ID: 960677924

View in Genome Browser
Species Human (GRCh38)
Location 3:120214866-120214888
Sequence CTCTGCAATCCTAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960677924 Original CRISPR CTCTGCAATCCTAAGGTGGA TGG Intronic
900982983 1:6057161-6057183 CTCTGCAGTCCAGATGTGGATGG + Intronic
901132386 1:6970281-6970303 ATCTGTAATCCTAATGTGTACGG + Intronic
902403938 1:16173003-16173025 CCTAGCAATCCGAAGGTGGAGGG - Intergenic
903163746 1:21507165-21507187 CCCTGAAATCCCGAGGTGGAGGG + Intergenic
904598595 1:31661794-31661816 CCCAGCTATCCTAAGATGGAGGG + Intronic
905949423 1:41936144-41936166 CTCTGTAACCCCAAGATGGAGGG + Intronic
906442418 1:45860096-45860118 GCCTGCAATCCTGAGGTGGCGGG + Intronic
909070176 1:70984469-70984491 CTCTGCAAGGCCAAGGTGGGAGG + Intronic
914312845 1:146482600-146482622 CTCTGCGATGCCAAGGTGGGTGG - Intergenic
914501502 1:148250773-148250795 CTCTGCGATGCCAAGGTGGGTGG + Intergenic
915182622 1:154076030-154076052 CTCTGGGAGCCTGAGGTGGACGG - Intronic
915388700 1:155520617-155520639 CTCTGGGAGGCTAAGGTGGACGG + Intronic
919924032 1:202183080-202183102 CTCTGCAAACCTAAGGCTGTGGG + Intergenic
921646099 1:217619988-217620010 CTCTACAACCCTCAGGTGGCTGG + Exonic
922663772 1:227451906-227451928 CTCTGCAGTCAGCAGGTGGAGGG + Intergenic
1064521849 10:16210794-16210816 CTTTGGGATCCCAAGGTGGAAGG + Intergenic
1068781297 10:60921698-60921720 CTCTGCCAGCCCCAGGTGGAAGG - Intronic
1069916326 10:71789370-71789392 CCCTGCACTCCTGGGGTGGAGGG - Intronic
1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG + Intergenic
1070025133 10:72625318-72625340 CTCTGTAATCTTATGGTTGATGG - Intronic
1071209102 10:83317405-83317427 CTCTGCTCTCCTCAAGTGGAAGG - Intergenic
1071338815 10:84623972-84623994 CCCTGCAGGCCTAAGCTGGAAGG + Intergenic
1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG + Intronic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1073554243 10:104433329-104433351 CTCTGGGAGGCTAAGGTGGAAGG - Intronic
1077219305 11:1408364-1408386 CGCTGGACTTCTAAGGTGGATGG - Intronic
1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG + Intergenic
1083890351 11:65592724-65592746 CTCTGCCATCCTAAGCCGGAAGG + Intronic
1084854163 11:71970415-71970437 CTTTGGAAGACTAAGGTGGAAGG + Intronic
1085562728 11:77487045-77487067 CTCTCCTCTCCTCAGGTGGAAGG - Intergenic
1085701279 11:78748032-78748054 CCCTGCCATCCTAAGGTGCTAGG + Intronic
1085980472 11:81718275-81718297 CTCTCCTCTCCTCAGGTGGAAGG - Intergenic
1088089913 11:106025395-106025417 CTTTGCAAGGCTGAGGTGGAAGG - Intergenic
1088106212 11:106209498-106209520 CTCTTCCATGTTAAGGTGGATGG + Intergenic
1088255159 11:107896635-107896657 CTTTGGAAGCCTGAGGTGGATGG + Intronic
1089136415 11:116252853-116252875 CTCTGCCATCCTAAGGGTGTTGG + Intergenic
