ID: 960680506

View in Genome Browser
Species Human (GRCh38)
Location 3:120242903-120242925
Sequence CTTGGTCACCACACAGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960680502_960680506 1 Left 960680502 3:120242879-120242901 CCACAGGCAATGGAGCACGACAT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 960680506 3:120242903-120242925 CTTGGTCACCACACAGGGTAAGG 0: 1
1: 0
2: 0
3: 16
4: 116
960680499_960680506 25 Left 960680499 3:120242855-120242877 CCAATTCTCATCTGAGTGTCAAA 0: 1
1: 0
2: 2
3: 13
4: 152
Right 960680506 3:120242903-120242925 CTTGGTCACCACACAGGGTAAGG 0: 1
1: 0
2: 0
3: 16
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960680506 Original CRISPR CTTGGTCACCACACAGGGTA AGG Intronic
900306508 1:2011798-2011820 CCTGGCCACCACACAGGAAAGGG + Intergenic
902652162 1:17844110-17844132 CTTGGGGACCCCACAGGGCAGGG + Intergenic
904164445 1:28544681-28544703 CTTGGCTACCAAACAGGGAAGGG - Intergenic
906228524 1:44140710-44140732 CTTGCTCCCCACAGAGGGTCTGG + Intergenic
907570910 1:55482804-55482826 CCTGGTCAAAACACAGGGAAGGG - Intergenic
913103635 1:115592799-115592821 CTTGGTCACCACACAGGAACAGG - Intergenic
915904548 1:159868209-159868231 CTTTGTGACCACACAAGGCAGGG - Intronic
915943289 1:160132541-160132563 CTTGGTGACCAAACTGGATATGG + Intronic
917682830 1:177385059-177385081 CCTGGAAGCCACACAGGGTAAGG - Intergenic
1063004060 10:1952206-1952228 CTTTGTCATCACACAGGGTTAGG - Intergenic
1065378963 10:25069676-25069698 CTTTGTGACAACACAGAGTAGGG - Intergenic
1067135958 10:43607152-43607174 CTTTGTCCACACACAGGGCAGGG - Intronic
1068963183 10:62886036-62886058 CTTGCTGACCACACAGGGAATGG - Intronic
1071697565 10:87893007-87893029 CTTGAACAACACAGAGGGTAGGG + Intronic
1072791472 10:98321233-98321255 CATGTTCACCACAGAAGGTAGGG - Intergenic
1074869365 10:117564870-117564892 CCAGGCCACCCCACAGGGTAGGG - Intergenic
1076188248 10:128465218-128465240 CTTTGTCAACACACAGAGTAGGG + Intergenic
1077128495 11:956514-956536 ATTATTCATCACACAGGGTAAGG - Intronic
1077541653 11:3149345-3149367 CCTGGCCACCAGATAGGGTAGGG - Intronic
1080874901 11:36266273-36266295 TTGGGTCACCAAACAGGGTATGG + Intergenic
1081244995 11:40754619-40754641 ATTGGTCACCACAGGGAGTATGG - Intronic
1083240527 11:61384657-61384679 CATGGTGTCCACACAGGATATGG + Intergenic
1083923819 11:65794151-65794173 CTGGGCCACCACACAGGGCCCGG - Exonic
1088384878 11:109242539-109242561 CTTTTTCACCACACACTGTATGG - Intergenic
1089607900 11:119652226-119652248 CATGGTGACCACACCGGGTGGGG - Intronic
1089747970 11:120630172-120630194 CAGGGTCCCCACACAGGGCAAGG - Intronic
1090401132 11:126449052-126449074 GTTGGTCACCTCACAGGAGACGG + Exonic
1090423811 11:126593421-126593443 CCTGGTCCCCACAGTGGGTAGGG - Intronic
1094113185 12:26882949-26882971 CTTGGAAAACACACAGGGTTTGG + Intergenic
1096115645 12:49053426-49053448 CTTAGGCACAACACAGGTTAGGG - Intronic
1098966512 12:76795356-76795378 CTTGGACCCCACCCAGGATAGGG - Intronic
1100176179 12:92033489-92033511 TTTGGTCACCACATATGGTTTGG + Intronic
1102132007 12:110539032-110539054 CTGTGTCACCACACAGAGCACGG + Intronic
1102176144 12:110876382-110876404 CATAGCCACCACACAAGGTAGGG - Intronic
1102961342 12:117095377-117095399 CTCTGTCTCCACCCAGGGTAAGG - Intronic
1103971420 12:124675229-124675251 CTTGGTCACCACCCAGGGCCTGG - Intergenic
1105567980 13:21570789-21570811 CTAGTTAACCAAACAGGGTATGG - Intronic
