ID: 960681647

View in Genome Browser
Species Human (GRCh38)
Location 3:120254154-120254176
Sequence GTCAACAGTCAGATGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 819}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960681647_960681651 3 Left 960681647 3:120254154-120254176 CCTACCACCATCTGACTGTTGAC 0: 1
1: 0
2: 4
3: 79
4: 819
Right 960681651 3:120254180-120254202 CTTGACAAAAACAAGCAATAGGG 0: 12
1: 413
2: 5063
3: 13122
4: 5577
960681647_960681650 2 Left 960681647 3:120254154-120254176 CCTACCACCATCTGACTGTTGAC 0: 1
1: 0
2: 4
3: 79
4: 819
Right 960681650 3:120254179-120254201 GCTTGACAAAAACAAGCAATAGG 0: 7
1: 239
2: 4946
3: 13186
4: 5822
960681647_960681652 8 Left 960681647 3:120254154-120254176 CCTACCACCATCTGACTGTTGAC 0: 1
1: 0
2: 4
3: 79
4: 819
Right 960681652 3:120254185-120254207 CAAAAACAAGCAATAGGGAAAGG 0: 219
1: 4674
2: 12526
3: 5370
4: 3080
960681647_960681653 28 Left 960681647 3:120254154-120254176 CCTACCACCATCTGACTGTTGAC 0: 1
1: 0
2: 4
3: 79
4: 819
Right 960681653 3:120254205-120254227 AGGATTCCCTATTTAACAAATGG 0: 555
1: 13050
2: 6205
3: 3733
4: 3871

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960681647 Original CRISPR GTCAACAGTCAGATGGTGGT AGG (reversed) Intronic
900734431 1:4287406-4287428 GTCAAAGATCAGATGGTTGTAGG + Intergenic
903023035 1:20407343-20407365 GTCAAAGATCAGATGGTTGTAGG - Intergenic
904150813 1:28438068-28438090 GTCAGCAGCCAGAATGTGGTTGG + Intronic
905100507 1:35517413-35517435 GTCAAAACTCAGATGTTCGTAGG - Intronic
905953101 1:41969409-41969431 GTCAAAGATCAGATGGTTGTAGG - Intronic
905959680 1:42033195-42033217 TTCAGGGGTCAGATGGTGGTAGG - Intronic
906979666 1:50616144-50616166 GTCAAAAATCAGATGGTTGTAGG + Intronic
907141249 1:52187166-52187188 GTCAAAGATCAGATGGTTGTAGG - Intronic
907860757 1:58350747-58350769 GTCAAAGATCAGATGGTTGTAGG + Intronic
908819933 1:68075336-68075358 GTCAAAGTTCAGATGGTTGTAGG + Intergenic
909260858 1:73487589-73487611 GTCAAAGATCAGATGGTTGTAGG + Intergenic
909273929 1:73660489-73660511 GTCAAAAATCAGATGGTTGTAGG - Intergenic
909374894 1:74928767-74928789 GTCAAAGATCAGATGGTTGTAGG - Intergenic
909695222 1:78460776-78460798 GTCAAAGATCAGATGGTTGTAGG + Intronic
909714924 1:78696330-78696352 GTCAAATTTCAGATGGTTGTAGG + Intergenic
909743320 1:79060717-79060739 GCCAACAGTCGGTTGGTTGTAGG - Intergenic
909806640 1:79880990-79881012 GTCAAAGATCAGATGGTTGTAGG - Intergenic
910016420 1:82530411-82530433 GTCAAAGATCAGATGGTTGTAGG + Intergenic
910813229 1:91259257-91259279 GTCAAAGATCAGATGGTTGTAGG - Intergenic
911117574 1:94262103-94262125 GTCAAAGATCAGATGGTTGTAGG - Intronic
911252699 1:95596012-95596034 GTCAAAGGTCAGATGGTTGTAGG - Intergenic
911272515 1:95820281-95820303 GTCAAAGATCAGATGGTTGTAGG + Intergenic
911548517 1:99251147-99251169 GTCAATAGGCAGCAGGTGGTTGG + Intergenic
911785110 1:101936808-101936830 GTCAAAGATCAGATGGTTGTAGG - Intronic
911874389 1:103140552-103140574 GTCAAAGATCAGATGGTTGTAGG - Intergenic
912656938 1:111494847-111494869 GTCAAGGATCAGATGGTTGTAGG - Intronic
912957050 1:114162197-114162219 GTCAAAGATCAGATGGTTGTAGG - Intergenic
913217784 1:116634985-116635007 GGTTACAGTCAGATGGTGGTTGG - Intronic
913391132 1:118313671-118313693 GTCAAAGATCAGATGGTTGTAGG - Intergenic
913990928 1:143611029-143611051 GTTAGCAGTCAGCTGGGGGTGGG - Intergenic
914363830 1:146960507-146960529 GTTTGCAGTCAGATGGGGGTGGG + Intronic
914405561 1:147368282-147368304 GTCAAAGATCAGATGGTTGTAGG + Intergenic
915019474 1:152765493-152765515 GTCATCAGTGAAATGGTGGATGG - Intronic
915048130 1:153036777-153036799 GTCAACAATTAGATGGCTGTAGG + Intergenic
915523374 1:156461761-156461783 GGCCTCACTCAGATGGTGGTTGG + Intergenic
916646223 1:166787945-166787967 GTCAAAGATCAGATGGTTGTAGG + Intergenic
916904521 1:169267620-169267642 GTCAAAGATCAGATGGTTGTAGG - Intronic
917181247 1:172300513-172300535 GTCAAAGATCAGATGGTTGTAGG - Intronic
917248122 1:173026675-173026697 GTCAAAAATCAGATGGTTGTGGG + Intergenic
917267599 1:173238108-173238130 GTCAAAGATCAGATGGTTGTAGG - Intergenic
917290336 1:173465990-173466012 GTCAAAGATCAGATGGTTGTAGG - Intergenic
917352120 1:174089199-174089221 GTCAAAGATCAGATGGTTGTAGG + Intergenic
917363529 1:174203397-174203419 GTCAAAGATCAGATGGTTGTAGG + Intronic
917832616 1:178909192-178909214 GTCAAAGATCAGATGGTAGTAGG + Intronic
918165741 1:181945801-181945823 GTCAACAATCAGATAGTTGTAGG - Intergenic
918191673 1:182181487-182181509 CTCAACAGTGAGATGTTTGTGGG + Intergenic
918278772 1:182981848-182981870 GTCAAAGGTCAGATAGTTGTAGG + Intergenic
918665187 1:187142256-187142278 GTCAAAGATCAGATGGTTGTAGG - Intergenic
918842404 1:189558706-189558728 GTCAAATATCAGATGGTTGTAGG - Intergenic
918858850 1:189795210-189795232 GTCAAAGATCAGATGGTGGTAGG + Intergenic
918867227 1:189917837-189917859 ATCAACGATCAGTTGGTGGTAGG + Intergenic
919009313 1:191939274-191939296 GTCAAAGATCAGATGGTGGTAGG + Intergenic
919195318 1:194277495-194277517 GTCAAATATCAGATGGTTGTAGG - Intergenic
919203716 1:194392989-194393011 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919235139 1:194831235-194831257 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919239907 1:194901000-194901022 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919287524 1:195583109-195583131 GTCAAAGATCAGATGGTTGTAGG - Intergenic
919355850 1:196520648-196520670 GTCAAAGATCAGATGGTTGTAGG - Intronic
920899240 1:210090074-210090096 GTCACCAGTCTGATTGTGGGAGG + Intronic
921104709 1:211964672-211964694 GTCAAAGATCAGATGGTTGTAGG - Intronic
921390742 1:214610971-214610993 GTCAAAGATCAGATGGTTGTAGG + Intronic
921408627 1:214810598-214810620 GTCATCAGACAGAGGGTTGTTGG - Intergenic
921540574 1:216409582-216409604 CTCAAAGATCAGATGGTGGTAGG - Intronic
921656546 1:217745107-217745129 GTCAAGTGTCAAATGGAGGTGGG - Intronic
922189615 1:223306409-223306431 ATCAACAGGAAGATGGTGGCAGG + Intronic
922386807 1:225094328-225094350 GTCAAAGATCAGATGGTCGTAGG - Intronic
922681464 1:227601061-227601083 GTCAAAGATCAGATGGTTGTGGG + Intronic
922843203 1:228661529-228661551 GTCAAAGATCAGATGGTTGTAGG - Intergenic
923002475 1:230018864-230018886 GTCAAAGATCAGATGGTTGTAGG + Intergenic
923044142 1:230342925-230342947 GTCAACAGTCACATGAGGCTAGG + Intronic
923930238 1:238686096-238686118 GTCAAAGATCAGATGGTTGTAGG - Intergenic
924048437 1:240055925-240055947 GGAAACAGAAAGATGGTGGTGGG + Intronic
924819535 1:247475447-247475469 GTCAAAGATCAGATGGTTGTAGG - Intergenic
924919019 1:248606510-248606532 GTCAAAGATCAGATGGTTGTTGG + Intergenic
1062785738 10:263248-263270 GTCAACAGGCAGCAGGTGGGTGG + Intergenic
1063186996 10:3660569-3660591 GTCGAAAGTCAGATGGGGGCAGG + Intergenic
1064168909 10:13011898-13011920 GTCAAAGATCAGATGGTTGTAGG - Intronic
1064563614 10:16617687-16617709 GTCGAAGGTCAGATGGTTGTAGG - Intronic
1064872212 10:19950851-19950873 GTCAACAATTAGATGGTTGTAGG - Intronic
1065059731 10:21887587-21887609 GTCAAAAGTCAGATGGTTATAGG - Intronic
1065392733 10:25200781-25200803 GTCAAAGATCAGATGGTTGTAGG + Intronic
1065424666 10:25587101-25587123 GTCAACAGGAAGCAGGTGGTTGG + Intronic
1065507342 10:26442465-26442487 CTCATCAGTGAGATGGTTGTGGG + Intronic
1067199262 10:44152327-44152349 GTCAAAGATCAGATGGTGGTTGG - Intergenic
1067207039 10:44227248-44227270 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1067207082 10:44227773-44227795 GTCAAACATCAGATGGTAGTAGG - Intergenic
1068055639 10:52009872-52009894 GTCAAACATCAGATGGTTGTAGG - Intronic
1068257954 10:54538400-54538422 GTCAAAAATCAGATGATTGTAGG + Intronic
1068290473 10:54995822-54995844 GTCAACAGACAACAGGTGGTAGG - Intronic
1068810740 10:61253078-61253100 GTCAAGGATCAGATGGTTGTAGG + Intergenic
1069044648 10:63729856-63729878 GTCAAACATCAGATGGTTGTAGG - Intergenic
1069167284 10:65177653-65177675 TTCAAAGGTCAGATGGTTGTAGG + Intergenic
1071214875 10:83389423-83389445 GTCAAAAATCAGGTGGTTGTAGG + Intergenic
1071324051 10:84494248-84494270 GTGAACTGTCAGGTGCTGGTGGG + Intronic
1071357733 10:84814821-84814843 GTCAATGATCAGATGGTTGTAGG + Intergenic
1071418881 10:85468934-85468956 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1071875925 10:89843111-89843133 GTCAAAGGTCAGCTGGTTGTGGG + Intergenic