1089215736 11:116833603-116833625 CACGGCAAACCTACGGTGGAGGG - Intergenic
1090486361 11:127115983-127116005 CTCCGCAACCCTAAGGCGGGAGG + Intergenic
1090721086 11:129473859-129473881 AGTTGCAATCCTAAGGTGTAAGG + Intergenic
1091691427 12:2600007-2600029 CTCTGCATTCCTCAGATGGGTGG - Intronic
1091832259 12:3558055-3558077 CCCTGCAAGCCTAGGGAGGAGGG - Intronic
1095712257 12:45302891-45302913 TTCTGCACTCCTAAAGTGGTAGG - Intronic
1096472624 12:51888917-51888939 TCCTGCAGTCCTAAGGAGGAAGG + Intronic
1097288984 12:57898103-57898125 CCCTGCAGCCCTTAGGTGGAGGG + Intergenic
1098459085 12:70712074-70712096 CTCTGAAATTCCAAGGTGAAAGG - Intronic
1098480903 12:70959867-70959889 CTCTGGGAAACTAAGGTGGAAGG - Intergenic
1100020395 12:90062428-90062450 CTTTGCAATGCCAAGGCGGACGG + Intergenic
1101555998 12:105810074-105810096 GACAGCAATCCCAAGGTGGAAGG + Intergenic
1102317886 12:111904721-111904743 CTCTCCTCTCCTCAGGTGGAGGG - Intergenic
1103174524 12:118850990-118851012 CTCTGCAAGGCTGAGGTGGAAGG - Intergenic
1106129858 13:26931315-26931337 CTCAGGAATCCTGATGTGGAAGG - Intergenic
1108246231 13:48517083-48517105 TTGTGCTCTCCTAAGGTGGAAGG - Intronic
1109881020 13:68476574-68476596 CTCTGCCATCCTCTTGTGGAGGG - Intergenic
1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG + Intronic
1110971937 13:81774676-81774698 CACTTCAATCCCAAGATGGAAGG - Intergenic
1111390791 13:87592049-87592071 CTCTGCTCTCCTCAAGTGGAAGG - Intergenic
1115637626 14:35305839-35305861 GCCTGTAATCCTAAGGTGGGAGG + Intronic
1117097901 14:52315742-52315764 GACAGCCATCCTAAGGTGGAAGG - Intronic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1120183181 14:81366546-81366568 CTCTGCAATGCTAAAGGGCACGG + Intronic
1120960437 14:90119841-90119863 CTCTGCGATGCCAAGGTGGGCGG - Intronic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1122920270 14:104877074-104877096 CTCTGCAGTCCTGAGCTGGGGGG + Intronic
1123950938 15:25274260-25274282 CTCTGTCATCCTATGGTAGAAGG + Intergenic
1125260912 15:37823773-37823795 CTGTGCTCTCCCAAGGTGGAAGG - Intergenic
1125717811 15:41829530-41829552 CTTTGGAATGCTGAGGTGGAAGG - Intronic
1126295035 15:47130106-47130128 CTCTGCTCTCCTCAAGTGGAAGG + Intergenic
1128714385 15:69896722-69896744 CTATGCAATCCAGAGGAGGAGGG + Intergenic
1129268432 15:74407228-74407250 CTCTACATTCCTAAAGTGGGAGG + Intergenic
1132050792 15:98606261-98606283 CTCTTCACTCCTAAGATGCATGG + Intergenic
1133840936 16:9408656-9408678 CCCTTCTATCCTAAGGAGGAGGG + Intergenic
1135280717 16:21151989-21152011 CTCTGAAAGGCTGAGGTGGATGG + Intronic
1136254494 16:29029245-29029267 CTCTGCTTTCCTTAGGGGGAGGG + Intergenic
1138655037 16:58486605-58486627 CTCTGCCATCCTGAAGTTGAGGG + Intronic
1139315887 16:66068318-66068340 CCTTGCACCCCTAAGGTGGATGG + Intergenic
1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1146619144 17:34383119-34383141 CTCCCCAGTCCTAAGGTGCAGGG - Intergenic
