Intergenic
933722085 2:85403965-85403987 GACCAAATGAGGTTTATCCCAGG + Intronic
934544770 2:95205810-95205832 GACCAAATGCAGCCAATCTACGG + Intergenic
936759417 2:115757719-115757741 GATCAAATGAGGTTAATCCCAGG + Intronic
937120996 2:119439913-119439935 GAGCAAACGAACCAAATCCCAGG + Exonic
937123826 2:119460251-119460273 AACCAAAAGAAGCTAATGCTTGG + Intronic
937538644 2:122922709-122922731 GAACAGATGAAGCTAGTCACAGG - Intergenic
937899385 2:127006129-127006151 GACCAAGTGGAGTTAATCCCAGG + Intergenic
938180485 2:129178019-129178041 GACCAGATGAAGCTAAGCTATGG - Intergenic
939026010 2:137014565-137014587 GACCAAATGAAAGAAATCCCAGG - Intronic
939064574 2:137467116-137467138 GAGCAAATCAAGCTCTTCCCAGG - Intronic
939444989 2:142298125-142298147 GACCAAATGAGATTTATCCCAGG + Intergenic
940594936 2:155779157-155779179 AACAAAATGAAGGTATTCCCTGG - Intergenic
942330681 2:174820750-174820772 GACTAAATCCAGCTAATACCAGG - Intronic
944481807 2:200164756-200164778 GACACAATGAAGCTTAGCCCTGG - Intergenic
944751261 2:202712877-202712899 GACCAAATGGAATTTATCCCAGG - Intronic
944870131 2:203902394-203902416 GACCAAATGAGATTTATCCCAGG + Intergenic
945309241 2:208291333-208291355 GACCAAATGGAATTTATCCCAGG - Intronic
946184125 2:217967955-217967977 GACCAAATGGGACTTATCCCAGG + Intronic
948351990 2:237348334-237348356 GACCAAAGGTAAATAATCCCTGG - Exonic
1170197479 20:13704332-13704354 CAACAAATGAAGTTTATCCCAGG + Intergenic
1172811114 20:37648985-37649007 TACCAATTGTAGTTAATCCCGGG - Intergenic
1173134021 20:40423421-40423443 AACCAAAGGAAGCTAGACCCTGG + Intergenic
1173549075 20:43919996-43920018 GACCAACTGAATCCAATCTCTGG - Intronic
1175478543 20:59294714-59294736 CACCAAATGCAGCCAATCACTGG - Intergenic
1184630113 22:45770807-45770829 GACCAAATGAAACAATTCACTGG - Intronic
1184953101 22:47860125-47860147 GAGCTGATGATGCTAATCCCTGG - Intergenic
949828903 3:8192685-8192707 GACCAAATAAGTTTAATCCCAGG - Intergenic
950699709 3:14733065-14733087 GATCAAATGGAGTTTATCCCAGG - Intronic
952611760 3:35218181-35218203 GGTAAAATGAAGCTATTCCCAGG - Intergenic
953299551 3:41758544-41758566 GACCAAGTGAGGTTTATCCCAGG + Intronic
954141995 3:48612362-48612384 AACCAACTGAAGCCAGTCCCTGG + Intergenic
955221083 3:57023852-57023874 GACCTAAACAAGCTATTCCCAGG - Intronic
956757510 3:72403652-72403674 GATCAAATGGAGCTAATCAGAGG - Intronic
959386510 3:105715112-105715134 GGCAAAATGAAGCAAATCACTGG + Intronic
959464817 3:106672242-106672264 GACCAAATGAGATTAATCCCAGG + Intergenic
960168320 3:114429115-114429137 GAACAAATGAATCTAGTCCGTGG - Intronic
960481299 3:118193501-118193523 GACCAAATGGAAGTTATCCCTGG - Intergenic
960675328 3:120188657-120188679 GACCAAATGAAGCTAATCCCAGG + Intronic