1072207628 10:93218562-93218584 GTCAAAGGTCAGATGGCTGTAGG - Intergenic
1072379862 10:94857038-94857060 GCCAACATTCAGATGGTGCTAGG - Intergenic
1072414915 10:95239049-95239071 GTCAAAGATCAGATGGTTGTGGG - Intronic
1073415907 10:103381780-103381802 TTCAACTGTCAGAGTGTGGTCGG + Exonic
1073863628 10:107775422-107775444 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1073999157 10:109351003-109351025 GTCAAAAATCAGATGGTTATAGG + Intergenic
1074050572 10:109877673-109877695 CTCAACAGACAGATGAAGGTGGG + Intronic
1075095762 10:119469551-119469573 CTCCACAGTCAGAGGGTGCTGGG - Intergenic
1075818991 10:125289403-125289425 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1075840129 10:125494350-125494372 GCCAGCAGACAGATGGGGGTTGG - Intergenic
1077293190 11:1809861-1809883 GTCAGCAGTAAGCAGGTGGTGGG + Intergenic
1077742846 11:4866784-4866806 GTCAAAGATCAGATGGTTGTAGG - Intronic
1077770452 11:5212656-5212678 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1077792653 11:5458258-5458280 GTCAAAGATCAGATGGTTGTAGG + Intronic
1077837878 11:5939976-5939998 ATCAACAGTCAGATCCTGTTAGG - Intergenic
1077882150 11:6359580-6359602 GTCAACATTCAGTTGGATGTTGG - Intergenic
1078028066 11:7718555-7718577 GTCAAAGGTCAGATGGTTTTAGG - Intergenic
1078032774 11:7770053-7770075 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1078278070 11:9870555-9870577 GTCAACGATCAGATGGTTGTAGG - Intronic
1078651758 11:13201462-13201484 GTCAAATGTCAGATGGCTGTAGG - Intergenic
1078989143 11:16628084-16628106 GTCAAAGATCAGATGGTTGTAGG + Intronic
1079578249 11:22029786-22029808 GTCAAAGATCAGACGGTGGTAGG - Intergenic
1080097557 11:28427224-28427246 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1080167541 11:29257371-29257393 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1080221383 11:29909432-29909454 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1080256929 11:30300758-30300780 GTCAACAATTAGATGGTTGTAGG - Intergenic
1081009056 11:37784970-37784992 GTCAAACATCAGATGGTTGTAGG - Intergenic
1081094564 11:38917060-38917082 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1081272392 11:41100892-41100914 GTCAAAGATCAGATGGTTGTAGG - Intronic
1081342079 11:41940996-41941018 GTCAAATATCAGATGGTTGTAGG - Intergenic
1081389291 11:42510351-42510373 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1082688223 11:56266862-56266884 GTCAAAGTTCAGATGGTAGTAGG - Intergenic
1082709472 11:56536728-56536750 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1082818290 11:57525525-57525547 GGCAACAGCCTGATGGTGGATGG - Intergenic
1083102408 11:60322562-60322584 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1084364678 11:68689978-68690000 GTTAACAGGGAGGTGGTGGTGGG + Intronic
1084364733 11:68690227-68690249 GTTAACAGGGAGCTGGTGGTGGG + Intronic
1084665814 11:70575690-70575712 GTCGACACTCAGGTGGTGGGTGG + Intronic
1085222496 11:74886917-74886939 GTCAAAGATCAGATGGTTGTAGG - Intronic
1085891922 11:80590152-80590174 GTTAAAAGTCAGTTGGTTGTAGG - Intergenic
1085965933 11:81526409-81526431 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1086029962 11:82342784-82342806 GTCAAATATCAGATGGTTGTAGG - Intergenic
1086201014 11:84202318-84202340 GTCAAAGATCAGATGGTTGTAGG - Intronic
1086447461 11:86883344-86883366 GTCAAAAATCAGATAGTTGTAGG - Intronic
1086526491 11:87733363-87733385 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1086536915 11:87858154-87858176 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1086741547 11:90375747-90375769 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1087060866 11:93976266-93976288 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1087085065 11:94209752-94209774 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1087316582 11:96610404-96610426 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1087439796 11:98168892-98168914 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1087597718 11:100274072-100274094 GTCGAAAATCAGATGGTTGTAGG - Intronic
1087815280 11:102651575-102651597 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1087848705 11:103003523-103003545 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1088149930 11:106732227-106732249 GTCAAAGATCAGATGGTTGTAGG - Intronic
1088385045 11:109244923-109244945 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1088391042 11:109315448-109315470 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1088471518 11:110192237-110192259 GTCAAAAATCAGATGGTTGTAGG - Intronic
1088516723 11:110644506-110644528 GTCAAAGATCAGATGGTTGTAGG - Intronic
1088945530 11:114508593-114508615 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1089015774 11:115164034-115164056 GTTAACAGTCTGATGGGGGAGGG - Intergenic
1090742589 11:129678841-129678863 GTCGAAAATCAGATGGTTGTAGG - Intergenic
1091822847 12:3489660-3489682 GTCAACATGCAGAAAGTGGTAGG - Intronic
1091850032 12:3688479-3688501 GTCAAAGATCAGATGGTTGTGGG + Intronic
1092264147 12:6968380-6968402 GACACCACGCAGATGGTGGTGGG + Intronic
1092316189 12:7416708-7416730 GTCAAGGATCAGATGGTTGTAGG + Intronic
1092512793 12:9175161-9175183 GTCAAAGATCAGATGGTTGTAGG - Intronic
1092569338 12:9705688-9705710 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1092587768 12:9918389-9918411 GTCAAAGATCAGATGGTCGTAGG + Intronic
1092588516 12:9925839-9925861 GTCAACAGGGAGCAGGTGGTCGG - Intronic
1092627431 12:10342102-10342124 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
1094020858 12:25912675-25912697 GTCAAAGTTCAGATGGTTGTAGG + Intergenic
1094206609 12:27846876-27846898 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1094431597 12:30375553-30375575 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1095610649 12:44123691-44123713 GTCAAAGATCAGATGGTTGTAGG + Intronic
1095625799 12:44313399-44313421 GTCAAAGGTCAGATGGCTGTAGG + Intronic
1096563734 12:52457881-52457903 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1097253208 12:57651185-57651207 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1097303045 12:58038578-58038600 GTCAATGCTCAGATGGTTGTAGG + Intergenic
1097320067 12:58215602-58215624 GTCAAAAATCAGATGGTTTTAGG + Intergenic
1097520793 12:60668126-60668148 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1097922372 12:65090129-65090151 GTCAACAGTCAGCGGGAGATGGG + Intronic
1098145578 12:67494488-67494510 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1098658055 12:73057808-73057830 TTCTACAGACAGAAGGTGGTAGG - Intergenic
1098788227 12:74786567-74786589 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1099130777 12:78827689-78827711 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1099200785 12:79674254-79674276 GTCAAAGATCAGATGGTTGTAGG - Intronic
1099252954 12:80280586-80280608 GTCAAAGATCAGATGGTTGTAGG + Intronic
1099265916 12:80447690-80447712 GTCAAAAATCAGTTGGTTGTAGG + Intronic
1100034773 12:90236899-90236921 GTCAACAGGCAGAAAGTGGGAGG - Intergenic
1100132839 12:91517758-91517780 GTCAAAAATCAGATGGCTGTAGG - Intergenic
1100761159 12:97809062-97809084 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1100772791 12:97941845-97941867 TTTAAGAGTCAGATGGTGGGAGG + Intergenic
1101280782 12:103253096-103253118 GTCAAAGATCAGATGGTTGTAGG + Intronic
1101344630 12:103875235-103875257 GTCGAAGATCAGATGGTGGTAGG - Intergenic
1101636500 12:106547201-106547223 GTCAAAGATCAGATGGTTGTAGG + Intronic
1101861699 12:108487586-108487608 GTCAAAGATCAGATGGTTGTGGG - Intergenic
1102225209 12:111223751-111223773 GTTCACAGTCAGATGGCAGTTGG - Intronic
1103111251 12:118280485-118280507 GTCAAAGATCAGATGGTTGTAGG + Intronic
1103990038 12:124792864-124792886 GGCTACAGTCAGCTGGTGCTGGG + Intronic
1104190108 12:126473247-126473269 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1104225203 12:126825010-126825032 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1104240329 12:126983204-126983226 GTCAGCAGTCAAATGGTGACAGG + Intergenic
1104305403 12:127606156-127606178 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1104533891 12:129599537-129599559 GTCAACAGTTTTATGGTTGTAGG - Intronic
1104940824 12:132393939-132393961 TTCAAGAGCCAGCTGGTGGTGGG - Intergenic