1151687489 17:75657123-75657145 CTCTGGGAGCCTAAGGTGGGAGG + Intronic
1152790528 17:82276356-82276378 CTCTGGAAGGCCAAGGTGGATGG - Intergenic
1153715058 18:7839234-7839256 CTCTGCTTTTCTCAGGTGGAAGG + Intronic
1155811756 18:30245094-30245116 TTCTGCAATCTTAAGGAGCATGG + Intergenic
1156616483 18:38791748-38791770 TTCTGCAGCCCTAAAGTGGAAGG - Intergenic
1159784318 18:72695875-72695897 CTTTGCAAGGCTAAGGTGGGTGG + Intergenic
1162331637 19:10033428-10033450 GTCTGAAGTCCCAAGGTGGAAGG + Intergenic
1163819039 19:19485731-19485753 CTCTGCAGTCCTGAGGAGGCCGG - Intronic
1165396343 19:35565806-35565828 CTCTGGAAGGCTGAGGTGGACGG + Intergenic
1165521333 19:36316652-36316674 CTGTGCCGTCCTATGGTGGAAGG + Intergenic
1165622728 19:37261936-37261958 CTGTGCCGTCCTATGGTGGAAGG - Intergenic
1168323073 19:55521784-55521806 CTCTGCAGGCCAGAGGTGGAGGG + Intergenic
926899289 2:17732453-17732475 CTCTGCGAGGCCAAGGTGGATGG + Intronic
928507770 2:31971617-31971639 CTTTGCAAGGCTGAGGTGGAAGG - Intronic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
930469220 2:51792245-51792267 CTCTTCACTCCTCACGTGGAAGG - Intergenic
932514714 2:72334153-72334175 CTCTTCACTCTTAAGATGGATGG - Intronic
936456331 2:112677320-112677342 CTCTGGAATCTTAAGCTGTATGG - Intergenic
936795324 2:116196428-116196450 CTCTGTCCTCCTCAGGTGGAAGG + Intergenic
937336101 2:121063285-121063307 TTCTGGAATCCCAAGGGGGAAGG + Intergenic
939710343 2:145509472-145509494 CTCTGCTCTCCTCAAGTGGAAGG + Intergenic
941658985 2:168175096-168175118 CTGTGGAATCCTCAGGAGGAAGG - Intronic
944085298 2:195839438-195839460 CTCTGGTTTCCTAAGGTGGAAGG - Intronic
945507058 2:210654839-210654861 CTCTGAAATGCTAATCTGGAAGG - Intronic
945997803 2:216453607-216453629 CTATGAAATCCTGAGTTGGAAGG + Intronic
946984642 2:225257981-225258003 CTCTCCTCTCCTCAGGTGGAAGG - Intergenic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
1169030107 20:2400298-2400320 CTCTGCAGTCCTCAGGTGCTTGG + Exonic
1169440324 20:5628476-5628498 CTCTGGGAGCCTGAGGTGGAAGG + Intergenic
1170668789 20:18410701-18410723 CTCTGGAAGGCTAAGGTGGGAGG + Intronic
1172222751 20:33284944-33284966 ATCTGCAATACTAAGGGGGCTGG - Intronic
1173037233 20:39424100-39424122 CTATGACTTCCTAAGGTGGATGG + Intergenic
1173603713 20:44314163-44314185 CTCTGCACTCCCAGGCTGGAGGG + Intergenic
1173808694 20:45942854-45942876 CTTTGGAAGGCTAAGGTGGAAGG - Intronic
1179311865 21:40203265-40203287 ATCTGCAAACATAAGGTGGAAGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181314579 22:21963088-21963110 CTCTGGGAGGCTAAGGTGGATGG + Intronic
1184007149 22:41718797-41718819 CTCTGTCATCCCATGGTGGAAGG + Intronic
1184135390 22:42546061-42546083 CTCTGAGAGGCTAAGGTGGAGGG + Intergenic