1109269746 13:60241560-60241582 CTTGTTCTCCTCACATGGTAGGG + Intergenic
1113109694 13:106809582-106809604 CTTCCTCACCACCCAGGTTATGG + Intergenic
1118265178 14:64288058-64288080 CCTGTTCACCACCCAGGATATGG - Intronic
1118530592 14:66701548-66701570 CTTGGGAGCCACACAGGGCAGGG + Intronic
1119473939 14:74916287-74916309 CTTGGGCATGACACAGGGAAAGG + Intronic
1119880339 14:78094743-78094765 CTGGCTCAGCATACAGGGTAAGG - Intergenic
1126711048 15:51456567-51456589 CTTGGTAACCTCACAGGCCAGGG - Intronic
1127563212 15:60161219-60161241 CTTGGTCAGCACGTGGGGTAGGG - Intergenic
1128155408 15:65388802-65388824 CTTGCTCACCACGCAGGGTGAGG - Exonic
1131259075 15:90879335-90879357 CCTGGGCACCACAGATGGTATGG - Intronic
1131745930 15:95447160-95447182 CTTGCTCACCAAGCAGGGGAAGG - Intergenic
1131770990 15:95737090-95737112 TTTGGTCATTACAGAGGGTATGG + Intergenic
1132662543 16:1068090-1068112 CTTTGGCATCACACAGGGTCAGG + Intergenic
1132968845 16:2674967-2674989 CTAGGACACCACACAGGGAGCGG + Intergenic
1136662017 16:31771611-31771633 CCTGGGAACCACACAGGGCAAGG + Intronic
1139441428 16:66969663-66969685 CTTGGTGTCCACACAGGGCTGGG + Exonic
1143313449 17:6013072-6013094 TGTGGTCACGACACAGGGTGGGG + Intronic
1146172512 17:30644832-30644854 CTTGGTCACCTGACAGGGGCAGG + Intergenic
1146345966 17:32060841-32060863 CTTGGTCACCTGACAGGGGCAGG + Intergenic
1146547447 17:33751074-33751096 CTTGGAAGCCACCCAGGGTAGGG + Intronic
1149783354 17:59415615-59415637 CTTGGTTACCTCACAGGCTATGG + Intergenic
1149996921 17:61410435-61410457 CTTGGGCACTGCACAGGGTGGGG + Intergenic
1152101797 17:78305778-78305800 ACTGGTCACCACACAAGGGATGG - Intergenic
1152328885 17:79659103-79659125 CTTGGTCACCGCACAGGAACAGG + Intergenic
1153847934 18:9066642-9066664 CTTTGGGACCAGACAGGGTAGGG - Intergenic
1155384388 18:25261343-25261365 CTCGTTGACCACAGAGGGTATGG - Intronic
1156861925 18:41847036-41847058 CTTGGCCACCAAAGAGGTTATGG + Intergenic
1158454174 18:57592072-57592094 CTTGGCCATAGCACAGGGTATGG + Intergenic
1159651271 18:70981961-70981983 CTGGTTCCCCAGACAGGGTACGG - Intergenic
1162126585 19:8502652-8502674 CACGGTCAGCACACAGGGTGGGG + Exonic
1162989919 19:14295248-14295270 CTTGGTCACCTGACAGGGGCAGG - Intergenic
1165403001 19:35613680-35613702 CTGGGGCAGCACACAGGGTGTGG - Intronic
1167618036 19:50546965-50546987 CTCGGTCACCACCCAGGACAGGG + Intronic
1167851946 19:52208904-52208926 CCTGGAGACCACACAGGGTAGGG - Intronic
926707021 2:15844182-15844204 CTTGGTCCCCACATGGGGTCTGG + Intergenic
927107501 2:19840662-19840684 CTTGGTCACCATGGGGGGTAGGG - Intergenic
930769403 2:55116743-55116765 CTTGCTCCCCACAGAGGTTAAGG - Intergenic
934557890 2:95297017-95297039 CTTGGTGACCAAAAAGGGCAAGG + Intergenic
936966902 2:118135725-118135747 CATGGTAACCACACAGGGAGAGG - Intergenic
937886612 2:126903581-126903603 CTTGGTCAAAACATAGGGTCTGG + Intergenic
943686865 2:190827744-190827766 TTTGGTATCCACACAGGGTATGG + Intergenic
947366123 2:229396534-229396556 CATGGTCACCACCTAAGGTATGG + Intronic
947898011 2:233693459-233693481 CAGGATCACCCCACAGGGTAAGG - Exonic
947984438 2:234436760-234436782 CTTAGGCACCACACAGTGTATGG + Intergenic
948197015 2:236103918-236103940 CTTGGTAAACGCACAGGGCAGGG - Intronic
1169423171 20:5475580-5475602 ATGGGTCAGCAGACAGGGTAGGG + Intergenic
1170154198 20:13254712-13254734 CGGGGTCACCACACAGGTAAGGG + Intronic
1171967593 20:31542226-31542248 CTTGGTGACTACACAAGGTAAGG - Intronic