960998450 3:123354759-123354781 GACCAAATGGGCTTAATCCCAGG + Intronic
963116645 3:141736050-141736072 AACCAAAGGAAGGTAATCACAGG + Intergenic
963474369 3:145785547-145785569 TTCCAAAAGAAGATAATCCCTGG - Intergenic
963510507 3:146242106-146242128 GACCAAATAAAGCAAATACCAGG + Intronic
964093911 3:152909394-152909416 GACAAAATGTAGATAATCCTGGG - Intergenic
964141192 3:153401893-153401915 GACCAAATGAAATTTATTCCAGG - Intergenic
964403007 3:156318774-156318796 GACCAAACAAAACTAATCTCAGG + Intronic
964866025 3:161262277-161262299 GACCAAATGGAATTTATCCCAGG - Intergenic
965415835 3:168391161-168391183 GACCAAATGAGGTTTATCCCAGG + Intergenic
965808824 3:172571316-172571338 CACCAAGTGCAGCTCATCCCAGG - Intergenic
967302844 3:188032996-188033018 GACCAAATGGGATTAATCCCAGG + Intergenic
967573458 3:191060587-191060609 GACCAAGTGAAATTTATCCCTGG + Intergenic
969061991 4:4443692-4443714 GACCAAATGAGGTTTAACCCAGG + Intronic
969947508 4:10799562-10799584 GGCCAAATCCAGCTAATCCATGG - Intergenic
970675671 4:18447716-18447738 GACCAAGGGAAGTTCATCCCAGG + Intergenic
970713021 4:18886666-18886688 TAGCAAATGAAGCTCATACCAGG - Intergenic
971048741 4:22835809-22835831 GACCAAATGAGATTCATCCCTGG + Intergenic
973966511 4:56168378-56168400 GTCCAAGTGATGCTTATCCCAGG - Intergenic
975179628 4:71330147-71330169 GACCAAGTGAAATTTATCCCAGG - Intronic
975296163 4:72736986-72737008 GACCAAGTGAAATTTATCCCAGG + Intergenic
976017446 4:80574796-80574818 GACCAAGTGGAACTTATCCCAGG - Intronic
976819092 4:89184679-89184701 TACCATAGGAAGCTAAACCCTGG - Intergenic
977019241 4:91739190-91739212 GACCAAAAGAAACTAATTCTAGG - Intergenic
977447784 4:97153174-97153196 GACCAAATGAACAAAATCACTGG + Intergenic
977715990 4:100184581-100184603 TAGCAAATTAATCTAATCCCAGG - Intergenic
979850811 4:125568913-125568935 GACCAAGTGAAATTCATCCCAGG - Intergenic
980566390 4:134548443-134548465 GATCAAATGAAATTTATCCCTGG + Intergenic
981870734 4:149482615-149482637 GACCAAGTGGAACTTATCCCAGG - Intergenic
982038049 4:151365841-151365863 GACCAAATGGAATTTATCCCAGG - Intergenic
983651597 4:170041580-170041602 GTCCATATGAGGCTACTCCCTGG - Intergenic
988857405 5:35242146-35242168 GACCAAGTGAAATTTATCCCTGG - Intergenic
989039452 5:37211903-37211925 GCCCATATGAAGCATATCCCCGG - Intronic
989735811 5:44703876-44703898 GATCAAATAAAGTTTATCCCAGG + Intergenic
991275626 5:64843179-64843201 GAACAAATAAAGCTAATGTCTGG - Intronic
991947556 5:71914326-71914348 GAAGAAATGCAGCTAAACCCTGG - Intergenic
993846397 5:92949549-92949571 GACCAAATGAAATTTATCTCAGG - Intergenic
994287421 5:97986238-97986260 GACCAAATGAAACAAATTCCTGG - Intergenic
994445105 5:99862381-99862403 AACCAAATAAAGCAAATCCCAGG + Intergenic