1105835311 13:24205784-24205806 GTCAAAGGTCAGATAGTTGTAGG - Intronic
1106604738 13:31217721-31217743 GTCAAAGATCAGATGGTTGTAGG + Intronic
1106648176 13:31659590-31659612 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1106889788 13:34232488-34232510 GTCAAAAATCAGATGGTTGCAGG + Intergenic
1107116206 13:36748524-36748546 GTCAAAGGTCATATGGTTGTAGG + Intergenic
1107324172 13:39223012-39223034 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1107329955 13:39288676-39288698 GTCAAAAATCAGATGGTTGTAGG - Intergenic
1107568012 13:41626619-41626641 GTCAAATATCAGATGGTTGTAGG - Intronic
1107779690 13:43885457-43885479 GTCAAAGATCAGATGGTTGTAGG - Intronic
1108226218 13:48292421-48292443 GTCTACAGACAGATGTTGGCTGG + Intergenic
1108239714 13:48450452-48450474 GTCAAAGATCAGATGGTTGTAGG + Intronic
1108854805 13:54779644-54779666 GTCAAAAATCAGATTGTTGTAGG - Intergenic
1109137595 13:58673910-58673932 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1109621521 13:64913506-64913528 GTCAAAAATCAGATTGTTGTAGG - Intergenic
1109714089 13:66198190-66198212 GTCAAAGTTCAGATGGTTGTAGG - Intergenic
1109715251 13:66213376-66213398 GTCAAAGATCAGTTGGTGGTAGG - Intergenic
1109799059 13:67350619-67350641 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1109913242 13:68944509-68944531 GGCAACTCTCAGATGGTGGAGGG - Intergenic
1109997260 13:70145141-70145163 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1110611917 13:77498242-77498264 CTCATCAGTAAAATGGTGGTAGG + Intergenic
1110732907 13:78901278-78901300 GTCAAAAATCAGATGGTTGTAGG - Intergenic
1110876422 13:80516429-80516451 GTCAAATATGAGATGGTGGTAGG + Intergenic
1111201877 13:84948865-84948887 GTCAACAGAAAGCAGGTGGTTGG - Intergenic
1111207042 13:85024484-85024506 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1111260704 13:85736606-85736628 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1111318642 13:86594542-86594564 GTCAAAGGTCAGATGGTCATAGG - Intergenic
1112427537 13:99316816-99316838 GTCAACAGCTAGCAGGTGGTGGG - Intronic
1112584798 13:100708795-100708817 GACACCAGTCAGATTGTGTTAGG + Intergenic
1112684989 13:101814589-101814611 GTCAGCAGTCACTTGGGGGTAGG - Intronic
1112782785 13:102919716-102919738 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1112868487 13:103938532-103938554 GGATGCAGTCAGATGGTGGTTGG + Intergenic
1113227361 13:108173938-108173960 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1113282914 13:108809834-108809856 GTCCACAGTCAGTGAGTGGTGGG - Intronic
1113522103 13:110948474-110948496 GTGAAGAGACAGAGGGTGGTAGG - Intergenic
1114054611 14:18956621-18956643 TTCAAAGGTCAGATGGTTGTGGG + Intergenic
1114067760 14:19079436-19079458 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1114094497 14:19320590-19320612 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1114107943 14:19445310-19445332 TTCAAAGGTCAGATGGTTGTGGG - Intergenic
1114361302 14:21976008-21976030 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1114586731 14:23821698-23821720 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1114604153 14:23982654-23982676 GTCAAAAATCTGATGGTTGTAGG - Intronic
1114609176 14:24025453-24025475 GTCAAAAATCTGATGGTTGTAGG - Intergenic
1114797958 14:25738595-25738617 GTCAACGATCAGATAGTTGTAGG - Intergenic
1114937252 14:27556094-27556116 GTCAAAAATCAGACGGTTGTAGG - Intergenic
1115077321 14:29407527-29407549 GTCAAAAATCAGATGGCTGTAGG + Intergenic
1115110577 14:29816397-29816419 GACAACAGACACATGGTGGTAGG + Intronic
1115764634 14:36610858-36610880 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1115869306 14:37781917-37781939 GTCAAAGATCAGATGGTTGTAGG + Intronic
1115942497 14:38625057-38625079 GTCAAAGATCAGTTGGTGGTAGG - Intergenic
1116084586 14:40218438-40218460 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1116125872 14:40784493-40784515 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1116319942 14:43448763-43448785 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1116575475 14:46568932-46568954 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1116671140 14:47844995-47845017 GTCAAAAATCAGATGTTTGTTGG + Intergenic
1116808952 14:49520864-49520886 GTTTGCAGTCAGATGGTGGGTGG + Intergenic
1116943555 14:50814741-50814763 GTCAAAGATCAGATGGTTGTAGG - Intronic
1117080423 14:52146139-52146161 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1117829657 14:59737862-59737884 GTCAAAGATCAGATGGTTGTAGG - Intronic
1118027118 14:61780720-61780742 GTCAACCATCAGGTGGTCGTAGG + Intronic
1118325973 14:64780925-64780947 GTCAAAGATCAGATGGTGGTAGG - Intronic
1119376751 14:74200456-74200478 GGCAATAGTCTGATGGTGTTTGG + Exonic
1120252657 14:82077968-82077990 CTCAACAATCAGAGGGAGGTAGG - Intergenic
1120283543 14:82468692-82468714 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1120336005 14:83155921-83155943 GTCAAAGATCAGATGGTTGTGGG - Intergenic
1120588062 14:86340431-86340453 GTCAAAAATCAGATAGTTGTAGG + Intergenic
1121243886 14:92449138-92449160 GTCAACAGTGAGCTGGAGGCTGG + Exonic
1122350052 14:101083873-101083895 ATCAACAATCACATGGGGGTTGG + Intergenic
1122389684 14:101371646-101371668 GACAACAGTCCGGTGGAGGTAGG - Intergenic
1123214681 14:106796276-106796298 GTCAAAAAACAGATGGTTGTGGG + Intergenic
1123857733 15:24431019-24431041 GTCAAAGGTCAGATGGTCATAGG + Intergenic
1124113196 15:26812587-26812609 GTCAAAGATCAGATGGTTGTAGG - Intronic
1124353920 15:28980888-28980910 GTCAAAGGGCAGATGGTTGTAGG - Intronic
1124811945 15:32949403-32949425 GTCAAAGGTCAGATAGTTGTAGG - Intronic
1125254699 15:37750108-37750130 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1125787707 15:42336333-42336355 GTCAAAGATCAGATGGTTGTAGG - Intronic
1125867481 15:43066257-43066279 GTCAATAATCAGATGGTTCTAGG + Intronic
1125891797 15:43272606-43272628 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1126476759 15:49073396-49073418 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1126502626 15:49362913-49362935 GTCAAAGGTTAGATGGTAGTAGG + Intronic
1126507082 15:49417521-49417543 GTCAACGATCAGATAGTTGTGGG - Intronic
1126715377 15:51510893-51510915 GTCAAAGATCAGATGGTTGTAGG - Intronic
1126948715 15:53854585-53854607 GTCAAAGGTCAGATAGTTGTAGG + Intergenic
1126956756 15:53941155-53941177 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1127054995 15:55122234-55122256 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1127058430 15:55156383-55156405 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1127208025 15:56740631-56740653 GTCAAAGGTCAATTGGTGGTAGG + Intronic
1127231093 15:56996345-56996367 GTCAACAATCAGATGGTTGTAGG - Intronic
1127374177 15:58367762-58367784 GTCAAAGATCAGATGGTTGTAGG - Intronic
1127387092 15:58475391-58475413 GTCAAGAGGCAGATGGTGAAGGG - Intronic
1127837036 15:62798165-62798187 GGCAGCAGCCAGATGGGGGTGGG + Intronic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1128895415 15:71368575-71368597 GTCAAAGATCAGATGGTTGTAGG + Intronic
1129234090 15:74213581-74213603 GCCAACCTTCAGAGGGTGGTGGG + Intergenic
1129965092 15:79727861-79727883 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1130189357 15:81717651-81717673 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1130779566 15:87021194-87021216 GTCAAAGATCAGATGGTTGTAGG - Intronic
1130800527 15:87258048-87258070 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1131555137 15:93391269-93391291 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1132975930 16:2711271-2711293 GTCAACAGGCAGATGCCCGTGGG - Intergenic
1133603903 16:7367199-7367221 GCAAACAGTAAGATGGGGGTGGG - Intronic
1134792806 16:17005534-17005556 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1135911235 16:26562942-26562964 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1138306884 16:55985593-55985615 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1138583639 16:57957110-57957132 GCCCAGAGCCAGATGGTGGTTGG - Intronic
1138876418 16:60956245-60956267 ATGATCAGTCAGGTGGTGGTTGG - Intergenic
1139042571 16:63015779-63015801 GTCAAATATCAGATGGTCGTAGG + Intergenic
1139080681 16:63515657-63515679 AATTACAGTCAGATGGTGGTTGG + Intergenic