1172288618 20:33758890-33758912 CTGGGTCACCCCACAGGCTAGGG - Intronic
1172948427 20:38706158-38706180 CTGGGTCACCTCTCAGGGTGGGG + Intergenic
1175490479 20:59377284-59377306 CTTGGACAGCACACAGGGAATGG - Intergenic
1180147332 21:45928726-45928748 CTTCCTCACTGCACAGGGTATGG - Intronic
1183587060 22:38758893-38758915 CTTTGTCACCAGACTGGGTGGGG - Intronic
950910244 3:16581985-16582007 TTTGATCACCACACATTGTACGG + Intergenic
953022007 3:39120626-39120648 CTTGTTCTCCACACATGGCAGGG + Intronic
953350223 3:42209830-42209852 CTTGGTGACCACACCGGGCCGGG - Exonic
953749705 3:45599952-45599974 CATGGTCCCCACACAGGGCCAGG - Intronic
955544181 3:60010297-60010319 ATTGCTCTACACACAGGGTATGG - Intronic
955923741 3:63985551-63985573 CTTGGGAAACACTCAGGGTAGGG - Intronic
960680506 3:120242903-120242925 CTTGGTCACCACACAGGGTAAGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961523199 3:127480174-127480196 CTTTCTCACCACCCAGGGGAAGG - Intergenic
962434163 3:135349003-135349025 CTTGGTCACCAGGGAGGATAAGG + Intergenic
969284907 4:6197054-6197076 CACGGGCACCACACAGGGTGAGG - Intronic
969707739 4:8820953-8820975 CTTGGTCTCCACGCTGGGTTAGG - Intergenic
972715831 4:41644849-41644871 CTTGGTCACAAAAGAGGGGAGGG + Intronic
979197924 4:117942035-117942057 CTTGAGAACCACACAGGGAAGGG - Intergenic
979505317 4:121488614-121488636 CTTGGAAAACACACAGGGAACGG - Intergenic
993739367 5:91518737-91518759 CTTGGTGACCACCCAGGCAAGGG + Intergenic
994259227 5:97637256-97637278 CCTGGTTGCCACACAGGATAAGG - Intergenic
996158851 5:120137430-120137452 CTTGGTCACCACATATTCTAAGG - Intergenic
996289922 5:121840626-121840648 CTTGGGAAGCAAACAGGGTAGGG - Intergenic
998763841 5:145462584-145462606 CTTGGTCACAGAGCAGGGTAGGG - Intergenic
1000409835 5:160926664-160926686 CTTGGCAACCACACAGCGTTTGG - Intergenic
1001238528 5:170050111-170050133 CTTGGTTTCCCCACAGGGAAAGG - Intronic
1002087524 5:176785317-176785339 CTTGGGCTCCACACTGGGTCTGG + Intergenic
1002108786 5:176894177-176894199 CTTTGTCATCAGAGAGGGTATGG - Intronic
1018480491 6:164184573-164184595 CTTGTTCCCCAAACAGGGCAAGG - Intergenic
1025012835 7:55412112-55412134 CTGGCTCCCCACACAGGGGACGG - Intronic
1029977634 7:104849463-104849485 CTTGGCCCCCACACAGTGCAGGG - Intronic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1032241136 7:130160200-130160222 CTTGGCCTCCACACAGGGCCTGG - Intergenic
1036750710 8:11442179-11442201 CTTGGCCAGCACACTGGGCAGGG + Intronic
1038451648 8:27643247-27643269 CTTGGTAACCACAGAGGTTGTGG - Intronic
1040805311 8:51389543-51389565 TTTAGTACCCACACAGGGTAAGG - Intronic
1044752858 8:95432734-95432756 CTTGATCACCTCACCAGGTAGGG - Intergenic
1051056798 9:12996978-12997000 GTTGGTCACCGCACACAGTAGGG + Intergenic
1052135011 9:24898443-24898465 CTTGTTCCCCTCACAGGGCATGG - Intergenic
1056475589 9:86948131-86948153 CTTGATCACCACAGAGGGGAAGG + Intergenic
1057303454 9:93899530-93899552 CTTGTTCACCCCTCAGGGAAGGG + Intergenic
1057748320 9:97770152-97770174 CATGGTGAACACACAGTGTATGG - Intergenic
1187067259 X:15853948-15853970 CTTGGTGACCAGAAAGGGTGAGG + Intronic
1192200368 X:69062721-69062743 CCTGTTCACCACACAGGCTGGGG - Intergenic
1193667502 X:84340067-84340089 CTTCATCACCACACAGGGAAAGG + Intronic
1193826359 X:86231731-86231753 CTTGGTCAGAACTCAGGGGAGGG - Intronic
1195399625 X:104447589-104447611 ATTGGTCACCCAACAAGGTAGGG + Intergenic