995293542 5:110489320-110489342 GACCAAATTGAGTTTATCCCAGG + Intronic
996954727 5:129169229-129169251 TACCAACTGAACCTCATCCCTGG + Intergenic
997406412 5:133651576-133651598 GACCAAGTGAAGTTTATCCCAGG - Intergenic
1002414848 5:179114803-179114825 GACCCAATATAGCAAATCCCAGG + Intronic
1002522061 5:179797545-179797567 GACCAAATGAAGCCAACCGCAGG + Intergenic
1003375247 6:5570960-5570982 TAGGAAATAAAGCTAATCCCAGG - Intronic
1004252761 6:14035321-14035343 GACCAAATGGAGCTACACCAGGG - Intergenic
1005179714 6:23090854-23090876 GACAAAATGAAGCCAACCCCAGG - Intergenic
1005400626 6:25429809-25429831 GGCCAAATGAGACTTATCCCAGG - Intronic
1005800414 6:29416663-29416685 GACCGAATGAAGATATTCACAGG + Intronic
1005805361 6:29469410-29469432 GACCAAGTGAAATTTATCCCAGG + Intergenic
1006602416 6:35234904-35234926 GACCAAATGAGGCTATTCTGGGG + Intronic
1006925581 6:37652495-37652517 GAACAAATGAAACAATTCCCAGG - Intronic
1007123665 6:39405547-39405569 GACCAAGTGAGGCTTATCTCAGG - Intronic
1008944129 6:57078422-57078444 GACCAAGTGAAACTTCTCCCAGG - Intergenic
1010719463 6:79265783-79265805 GACCAAATGAAATTTATTCCAGG + Intergenic
1010951157 6:82038811-82038833 AACCTAATGGAGCTAAGCCCAGG + Intergenic
1012558288 6:100544956-100544978 GACCAAATGAAGTTTATTCTGGG + Intronic
1013002647 6:106039630-106039652 GACAGAAGGAAGCTAATTCCAGG - Intergenic
1014834148 6:126140214-126140236 GACCAAATAGGGCTTATCCCAGG - Intergenic
1015702160 6:136048496-136048518 GACCAAATGCAACAAATTCCAGG + Intronic
1017330232 6:153188894-153188916 GGCCAAATGGAATTAATCCCAGG + Intergenic
1019583147 7:1779112-1779134 GACCAAATCAAGTTTATCCCTGG - Intergenic
1021534966 7:21693309-21693331 GACCAAGCGGAGCTTATCCCTGG - Intronic
1023165482 7:37339169-37339191 CACCAGATGAATCTAATCCAAGG - Intronic
1024757091 7:52547009-52547031 GACCAAGTGAAATTCATCCCAGG - Intergenic
1026687881 7:72527848-72527870 GACCAAGTGAAGTTTAGCCCAGG + Intergenic
1026723100 7:72849696-72849718 GACCAAGTGAAGTTTAGCCCAGG + Intergenic
1028169542 7:87579546-87579568 GACCAAATGGGGTTTATCCCAGG - Intronic
1029502400 7:100940297-100940319 GACCAAGTGGGGTTAATCCCAGG - Intergenic
1032503652 7:132419085-132419107 GACAAAAAGAAGCAAGTCCCAGG - Intronic
1038794977 8:30701836-30701858 GATCTTATGAAGCTAATCCATGG + Intronic
1040624222 8:49127375-49127397 GACCAAGTGAAACTTATTCCAGG - Intergenic
1041403645 8:57472279-57472301 AACCAAATGAAATTTATCCCGGG - Intergenic
1043968162 8:86502719-86502741 GACAAAATGAAACCAATCCCGGG - Intronic
1044007053 8:86950481-86950503 GACCAAGTGAGACTTATCCCAGG - Intronic
1045602083 8:103728912-103728934 GACCAAATGAGATTTATCCCAGG - Intronic