1139087920 16:63610974-63610996 GTCAAAAATAAGATGGTTGTAGG + Intergenic
1139263138 16:65614550-65614572 GTCTAAAATCAGATGGTTGTAGG + Intergenic
1139290084 16:65849908-65849930 GTCCAGGGTCAGATGGTGGCAGG + Intergenic
1139783001 16:69367161-69367183 GTCATCATTCCAATGGTGGTTGG + Exonic
1139845686 16:69919598-69919620 GTCCACAGTGAGCTGGAGGTGGG + Intronic
1140076281 16:71701576-71701598 GTCATTTATCAGATGGTGGTAGG + Intronic
1140697986 16:77553823-77553845 GTCAACAGTTAGCTGGTTCTAGG + Intergenic
1140804831 16:78523563-78523585 GTGGACAGTCTGATGGAGGTGGG + Intronic
1143174251 17:4947549-4947571 GTGGACAGGGAGATGGTGGTGGG + Intronic
1143355970 17:6328837-6328859 TTCAAGAGATAGATGGTGGTGGG + Intergenic
1143593122 17:7897832-7897854 GTCAACAGTGAGCTGCTGGAAGG - Intronic
1143983084 17:10887203-10887225 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1143991693 17:10969225-10969247 GTCAAAGATCAGATGGTCGTAGG - Intergenic
1147925894 17:43945683-43945705 GTAAACTGTCTGATGCTGGTGGG - Intergenic
1149063816 17:52456701-52456723 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1149199352 17:54164742-54164764 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1149395324 17:56235644-56235666 GTCAAAGATCAGATGGTTGTAGG + Intronic
1150028448 17:61704170-61704192 GTCAAAGATCAGATGGTTGTAGG + Intronic
1150537573 17:66059013-66059035 GTCAAAGATCAGATGGTTGTAGG - Intronic
1150544343 17:66138249-66138271 GTCAACAGGAAGCAGGTGGTTGG + Intronic
1151122963 17:71813348-71813370 GTCAAAGATCAGATGATGGTAGG - Intergenic
1152454454 17:80405413-80405435 TTCTGCAGGCAGATGGTGGTTGG - Intergenic
1152994855 18:396980-397002 GTCACTTGACAGATGGTGGTAGG - Intronic
1153712619 18:7815147-7815169 GCCAACAGGCAGTAGGTGGTGGG - Intronic
1153857371 18:9163333-9163355 GTCAAAGGTCAGATGATTGTGGG + Intronic
1153954278 18:10082998-10083020 GTCAACAGGCAGCAGGTGGTGGG + Intergenic
1153957042 18:10105816-10105838 GTCAAAAATCAGATGGCTGTAGG + Intergenic
1154230865 18:12555016-12555038 GTCAACAGGAAGTAGGTGGTCGG - Intronic
1154398003 18:14009723-14009745 GTCAAAGATCAGATGGTTGTGGG + Intergenic
1154460406 18:14578570-14578592 GTCAAATATCAGATAGTGGTAGG + Intergenic
1155448417 18:25937356-25937378 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1155480420 18:26280641-26280663 GTCAAAAAACAGATGCTGGTGGG + Intronic
1155764781 18:29614792-29614814 GTCAAAGGTCAGATAGTTGTAGG - Intergenic
1157477145 18:48030685-48030707 GTCACCAGCAAGTTGGTGGTGGG - Intronic
1158075414 18:53522619-53522641 GTCAAAGATCAGATGGTTGTAGG - Intronic
1158631328 18:59117349-59117371 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1158738005 18:60105826-60105848 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1158814849 18:61083490-61083512 GTTAACAGGCACATGGTGGAAGG - Intergenic
1158853859 18:61522765-61522787 GTCAAAGATCAGATGGTTGTAGG - Intronic
1159395571 18:67851355-67851377 GTCAAAGATCAGATGGTCGTAGG - Intergenic
1159419010 18:68191335-68191357 GTCAAATGTCAGATGGTGGTAGG + Intergenic
1160250053 18:77195080-77195102 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1160361021 18:78278764-78278786 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1162390983 19:10390133-10390155 GGCAACAGGCAGATGGTGCTGGG + Intergenic
1163181126 19:15603318-15603340 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1163231257 19:16004143-16004165 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1163425250 19:17237198-17237220 GTCAACTGTCAAATGGGGATAGG + Intronic
1163921136 19:20290003-20290025 GTCAAAAATCTGATGGTTGTAGG + Intergenic
1163954963 19:20629073-20629095 GTCAAAGGTCAGATAGTTGTAGG + Intronic
1164039167 19:21479424-21479446 GTCAAAGGTCAGATGGTTGCAGG + Intronic
1164043772 19:21515873-21515895 GTCAAATATCAGATGGTCGTAGG + Intronic
1164101757 19:22060914-22060936 GTCAAAGATCAGATGGTTGTAGG + Intronic
1164121650 19:22270690-22270712 GTCAACTATAAGATGGTGTTTGG - Intergenic
1164209513 19:23086578-23086600 GTCAAAGGTCAGATGGTTGTAGG + Intronic
1164448647 19:28339446-28339468 GCCAAAAATCAGATGGTTGTAGG + Intergenic
1164877624 19:31702720-31702742 GACTACAGTCAGATGGTGGCTGG + Intergenic
1166176072 19:41071222-41071244 GTCAAAGGTCAGATGGCTGTAGG + Intergenic
1167787983 19:51651438-51651460 GGCAGCAGTCAGAGGGTGGATGG - Intergenic
925320615 2:2964156-2964178 GTCAAAGATCAGATGGTTGTAGG - Intergenic
925322371 2:2983975-2983997 GTCAAAGATCAGATGGTTGTAGG - Intergenic
925541805 2:4975322-4975344 GTCACCAATCTGATGGTGTTAGG + Intergenic
926290338 2:11524245-11524267 TTCAACAGTCTGAAGGAGGTGGG + Intergenic
926353746 2:12021125-12021147 GTCAACAGGTAGCAGGTGGTCGG - Intergenic
926402307 2:12510127-12510149 GTCAAAGGTCAGATGGTTGTAGG + Intergenic
926545098 2:14230103-14230125 GTCAAAGATCAGATGGTTGTAGG + Intergenic
927871322 2:26626024-26626046 GTCAAAGATCAGATGGTTGTAGG + Intronic
928041450 2:27881769-27881791 GTCAAAGATCAGATGGTTGTAGG - Intronic
928346376 2:30501002-30501024 GTCAACAGGCAGCAGGTGGTTGG - Intronic
928696141 2:33852087-33852109 GTCAACAGGAAGCAGGTGGTCGG + Intergenic
929076137 2:38080399-38080421 GTCATCAGGCACATGCTGGTAGG + Intronic
929109469 2:38394401-38394423 GTCAAAGATCAGATGGTTGTAGG - Intergenic
929306495 2:40368889-40368911 GTCAAAGGGCAGATGGTTGTGGG - Intronic
929373423 2:41254821-41254843 GTCAAAGATCAGATGGTTGTAGG - Intergenic
929975291 2:46627899-46627921 GTCAAAGGTCAGATGGCTGTAGG + Intergenic
930501890 2:52232024-52232046 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930516144 2:52410122-52410144 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930594961 2:53376234-53376256 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930673262 2:54173829-54173851 GTCAAAGATCAGATGGTTGTAGG + Intronic
930839599 2:55830908-55830930 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930943488 2:57042213-57042235 GTCAAAGATCAGATGGTTGTAGG - Intergenic
930981458 2:57530862-57530884 GTCAAAGATCAGATGGTTGTAGG - Intergenic
932482726 2:72056866-72056888 GTCAAAGATCAGATGGTTGTAGG + Intergenic
932542266 2:72667575-72667597 GTCAAAGATCAGATGGTTGTAGG - Intronic
933018937 2:77166656-77166678 GTCAAAGATCAGATGGTTGTAGG - Intronic
933118280 2:78501274-78501296 GTCAAAGTTCAGATGGTTGTAGG + Intergenic
933359049 2:81254103-81254125 GTCCAAGATCAGATGGTGGTAGG + Intergenic
933363110 2:81313471-81313493 CTCAAAGATCAGATGGTGGTAGG - Intergenic
933465600 2:82647016-82647038 GTCAATAATCAGATGGTTCTAGG - Intergenic
933603605 2:84358670-84358692 GTCAAAGATCAGATGGTTGTAGG - Intergenic
933873236 2:86590803-86590825 GTCAAAGATCAGATGGTTGTGGG + Intronic
934996153 2:98962656-98962678 GTCAAAGATCAGATGGTTGTAGG + Intergenic
936118774 2:109724058-109724080 GTCAAAGATCAGATGGTTGTAGG + Intergenic
936172491 2:110188847-110188869 GTCAAAGATCAGATGGTTGTAGG - Intronic
936649440 2:114409288-114409310 GTCAAAGATCAGATGGTTGTAGG + Intergenic
937633321 2:124127760-124127782 GTCAAAGGTCAAATGGTTGTAGG - Intronic
937723385 2:125129671-125129693 GTCAAATATCAGATGGTTGTGGG - Intergenic
938485405 2:131702039-131702061 GTCAAAGATCAGATGGTTGTAGG + Intergenic
939111130 2:138008626-138008648 GTCAAAGATCAGATGGTCGTAGG - Intronic
939199179 2:139013185-139013207 GTCAAAGATCAGATGGTTGTAGG + Intergenic
939242422 2:139578382-139578404 GTCAAAAATCAGATGGTTGTAGG - Intergenic
940208585 2:151232920-151232942 GTCAAAGATCAGATGGTCGTAGG - Intergenic
940366595 2:152855060-152855082 GTCAAAGATCAGATGGTTGTAGG + Intergenic
940615417 2:156043339-156043361 GTCAAAGATCAGATGGTTGTAGG - Intergenic
941112869 2:161435858-161435880 GTCAAATATCAGATGGTTGTAGG + Intronic
941247585 2:163119494-163119516 GTAAAAAGTAAGATGGAGGTGGG + Intergenic
941566136 2:167110459-167110481 GTCAAAGATCAGATGGTTGTAGG + Intronic
941704824 2:168646821-168646843 GTCAAAGATCAGATGGTCGTAGG + Intronic
942531950 2:176920388-176920410 GTCAACAGGCAGCTGGCGGTGGG - Intergenic
942643063 2:178080436-178080458 GTCAAAGATCAGATGGTTGTAGG + Intronic
942793085 2:179783182-179783204 GTCAAAGATCAGATGGTTGTAGG - Intronic
942819642 2:180097299-180097321 GTCAAGGATCAGATGGTTGTAGG - Intergenic
943030265 2:182677721-182677743 GTCAAAGATCAGATGGTTGTAGG - Intergenic