1184400416 22:44270659-44270681 ATCTGCCAGCCTAGGGTGGATGG + Intronic
954907936 3:54078407-54078429 GTCTGCAGTCCTGATGTGGATGG + Intergenic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
961690478 3:128665954-128665976 CTCTGCAAGGCCAAGGTGGGCGG - Intronic
962605715 3:137031340-137031362 CTTTGGAAGGCTAAGGTGGAAGG - Intergenic
962671009 3:137708561-137708583 CTCAGGAATCCAAAAGTGGAGGG + Intergenic
965690497 3:171351690-171351712 GTCTGTAATACTTAGGTGGAGGG - Intronic
966732172 3:183160470-183160492 CTTTGGGATCCTGAGGTGGAAGG - Intronic
967081316 3:186052353-186052375 CTCTGCAATCTTAAAGTGCTAGG - Intronic
967697027 3:192543914-192543936 CTATCCTCTCCTAAGGTGGAGGG + Intronic
968160743 3:196424627-196424649 CTTTGGAATGCCAAGGTGGAAGG - Intronic
968633711 4:1666756-1666778 CTCTGCAAGGCTGAGGTGGGCGG + Intronic
972327305 4:38028779-38028801 GTCTGAAATCCTAAGCGGGAAGG - Intronic
972725097 4:41740432-41740454 CTTTGCAATCCCCAGGAGGAGGG - Intergenic
974337638 4:60570465-60570487 CTCTCCTATCCTAAAGCGGAAGG + Intergenic
974435194 4:61847441-61847463 GTCTGCAAACCTAAGGGGCAGGG + Intronic
975754729 4:77561645-77561667 CTCTGGAATGCTAAGGGGCAGGG - Intronic
975858923 4:78655406-78655428 CTCTGGAAGGCTGAGGTGGATGG + Intergenic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
982759598 4:159265503-159265525 CTCTGCACTCCCAAGTTGCAGGG - Intronic
986758936 5:10862431-10862453 CTCTGCACTCCTAAGTTGTGAGG + Intergenic
987738076 5:21870458-21870480 CTGTGCTATCCTATGGTGGAAGG - Intronic
988462149 5:31449482-31449504 GCCTGTAATCCTAAGGTGGAGGG + Intronic
988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG + Intronic
988658226 5:33235844-33235866 CCCTGCAATCCAAAGGAGAAAGG - Intergenic
988956398 5:36324269-36324291 CTCTCCACTCCTAAAGGGGAGGG + Intergenic
990827874 5:59922448-59922470 CTCTCCTCTCCTTAGGTGGAGGG - Intronic
996010529 5:118477562-118477584 CCTTGCAAGCCCAAGGTGGATGG + Intergenic
1000044430 5:157510229-157510251 CTCTGGGAGGCTAAGGTGGATGG + Intronic
1000211242 5:159107578-159107600 CTCTGCAATGCTACCTTGGATGG - Intergenic
1001885419 5:175286126-175286148 CTCTCAAACCCTAAGATGGATGG - Intergenic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1004630663 6:17418026-17418048 CTTTGGAATGCTAAGGCGGATGG + Intronic
1006108105 6:31728738-31728760 TTCTCCTATCCTAAGGTCGATGG - Exonic
1008177674 6:48288511-48288533 CTCTCCTCTCCTAAAGTGGAAGG + Intergenic
1011779075 6:90766449-90766471 CTCTGCAATTCCAAGGTGAATGG - Intergenic
1017139716 6:151179652-151179674 CTCTGCAGCCCTAAGGAAGAAGG - Intergenic
1018447598 6:163871974-163871996 CTTTGGAATCCTAATGGGGATGG + Intergenic
1021425140 7:20491014-20491036 CTCTGCAGTCTTAAGTGGGATGG - Intergenic
1022741194 7:33123146-33123168 CTCTCCTCTCCTAAAGTGGAAGG + Intergenic
1024994736 7:55264395-55264417 ACCTGTAATCCCAAGGTGGATGG - Intergenic