1045615455 8:103904625-103904647 GACCAAATGAAGTTTATTCCTGG - Intronic
1045813374 8:106250877-106250899 TATCAAATGAAGTTTATCCCAGG + Intergenic
1045861978 8:106823820-106823842 GAAAATATGAAGCTAATCACTGG - Intergenic
1045947120 8:107809029-107809051 AACCAAATATAGCTAATCCTGGG + Intergenic
1048670613 8:136715094-136715116 AATGAAATGAAGCTCATCCCTGG - Intergenic
1050378982 9:5005500-5005522 GACCAAATGAATTTACCCCCAGG - Intronic
1053033395 9:34802608-34802630 TACCAAATGAAACTAATTTCTGG + Intergenic
1053435436 9:38070533-38070555 GACCAAATCAGGCCACTCCCTGG - Intergenic
1053520632 9:38774410-38774432 GACCAAATGAAATTTATTCCAGG + Intergenic
1053520691 9:38775409-38775431 GACCAAATGAAATTTATTCCAGG - Intergenic
1054192847 9:61999402-61999424 GACCAAATGAAATTTATTCCAGG - Intergenic
1054645560 9:67589289-67589311 GACCAAATGAAATTTATTCCAGG + Intergenic
1055403150 9:75945795-75945817 GACCAAAGGAAGCATATTCCAGG - Intronic
1055863251 9:80780832-80780854 GACCAAATGGAGTTTATTCCAGG - Intergenic
1056204850 9:84310047-84310069 TACTAAATGAAGTTAATACCAGG + Intronic
1058208611 9:102139096-102139118 GAACAAATAAAGGTAATTCCTGG - Intergenic
1058780445 9:108328420-108328442 GACCAAATGGAATTTATCCCTGG + Intergenic
1059030223 9:110685296-110685318 CACCAAGTGAAACTTATCCCTGG - Intronic
1188817415 X:34732171-34732193 GACCCAATGAAGCTAGGGCCAGG + Intergenic
1188832089 X:34911361-34911383 GACCAAGTGAAATTTATCCCTGG - Intergenic
1189610742 X:42731838-42731860 GACAAAGTGAAGTTTATCCCAGG + Intergenic
1189881165 X:45493996-45494018 GACCAAGTGAAATTTATCCCTGG - Intergenic
1189957515 X:46290875-46290897 GAGCAAATGAAATTTATCCCAGG - Intergenic
1190340988 X:49295483-49295505 GACCAAGTGAGGCTTATCCTGGG - Intronic
1190971249 X:55350806-55350828 GATCAAATGAGACTTATCCCTGG - Intergenic
1191179469 X:57544949-57544971 AACCAAATGAAATTTATCCCGGG + Intergenic
1192281423 X:69690474-69690496 GACCAAATGAAATTTATCCCAGG - Intronic
1192802626 X:74481067-74481089 GACCAAATGGGGTTTATCCCAGG - Intronic
1193663834 X:84290795-84290817 GACCAAGTGAATTTTATCCCTGG - Intergenic
1193691613 X:84652497-84652519 GACCAAATGGAATTTATCCCAGG - Intergenic
1195309728 X:103620207-103620229 GACCAAGTGAGGTTTATCCCAGG + Intronic
1195553633 X:106196629-106196651 GACCAAATGGAGTTTATCCTGGG - Intronic
1195781359 X:108468696-108468718 GACCAAATGAGAATTATCCCAGG - Intronic
1196133513 X:112182194-112182216 GACCAAAGGTAGCTAAATCCAGG + Intergenic
1196217189 X:113067175-113067197 GACCAAATGGGACTTATCCCTGG - Intergenic
1196315961 X:114223862-114223884 GACCAAATGAGATTTATCCCAGG + Intergenic
1196633463 X:117971639-117971661 GTCCAAAAGAAGCAATTCCCTGG - Intronic
1197470279 X:126859458-126859480 GACCAAGTGAAGTTTATCCTTGG + Intergenic