943074280 2:183175655-183175677 GTCAAAGATCAGATGGTTGTAGG + Intergenic
943283533 2:185967526-185967548 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
943352905 2:186816662-186816684 GTCAAAGATCAGATGGTTGTAGG - Intergenic
943505780 2:188755621-188755643 GTCAAAAATCAGATGGTTGTAGG + Intronic
943629875 2:190239254-190239276 GTCAAAGATCAGATGGTTGTAGG + Intronic
944322721 2:198366724-198366746 ATCAACAGTGAGAAAGTGGTAGG + Intronic
944327766 2:198426913-198426935 GTCAAAGATCAGATGGTTGTAGG + Intronic
944360751 2:198853197-198853219 GTCAAAGATCAGATGGTTGTGGG - Intergenic
944371006 2:198984012-198984034 GTCAAAGATCAGATGGTTGTAGG - Intergenic
944622200 2:201527609-201527631 GTCAAAAATCAGATGGATGTAGG - Intronic
945523190 2:210854771-210854793 GTCAAAGATCAGATGGTTGTAGG + Intergenic
945734050 2:213576213-213576235 GTCAAAAATCAGATAGTTGTAGG + Intronic
946017927 2:216619208-216619230 GTCATCAGGGAGATGGAGGTAGG + Intergenic
946471676 2:219966519-219966541 GTTAAAAGTAAGATGGGGGTTGG - Intergenic
946483161 2:220075747-220075769 GTCAAATGTCACATGGGGGTGGG + Intergenic
947060489 2:226159214-226159236 CTCAAAAATCAGATGGTTGTAGG - Intergenic
947198191 2:227590224-227590246 GTCAAAGATCAGATGGTTGTAGG + Intergenic
947281129 2:228456220-228456242 GTCAAAAATCAGATGGTTGTAGG + Intergenic
947515869 2:230804099-230804121 GTCAAAGATCAGATGGTTGTAGG - Intronic
948127626 2:235576454-235576476 GTCACCAGGCAGGTGGTGCTTGG + Intronic
948343542 2:237275983-237276005 GTCAAAGGTCAGATGGTTGTAGG - Intergenic
948478804 2:238238127-238238149 GTGAGCAGTGTGATGGTGGTGGG - Intergenic
1169024745 20:2359979-2360001 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1169506002 20:6212670-6212692 GTCAAAGGTCAGTTGGTTGTAGG - Intergenic
1169657958 20:7946251-7946273 GGCAAGAGTCAAATGGTTGTAGG + Intergenic
1170162450 20:13327657-13327679 GTCAAAGGTCAGATAGTTGTAGG - Intergenic
1170514218 20:17111125-17111147 GTCAAAAATCAGATAGTTGTAGG + Intergenic
1170769130 20:19317019-19317041 GTCAAAGGTCAGATGGTTGTAGG - Intronic
1171112617 20:22498084-22498106 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1171228603 20:23463107-23463129 TTCAAAAGTCAGATAGTTGTAGG + Intergenic
1171231177 20:23487058-23487080 ATCAAAGATCAGATGGTGGTAGG + Intergenic
1171331457 20:24342571-24342593 GGTAACAGTCAGATGGTGCCAGG - Intergenic
1171937702 20:31291476-31291498 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1172363017 20:34327441-34327463 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG + Intergenic
1174311704 20:49660936-49660958 GGCAACAGTGAGATGCTGTTTGG + Intronic
1174457948 20:50662712-50662734 GTCACCAGCCAGAGAGTGGTGGG - Intronic
1174955384 20:55092091-55092113 GCCTACAGTCAGATGTTGGCTGG + Intergenic
1176898402 21:14410982-14411004 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1177181787 21:17752266-17752288 GTCAACAGTCACCTGGAGGTAGG - Intergenic
1177924276 21:27194473-27194495 GTCAAATGTCAGATGGTTGTAGG - Intergenic
1178186846 21:30231991-30232013 GTCAAAGATCAAATGGTGGTAGG - Intergenic
1178835460 21:36093845-36093867 GTCAACAGGCAGCAGGTGGTGGG - Intergenic
1179109300 21:38432517-38432539 GTCAACAGTGAAATACTGGTTGG - Intronic
1179261385 21:39761106-39761128 GTCAAAGGTCAGATGGTTGTAGG - Intronic
1180236725 21:46465269-46465291 GTCAAAAGTCAGATTTTGGCTGG + Intronic
1180473080 22:15679013-15679035 TTCAAAGGTCAGATGGTTGTGGG + Intergenic
1180486235 22:15802005-15802027 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1180577841 22:16797021-16797043 GTCAAAGATCAGATGGTTGTAGG - Intronic
1182430925 22:30298560-30298582 GTCAACAAAGAGCTGGTGGTAGG + Intronic
1182606304 22:31507206-31507228 GTCAAAGATCAGATGGTTGTAGG - Intronic
1182702064 22:32248467-32248489 GTCAACAGGAAGCTGGTGGTGGG - Intronic
1182892368 22:33829730-33829752 TTGAACAGCCAGATGGTGGCTGG - Intronic
1184976094 22:48063527-48063549 GTCAAAGATCAGATGGTTGTAGG - Intergenic
950588790 3:13919457-13919479 GTCAAGGATCAGATGGTTGTAGG + Intergenic
950608076 3:14102233-14102255 GTCAAAGATCAGATGGTTGTAGG - Intergenic
951181483 3:19664406-19664428 GTCAAAGATCAGATGGCGGTAGG - Intergenic
951440613 3:22719013-22719035 GTCAAAGATCAGATGGTTGTGGG - Intergenic
952050129 3:29375060-29375082 GTCAAAGATCAGATGGTTGTAGG - Intronic
952546592 3:34426705-34426727 GTCAAAGGTCAGATAGTGGTAGG - Intergenic
952664696 3:35890140-35890162 GTCAAAAATCAGTTGGTAGTTGG + Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953089710 3:39712832-39712854 GTCAACAGAAAGCAGGTGGTTGG + Intergenic
953491639 3:43357648-43357670 GTCAAAGATCAGATGGTTGTAGG - Intronic
953516389 3:43596463-43596485 GTCAAAGGTCAGATGGTTGTAGG - Intronic
954892720 3:53946116-53946138 GTCAACAGGAAGCAGGTGGTGGG - Intergenic
955174605 3:56601263-56601285 GTCAAAGATCAGATGGTTGTGGG + Intronic
955180066 3:56659451-56659473 GTCAAACATCAGATTGTGGTGGG - Intronic
955471714 3:59293648-59293670 GTCAAAGATCAGATGGTTGTAGG + Intergenic
955886335 3:63602636-63602658 GTCAAAGATCAGATGGTTGTAGG + Intronic
956301486 3:67776897-67776919 GTCAAAAATCAGGTGGTTGTAGG + Intergenic
957105037 3:75876105-75876127 GTCAAAGATCAGATGGTTGTAGG - Intergenic
957446433 3:80317765-80317787 GTCAAAGATCAGATGGTTGTAGG - Intergenic
957542673 3:81593977-81593999 GTCAAACATAAGATGGTGGTTGG - Exonic
958088731 3:88848390-88848412 GTCAAAAATCAGATGATTGTAGG + Intergenic
958769836 3:98413015-98413037 GTCAAAGATCAGATGGTTGTAGG - Intergenic
958782445 3:98558963-98558985 GTCGACGATCAGATGGTTGTAGG - Intronic
958854552 3:99368801-99368823 GTCAAAGATCAGATGGTTGTAGG + Intergenic
958870848 3:99557192-99557214 GTCAAAGATCAGATGGTTGTAGG - Intergenic
959221081 3:103521003-103521025 TTCAAGAATCAGTTGGTGGTAGG - Intergenic
959392727 3:105796294-105796316 GTCAAAGATCAGATGGTTGTAGG - Intronic
959779130 3:110206916-110206938 GTCAAAGGTCAGATAGTTGTAGG - Intergenic
960306927 3:116073197-116073219 GTCAAAGATCAGATGGTTGTAGG + Intronic
960681647 3:120254154-120254176 GTCAACAGTCAGATGGTGGTAGG - Intronic
960756057 3:121013928-121013950 GTCAAAGATCAGATGGTTGTAGG + Intronic
960775653 3:121248937-121248959 GTCAAAGGTCACATGGTTGTAGG + Intronic
960858770 3:122130004-122130026 GTCAAATATCAGATGGTTGTAGG - Intergenic
961445148 3:126976991-126977013 GGCCACAGCCAGGTGGTGGTGGG - Intergenic
961932627 3:130549681-130549703 GTCAAAGATCAGATGGTTGTAGG + Intergenic
962122110 3:132572739-132572761 GTCAATGATCAGATGGTTGTAGG - Intronic
962257121 3:133880115-133880137 GTCAAAGATCAGATGGTGGTGGG - Intronic
962278531 3:134033226-134033248 GGCAGCAGTGGGATGGTGGTAGG + Intronic
962470230 3:135700922-135700944 GTCAAAGATCAGATGGTTGTGGG - Intergenic
962510040 3:136089372-136089394 GTCAAATATCAGATGGTTGTAGG + Intronic
962691553 3:137903930-137903952 GTCAAAGATCAGATGGTTGTAGG - Intergenic
962981574 3:140495754-140495776 GTCAAAGATCAGATGGTTGTAGG + Intronic
962997457 3:140644904-140644926 GTCAAAGATCAGATGGTTGTAGG + Intergenic
963032468 3:140992365-140992387 GTCAAAGATCAGATGGTTGTAGG - Intergenic
963050280 3:141136630-141136652 GTCAAAGATCAGATGGTTGTAGG + Intronic
963089441 3:141468932-141468954 GTCAAAAATCAGTTGGTTGTAGG + Intergenic
963862018 3:150321756-150321778 GTCAAAGATCAGATGGTTGTAGG + Intergenic
964214789 3:154267416-154267438 GTCAAAAATCAGATGGTTGTAGG - Intergenic
964370062 3:155991011-155991033 TTGAAGAGGCAGATGGTGGTTGG + Intergenic
964458452 3:156894743-156894765 GTCAAAGATCAGATGGTTGTAGG - Intronic
964581440 3:158243339-158243361 GTCAGAGATCAGATGGTGGTAGG + Intronic
964987429 3:162761560-162761582 GTCAAAGATCAGATGGTTGTAGG + Intergenic
965343982 3:167524696-167524718 GTCAAAGATCAGATGGTTGTAGG + Intronic
966137029 3:176710394-176710416 GTCAAAGATCAGATGGTTGTTGG - Intergenic
966150819 3:176866111-176866133 GTCAAAGATCAGATGGTTGTTGG - Intergenic
966270140 3:178095124-178095146 GTCAAAGGTCAGATAGTTGTAGG - Intergenic
966356950 3:179090671-179090693 GTCAAAGTTCAGATGGTTGTAGG - Intergenic
966573313 3:181471916-181471938 GTCAAAGCTCAGATGGTTGTAGG + Intergenic
966583268 3:181592187-181592209 GTCAAAGATCAGATGGTTGTAGG + Intergenic
967637840 3:191824993-191825015 GTCAAAGGTCAGATGGTTGTAGG - Intergenic
968260048 3:197314104-197314126 GTCAAAGATCAGATGGTTGTAGG + Intergenic
968687046 4:1967816-1967838 GTCAACAGGCAGCAGGTGGTTGG + Intronic