1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG + Intergenic
1028181429 7:87729821-87729843 CTCTCCTCTCCTTAGGTGGAGGG - Intronic
1028284662 7:88981400-88981422 CTCTCCTCTCCTCAGGTGGAAGG + Intronic
1028388841 7:90291622-90291644 CTCTGCAACCCTAAGGATTAAGG - Intronic
1029188180 7:98754345-98754367 CCCTGCAATCCTGAGGTGCCAGG + Intergenic
1034394072 7:150806919-150806941 CACTGCAATCCTCAGTTGCAAGG - Intergenic
1036585972 8:10124030-10124052 CTCTGCAATCCCAAGGTCAAAGG - Intronic
1038731426 8:30131396-30131418 CTTTGCAATGCTGAGGTGGAAGG - Intronic
1042112991 8:65401363-65401385 CAATGCATTCCTAATGTGGAAGG - Intergenic
1042449416 8:68927043-68927065 CTTTGGGATGCTAAGGTGGATGG + Intergenic
1043424181 8:80132449-80132471 CTTTGGAAGCCTGAGGTGGATGG - Intronic
1044426601 8:92058429-92058451 CTCTGCAATCCTAGAGTGGGAGG + Intronic
1044561921 8:93620702-93620724 GTCTGCAGTGCTGAGGTGGAAGG + Intergenic
1044608886 8:94072606-94072628 CTTGGCAATTCTATGGTGGATGG - Intergenic
1046962801 8:120127501-120127523 CTCTGAAATCCTCAGCTGGACGG - Intronic
1048627721 8:136204355-136204377 CTCTGTAAACCTAAGGTCAAGGG - Intergenic
1048806217 8:138243644-138243666 CTCTGCAATCCAAAGATTAATGG + Intronic
1051377873 9:16422683-16422705 CACAGTATTCCTAAGGTGGAAGG + Intronic
1059309771 9:113380250-113380272 CTTTGGAAGGCTAAGGTGGAAGG + Intergenic
1060937444 9:127523889-127523911 CTCTGACATCCTCTGGTGGAGGG - Intronic
1061538492 9:131264405-131264427 CGCTGCAACCCCCAGGTGGAGGG - Intronic
1185637133 X:1560970-1560992 CTTTGGAATGCTGAGGTGGATGG - Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186932776 X:14412961-14412983 CTCTTCTCTCCTCAGGTGGAAGG - Intergenic
1188414469 X:29915667-29915689 CTCTGCGATCCTAAGGAGCAAGG - Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189867821 X:45349950-45349972 CTCTGCATTCCTCAGGTATATGG - Intergenic
1190537823 X:51447017-51447039 CTCTCCTCTCCTCAGGTGGAAGG + Intergenic
1190934517 X:54984762-54984784 CTCTGCAATTCTGAGCTGAAGGG - Intronic
1194361079 X:92950905-92950927 CTCTCCTCTCCTCAGGTGGAAGG + Intergenic
1194990607 X:100543230-100543252 CTCTCCTCTCCTCAGGTGGAGGG - Intergenic
1196703549 X:118697185-118697207 CTCTGGAAGGCTGAGGTGGAAGG + Intergenic
1197322030 X:125044342-125044364 CTTTGCAAGGCTGAGGTGGAAGG + Intergenic
1198175904 X:134154051-134154073 CTCTGGAAAGCTAAGGTGGGAGG + Intergenic
1198995285 X:142567138-142567160 CTCTTCTCTCCTCAGGTGGAAGG + Intergenic
1199444410 X:147905088-147905110 CTTTGCAAGGCTAAGGTGGGAGG - Intergenic
1199583475 X:149385676-149385698 GTCTGATATCCAAAGGTGGAAGG - Intergenic
1200070797 X:153528086-153528108 CTCTGGAACCCTGAGGTTGATGG + Intronic
1200669273 Y:6066714-6066736 CTCTCCTCTCCTCAGGTGGAAGG + Intergenic
1202075101 Y:21029638-21029660 TCCAGCAATCCTAAGGTGAATGG + Intergenic