969159410 4:5242868-5242890 GTCAAAGATCAGATGGTTGTAGG + Intronic
970110013 4:12627376-12627398 GTCAATGATCAGATGGTTGTAGG + Intergenic
970306424 4:14737192-14737214 GTCAACAATCAGATGATTGTAGG - Intergenic
970875692 4:20867375-20867397 GTCAAAGATCAGACGGTGGTAGG - Intronic
971668682 4:29527928-29527950 GTCAAAGGTCAGATGGTTGTAGG - Intergenic
971989748 4:33877019-33877041 GTCAAAGATCAGATGGTTGTAGG + Intergenic
972256593 4:37362520-37362542 GTCAAAGGTCAGATGGCTGTAGG - Intronic
972264446 4:37445512-37445534 GTCATCAGTCAGCTGGGGGCTGG - Exonic
972648945 4:40997081-40997103 GTCAACAGGAAGCAGGTGGTTGG - Intronic
972791464 4:42375259-42375281 GTCAACAGGCAGCAGGTGGTTGG - Intergenic
973001451 4:44956553-44956575 GTCAAAGTTCATATGGTGGTAGG + Intergenic
973184887 4:47314645-47314667 GTCAAGCATCAGATGGTTGTAGG - Intronic
974094497 4:57348238-57348260 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974297115 4:60014811-60014833 GTCAAATATCAGATGGTTGTGGG + Intergenic
974342366 4:60630734-60630756 GTCAAATGTCAGATGGTTGTAGG + Intergenic
974342476 4:60632271-60632293 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974350067 4:60733053-60733075 GTCAAAGATCAGATGGTTGTAGG + Intergenic
974650168 4:64744760-64744782 GTCAAAGATCAGATGGTTGTAGG + Intergenic
975360852 4:73469953-73469975 GTCAAAGATCAGATGGTTGTAGG + Intergenic
975390197 4:73807315-73807337 GTCAAAGATCAGATGGTTGTAGG - Intergenic
975563976 4:75734426-75734448 GTCAAAGATCAGATGGTTGTAGG + Intronic
975902508 4:79169456-79169478 GTCAAAGATCAGATGGTTGTAGG - Intergenic
976900481 4:90168766-90168788 GTCAAAGATCAGATGGTTGTAGG + Intronic
976979457 4:91208517-91208539 GTCAAACATCAGATGGTTGTAGG + Intronic
977088481 4:92636530-92636552 TTTCACAGTCACATGGTGGTAGG + Intronic
977332468 4:95654704-95654726 GTCATAAGTCAGAGGGTTGTAGG + Intergenic
977505534 4:97898194-97898216 GTCAAAGATCAGATGGTTGTAGG + Intronic
977896103 4:102367032-102367054 GTCAAAGATCAGATGGTTGTAGG - Intronic
977971939 4:103223346-103223368 GTCAAAGATCAGATGGTTGTAGG - Intergenic
978022743 4:103833767-103833789 GTCAAAGATCAGATGGTTGTAGG + Intergenic
978047286 4:104145948-104145970 GTCAACAATCAGTTGTTTGTAGG + Intergenic
978452782 4:108854068-108854090 GTCAAAGATCAGATGGTTGTAGG - Intronic
979019366 4:115476612-115476634 GTCAAAGATCAGATGGTTGTAGG - Intergenic
979263866 4:118679143-118679165 GTCAACAGACAGAAGGTGCTTGG + Intergenic
979310387 4:119196520-119196542 GTCAAAAAACAGATGGTTGTAGG - Intronic
979576418 4:122296767-122296789 GTCAAAGATCAGATGGTTGTAGG - Intronic
979662729 4:123276772-123276794 GTCAAAACTCAGATAGTTGTAGG + Intronic
980392523 4:132165183-132165205 GTCAAAGATCAGATGGTTGTAGG + Intergenic
980665672 4:135930627-135930649 GTCAAAAATCAGATGGTGGTAGG - Intergenic
980777699 4:137458240-137458262 GTAAACTGTCAGGTGCTGGTGGG + Intergenic
980858612 4:138471210-138471232 GTCAAAGATCAGATGGTTGTAGG + Intergenic
981181293 4:141748761-141748783 GTCAAAGATCAGATGGTTGTAGG - Intergenic
981512300 4:145571167-145571189 GTCAAAGATCAGATGGTTGTAGG - Intergenic
981593178 4:146388273-146388295 GTCAAAGGTCAGTTGGTTGTAGG - Intronic
981790556 4:148531740-148531762 GTCAAAGATCAGATGGTTGTCGG + Intergenic
981878406 4:149577521-149577543 GTCAAAGATCAGATGGTTGTAGG + Intergenic
982130785 4:152227078-152227100 GTCACCAGCCAGATGGTGGCAGG + Intergenic
982432013 4:155333850-155333872 GTCAAAGATCAGATGGTTGTAGG - Intergenic
982446126 4:155492449-155492471 GACAACAGTCATATTGTGTTAGG - Intergenic
982499526 4:156135725-156135747 GTCAAAGGTCAGATGGTTGTAGG - Intergenic
982734314 4:158989581-158989603 GTCAAAGATCAGATGGTTGTAGG - Intronic
982747124 4:159115785-159115807 GTCAAAGATCAGATGGTTGTAGG - Intronic
982984887 4:162194716-162194738 GTCAAAGGTCAGATAGTTGTAGG + Intergenic
983441561 4:167793086-167793108 GTCAAAGATCAGATGGTTGTAGG + Intergenic
983778141 4:171634161-171634183 GTCAAATATCAGATGGTTGTAGG + Intergenic
983899437 4:173118056-173118078 GTCAAAGATCAGATGGTTGTAGG - Intergenic
984202196 4:176738402-176738424 GTCAAAAGTCAGATGGTTGTAGG - Intronic
984372833 4:178888780-178888802 GTCAAAGATCAGATGGTTGTAGG - Intergenic
984838134 4:184041081-184041103 GTCAAAAGTCATATGGTTGGTGG + Intergenic
985301038 4:188489822-188489844 GTCAAAGATCAGATGGTTGTTGG + Intergenic
985305043 4:188530253-188530275 GTCAAAGGTCAGATGGTCATAGG - Intergenic
986481483 5:8192974-8192996 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
986753959 5:10816792-10816814 GTCAAAGATCAGATGGTTGTAGG - Intergenic
987092412 5:14520139-14520161 GTCAAAGATCAGATGGTTGTAGG + Intronic
987460671 5:18205515-18205537 GTCAAAGATCAGATGGTTGTAGG + Intergenic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
987583919 5:19829889-19829911 GTCAAAGGTCAGATGTTGGTAGG - Intronic
987997754 5:25308071-25308093 GTCAAAGATCAGATGGTTGTAGG + Intergenic
988001928 5:25360256-25360278 GTCAAAGATCAGATGGTTGTAGG - Intergenic
988976187 5:36518314-36518336 GTCAAAGATCAGATGGTTGTAGG - Intergenic
989432120 5:41367930-41367952 GTCAAAAATCAGATGGTTGTAGG + Intronic
989447732 5:41550447-41550469 GTCAAAAATCAGATGGTTGTAGG - Intergenic
989455861 5:41643369-41643391 GTCAAAGATCAGATGGTTGTAGG - Intergenic
990195149 5:53306436-53306458 GTCAAAGATCAGATGGTTGTAGG + Intergenic
990335884 5:54772504-54772526 GTCAACAGCCAGCAGGTGGGTGG - Intergenic
990434025 5:55769406-55769428 GGCAAAAATCAGATGGTTGTAGG + Intronic
990923011 5:60988630-60988652 GTCAAAGATCAGATGGTTGTAGG - Intronic
991121370 5:63018611-63018633 ATCAAAGGTCAGATGGTTGTAGG + Intergenic
991224694 5:64256492-64256514 GTCAAAGATCAGATGGTTGTAGG + Intronic
992875238 5:81047642-81047664 GCTCACAGTCAGATGGTGTTTGG + Intronic
993286655 5:86007879-86007901 GTCAAAGATCAGATGGTGGTAGG + Intergenic
993389776 5:87305349-87305371 GTCAAAAATCAGATAGTTGTAGG - Intronic
993655537 5:90573940-90573962 GTCAAAGATCAGATGGTTGTAGG + Intronic
993779954 5:92054237-92054259 GTCAAAAATCAGATAGTTGTAGG + Intergenic
993821387 5:92621329-92621351 GTCAAAGATCAGATGGTTGTAGG + Intergenic
993952857 5:94197761-94197783 GTCAAAGATCAGATGGTTGTAGG + Intronic
994060769 5:95474199-95474221 GTCAAAGATCAGATGGTTGTAGG + Intronic
994119553 5:96098613-96098635 GTCAAAGATCAGATGGTTGTAGG + Intergenic
994129312 5:96206594-96206616 GTCAAAGATCAGATGGTTGTAGG + Intergenic
995141652 5:108741931-108741953 TTCAACTATCAGATGGTGATGGG - Intergenic
995155802 5:108911754-108911776 GTCAAAGGTCAGTTGGTTGTAGG + Intronic
995703825 5:114964322-114964344 GTCAAAGATCAGATGGTGGTAGG + Intergenic
996106068 5:119505040-119505062 GTCAAAGATCAGATGGTTGTAGG + Intronic
996147619 5:119995106-119995128 CTCACCAGACAGATGGGGGTGGG + Intergenic
996633254 5:125662717-125662739 GTCAAAGATCAGATGGTTGTAGG + Intergenic
996778078 5:127154664-127154686 GTCAAAGATCAGATGGTTGTAGG + Intergenic
997053201 5:130407706-130407728 GTCAAAGATCAGATGGTTGTAGG + Intergenic
997076226 5:130681043-130681065 GTCAAAGATCAGATGGTTGTAGG - Intergenic
997118482 5:131150766-131150788 GTCAACAGCATAATGGTGGTAGG + Intergenic
997204658 5:132038993-132039015 GTCAAAGATCAGATGGTTGTAGG + Intergenic
997371777 5:133366084-133366106 ATCAAAAGTGAGAGGGTGGTAGG - Intronic
997656795 5:135561208-135561230 TTCAGCACCCAGATGGTGGTTGG + Intergenic
997763485 5:136474181-136474203 GTCAAAGATCAGATGGTTGTAGG - Intergenic
998019543 5:138757851-138757873 GGCAACAGTCAGATTATGGAGGG + Intronic
998776159 5:145605463-145605485 GTCAAAGATCAGATGGTTGTAGG + Intronic
998922842 5:147088738-147088760 GTCAAAGATCAGATGGTTGTAGG + Intergenic
999253454 5:150196224-150196246 TTCCAGAGTCATATGGTGGTGGG + Intronic
999853347 5:155566625-155566647 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1000421090 5:161038746-161038768 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1000537097 5:162492770-162492792 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
1001886664 5:175297925-175297947 GTCAAAAGTAAGATGGTTTTAGG - Intergenic
1002383020 5:178843929-178843951 TTCAACAGTCAGGTGGTGGAGGG - Intergenic
1003200243 6:3953050-3953072 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1004011506 6:11692807-11692829 GTCAGCTGTCACGTGGTGGTGGG + Intergenic
1005347282 6:24903063-24903085 CTCCTCAGTCAGATGGTGGCTGG + Intronic
1005924155 6:30427763-30427785 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1006571484 6:35008935-35008957 GACAACAGTGAGATGATGGGAGG + Intronic
1007188214 6:39990891-39990913 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1007738291 6:43995409-43995431 GTCAACAGACAAGTGGTGGGGGG - Intergenic
1007872767 6:45060299-45060321 GTCAAATATCAGATGGTTGTAGG - Intronic
1008303805 6:49875749-49875771 GTCAAAGATCAGATGGTTGTAGG - Intronic
1009244720 6:61222567-61222589 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1009382689 6:63052637-63052659 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1009805442 6:68596229-68596251 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1009818440 6:68768390-68768412 GTCAAAGATCAGATGGTTGTAGG - Intronic
1009915640 6:69992188-69992210 GTCGAAAATCAGATGGTTGTAGG + Intronic
1010019978 6:71148139-71148161 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010120457 6:72369790-72369812 GTAAACACTAAGATGCTGGTAGG + Intronic
1010315398 6:74442976-74442998 GGCAAAGGTCAGATGGTTGTAGG + Intergenic
1010330427 6:74617229-74617251 GTCAAAGGTCAGATGGTTGTAGG - Intergenic
1010432847 6:75798273-75798295 GTCAAAAATCAGATGGTTGTAGG + Intronic
1010531252 6:76970060-76970082 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010670527 6:78681147-78681169 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010722090 6:79294560-79294582 GTCAAAATTCAGTTGGTTGTAGG + Intergenic
1010775698 6:79882685-79882707 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1010892925 6:81336481-81336503 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1010989887 6:82468911-82468933 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
1011128256 6:84029652-84029674 AACAACAGTCAGATTGGGGTAGG + Intergenic
1011320246 6:86083433-86083455 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1011921440 6:92581842-92581864 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1012135929 6:95555750-95555772 GTCAAAGATCAGATGGTCGTAGG + Intergenic
1012143058 6:95647702-95647724 GTCAAAAATCAGATGGTTATAGG - Intergenic
1012250893 6:96979428-96979450 GTCAAAGATCAGATGGTTGTAGG + Intronic
1012688737 6:102287142-102287164 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1012810126 6:103946511-103946533 GTCAAAAATCAGATGATTGTAGG + Intergenic
1013647445 6:112159635-112159657 GTTTACAATCAGATGGGGGTGGG - Intronic
1013726906 6:113109259-113109281 GTCAAAGGTCAGATGGTTGCAGG + Intergenic
1014029764 6:116686824-116686846 GTCAAAGATCAGATGGTTGTAGG + Intronic
1014367652 6:120564012-120564034 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1015000124 6:128204125-128204147 GTCAAAGATCAGATGGTTGTAGG - Intronic
1015679264 6:135785956-135785978 GTCAAAGGTCAGATGGTTTTAGG - Intergenic
1016005584 6:139085710-139085732 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1016088852 6:139950425-139950447 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1016175129 6:141070893-141070915 GGTAACAGTCAGATGTTGGAAGG + Intergenic
1016565049 6:145442706-145442728 GTCAAAGATCAGATGGTAGTAGG + Intergenic
1016847532 6:148583184-148583206 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1016995974 6:149962781-149962803 GACAACAGTCACACGGGGGTGGG - Intergenic
1017221209 6:151968121-151968143 GTCAAAGATCAGATGGTTGTAGG - Intronic
1017762212 6:157578478-157578500 GTCAATGATCAGATGGTTGTAGG + Intronic
1017984526 6:159432064-159432086 ATTTGCAGTCAGATGGTGGTTGG + Intergenic
1018125131 6:160675205-160675227 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1018375346 6:163205415-163205437 GTCAAAGATCAGATGGTTGTAGG - Intronic
1018477176 6:164154865-164154887 GTCAAAAATCAGTTGGTTGTAGG - Intergenic
1018574034 6:165239607-165239629 GTCAAAGATCAGTTGGTGGTAGG + Intergenic
1018578674 6:165287634-165287656 GTCAAAGATCAGATGGTTGTAGG - Intronic
1019031141 6:169013592-169013614 GTCAGAGGTCAGATGGTTGTAGG + Intergenic
1019318434 7:402464-402486 TTCAAGGGTCAGCTGGTGGTAGG - Intergenic
1019959005 7:4441584-4441606 GTCAAAGGTCAGATAGTTGTAGG + Intergenic
1021754509 7:23838479-23838501 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1021916561 7:25439352-25439374 GTCAAAGGTCAGATGGTTGTAGG + Intergenic
1022669683 7:32444103-32444125 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1022764580 7:33396854-33396876 GTCAAAGATCAGATGGTTGTAGG - Intronic
1024864481 7:53888907-53888929 GTCAACAGGGAGCAGGTGGTCGG + Intergenic
1024986359 7:55196804-55196826 GTCAACGATCACATGGTTGTAGG + Intronic
1026258360 7:68732481-68732503 GTCAACTGTGAGATGGAGGCCGG - Intergenic
1028640270 7:93034616-93034638 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1029063911 7:97828685-97828707 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1030378750 7:108786639-108786661 GTCAAAGATCAGATGGTCGTAGG - Intergenic
1030718837 7:112844946-112844968 GTCAAAAATCAGATGGTCATAGG - Intronic
1031444636 7:121836001-121836023 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031469565 7:122152965-122152987 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031542713 7:123014465-123014487 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031550748 7:123109261-123109283 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031737435 7:125384122-125384144 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1031738242 7:125394874-125394896 GTCAATGATCAGATGGTTGTAGG - Intergenic
1032361579 7:131260844-131260866 GTCAAACATCAGATGGTTGTAGG - Intronic
1032778372 7:135139862-135139884 GTCAAAGATCAGATGGTTGTAGG + Intronic
1032912719 7:136452093-136452115 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1033413648 7:141143507-141143529 GTCAAAGATCAGATGGTTGTAGG + Intronic
1033776054 7:144613375-144613397 GTCAAAAATCAGATGGTTATAGG + Intronic
1034180174 7:149130938-149130960 GTCAACAGGAAGCAGGTGGTGGG + Intronic
1036436629 8:8740591-8740613 GTCAAATATCAGATGGTTGTAGG - Intergenic
1036621482 8:10427123-10427145 GTGGACAGTCAGAGTGTGGTTGG + Intronic
1037033725 8:14141022-14141044 GTCAAAGATCAGATGGTTGTAGG - Intronic
1037388714 8:18369689-18369711 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1038519908 8:28222168-28222190 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1038859047 8:31365656-31365678 GTCAAAGATCAGATGGTCGTAGG + Intergenic
1039707009 8:40017689-40017711 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1040091109 8:43399830-43399852 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1040410306 8:47147381-47147403 TTCAAAGGTCAGATGGTTGTAGG - Intergenic
1040533518 8:48285501-48285523 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1041764143 8:61399825-61399847 GTCAAAGATCAGATGGTTGTAGG + Intronic
1041859275 8:62493314-62493336 GTCAAAAATCAGATGGTTCTAGG + Intronic
1041881882 8:62761212-62761234 GTCAAAAGTCAGGTGGAGGAAGG + Intronic
1043496216 8:80803534-80803556 GTCAAAGATCAGATGGTTGTAGG - Intronic
1043805240 8:84664106-84664128 GTCAAAGATCAGATGGTTGTAGG + Intronic
1043845499 8:85158626-85158648 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1043923416 8:86009859-86009881 GTCAAAGATCAGATAGTGGTAGG + Intronic
1044200492 8:89429526-89429548 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1044502062 8:92969091-92969113 GTCAAAGATCAGATGGTTGTAGG + Intronic
1044550937 8:93511690-93511712 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1044614221 8:94122637-94122659 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1045012591 8:97971051-97971073 GTCAACACGCAGCAGGTGGTTGG + Intronic
1045164495 8:99588112-99588134 GTCAAAGATCAGATGGTTGTAGG + Intronic
1045177723 8:99743676-99743698 GTCAAAGATCAGATGGTTGTAGG - Intronic
1045499809 8:102736619-102736641 GTCAACAGGAAGCTGGTGGTGGG - Intergenic
1045909131 8:107384910-107384932 GTCAAAGATCAGATGGTTGTAGG + Intronic
1046028062 8:108748885-108748907 GTCAAAGATCAGATGGTTGTAGG + Intronic
1046145356 8:110151170-110151192 GTCAAATATCAGATGGTTGTAGG + Intergenic
1046236783 8:111434545-111434567 GTCAACAATCAGATAGTTGTGGG + Intergenic
1046411526 8:113849631-113849653 GTTGACAATCAGATGGTTGTAGG - Intergenic
1046412554 8:113865716-113865738 GTCAACAGACAGGAGGTGTTTGG + Intergenic
1047671301 8:127149963-127149985 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1048582364 8:135740325-135740347 GTCCCCAGTGTGATGGTGGTGGG - Intergenic
1048640826 8:136358831-136358853 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1048826703 8:138434774-138434796 GTCAACTGTAAGAGGCTGGTGGG - Intronic
1049485272 8:142854779-142854801 GTCAAAGGTTAGATGGTTGTAGG - Intronic
1050177941 9:2888651-2888673 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1050249033 9:3724313-3724335 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1050404011 9:5288225-5288247 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1050986248 9:12086885-12086907 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1051300849 9:15649098-15649120 GTCAAAGATCAGATGGTTGTAGG - Intronic
1051596267 9:18827032-18827054 GGCAATAATCAGATGGTGGATGG - Intronic
1051603756 9:18899640-18899662 GTCAAAGATCAGATGGTTGTAGG - Intronic
1051861689 9:21632274-21632296 GTCAAGGATCAGATGGTTGTAGG - Intergenic
1052005661 9:23345467-23345489 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1052402477 9:28018058-28018080 GTCAAAGGTCAGATGATTGTAGG - Intronic
1052520119 9:29536031-29536053 GTCAATAGTCAGGTGGGGGTAGG - Intergenic
1052879310 9:33591061-33591083 GTAAACTGTGAGAGGGTGGTGGG + Intergenic
1053140749 9:35681271-35681293 GTCAGCAGTCAGATGTCAGTAGG + Intergenic
1053222157 9:36321149-36321171 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1053490183 9:38493923-38493945 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1053535700 9:38923463-38923485 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1054207921 9:62147868-62147890 GTCAAAGATCAGATGGTGGTAGG + Intergenic
1054630432 9:67440485-67440507 GTCAAAGATCAGATGGTGGTAGG - Intergenic
1055442070 9:76346177-76346199 GTCAAAAATCAGATGGTTGTAGG + Intronic
1055523266 9:77104061-77104083 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1055617448 9:78087772-78087794 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1056010320 9:82322472-82322494 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1057670513 9:97083191-97083213 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1057721838 9:97538074-97538096 GTCAACAGTCCGCTGGAGCTGGG + Intronic
1058293493 9:103275225-103275247 GTCAAAAATAAGATGGTTGTAGG - Intergenic
1058441393 9:105011190-105011212 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1059017489 9:110535307-110535329 GTCAAAGATCAGATGGTTGTAGG + Intronic
1059226067 9:112674386-112674408 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1059457720 9:114410212-114410234 GTATAAAGTCAGATGGTGATAGG - Intronic
1059594795 9:115708078-115708100 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1059913123 9:119068353-119068375 GTTAAAAATCAGATGGTCGTAGG + Intergenic
1059995113 9:119901411-119901433 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060849951 9:126866373-126866395 GGCCACAGTCAGAAGGTGGAGGG - Intronic
1062298160 9:135846231-135846253 GTCAAAGATCAGATGGTTGTAGG - Intronic
1062545070 9:137058720-137058742 GTCAACAGGAAGCTGGTGGTTGG - Intergenic
1185915936 X:4035242-4035264 GTCAACTGTCACATGTTGGAGGG - Intergenic
1186605720 X:11088701-11088723 GTCAAAGATCAGATGGTAGTAGG - Intergenic
1186938218 X:14474600-14474622 ATCTACAGTCAGCTGGTGGGTGG + Intergenic
1187286463 X:17909139-17909161 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1187637310 X:21244092-21244114 GTCAAAAATGAGGTGGTGGTAGG + Intergenic
1187640905 X:21288376-21288398 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1187801913 X:23073291-23073313 GTCAAAGGTCAGATAGTTGTAGG - Intergenic
1187818607 X:23260752-23260774 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1187999818 X:24970157-24970179 GTCAAACATCAGATGGTTGTAGG - Intronic
1188204155 X:27331716-27331738 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1188227916 X:27624705-27624727 GTCAAAGATCAGATGGTTGTAGG - Intronic
1188631957 X:32374594-32374616 GTCAAAAATCAGTTGGTTGTAGG + Intronic
1188717746 X:33481288-33481310 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1189334131 X:40160080-40160102 GTCAACCATCTGATGGTGGAGGG - Intronic
1189894341 X:45638553-45638575 GTCAAAGATCAGTTGGTGGTAGG - Intergenic
1190008482 X:46761333-46761355 GTCTACAGTAAGATGGTGGCTGG - Intergenic
1190605009 X:52132240-52132262 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1190724192 X:53176431-53176453 GTCAACGGGCAGCAGGTGGTTGG + Intergenic
1191018650 X:55837375-55837397 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1191023023 X:55883151-55883173 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1191598922 X:62981089-62981111 GTCAAAGATCAGATGGTCGTAGG + Intergenic
1191679605 X:63827370-63827392 GTCAACAATCAGATAGTTGTAGG + Intergenic
1191746013 X:64487726-64487748 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1191867325 X:65715110-65715132 GTCAAAGATCAGATGGTTGTAGG + Intronic
1191878141 X:65817212-65817234 GTCAAAGTTCAGATGGTTGTAGG - Intergenic
1191888360 X:65913641-65913663 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1192627704 X:72747297-72747319 GTCAAAGTTCAGATGGTTGTAGG + Intergenic
1192654004 X:72973515-72973537 GTCAAAGTTCAGATGGTTGTAGG - Intergenic
1192702463 X:73489821-73489843 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1192710141 X:73573234-73573256 GTCAAAGATCAGATGGTAGTAGG + Intronic
1192954469 X:76053921-76053943 GTCAAAATTCAGATTGTTGTAGG + Intergenic
1192965366 X:76171649-76171671 GGCAGAAGTCAGATGGTAGTGGG - Intergenic
1193073126 X:77327689-77327711 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1193093016 X:77514457-77514479 GTCAAAGATCAGATGGTTGTAGG - Intronic
1193168745 X:78312180-78312202 GTCAAAGATCAGATGGTTGTAGG - Intronic
1193207668 X:78767607-78767629 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1193389648 X:80911555-80911577 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1193409757 X:81148331-81148353 GTCAAAGATCAGATGGTTGTAGG - Intronic
1193581200 X:83265251-83265273 GTCAAAGGTCAGATAGTTGTAGG - Intergenic
1193607768 X:83589189-83589211 GTCAAAAATCAGATGGTTGTAGG - Intergenic
1193674420 X:84432125-84432147 GTCAAAGATCAGATGGTTGTAGG + Intronic
1193748900 X:85318660-85318682 GTCAAAGGTCAGATAGTTGTAGG + Intronic
1193799367 X:85916149-85916171 GTCAAAGGTCAGATAGTTGTAGG - Intronic
1193812486 X:86068109-86068131 GTCGAAGGTCAGATGGTTGTAGG - Intergenic
1193894385 X:87094369-87094391 GTCTAAACTCAGATGGTTGTAGG + Intergenic
1193942224 X:87689956-87689978 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1193984569 X:88224499-88224521 GTCAAAGATCAGATGGTTGTTGG + Intergenic
1194274270 X:91859753-91859775 GTCAAAGATCAGATGGTTGTAGG + Intronic
1194310232 X:92297437-92297459 GTCAATGATCAGATGGTTGTAGG + Intronic
1194337965 X:92672441-92672463 GTTAAAAATCAGATGGTTGTAGG - Intergenic
1194359609 X:92933469-92933491 GTCAAACATCAGATGGTTGTAGG - Intergenic
1194536737 X:95114631-95114653 GTCAAAGGTCAGATGGTTGTAGG + Intergenic
1194689751 X:96969014-96969036 GTCAAAATTCAGATGGCTGTAGG + Intronic
1194805405 X:98320824-98320846 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1194982767 X:100457476-100457498 ATCAAAGGTCAGATGGTTGTAGG - Intergenic
1194984274 X:100473318-100473340 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1195104294 X:101588574-101588596 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1195209164 X:102635231-102635253 GTCAAAAATCAGATGGTCGTAGG - Intergenic
1195241213 X:102954036-102954058 GTTAAGGATCAGATGGTGGTAGG + Intergenic
1195344458 X:103935628-103935650 GTCAAAGATCAGATGGTTGTAGG + Intronic
1195696521 X:107671640-107671662 GTCACCACTCAGTTGGTGCTGGG + Intergenic
1195807684 X:108794288-108794310 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1196040578 X:111198616-111198638 GTCAAAAATCAGGTGGTTGTGGG + Intronic
1196052181 X:111317276-111317298 GTCAAAGATCAGATGGTTGTAGG - Intronic
1196219808 X:113099745-113099767 GTCAAAAATCAGATGGTTGTAGG + Intergenic
1196225434 X:113160206-113160228 GTAAAAAATCAGATGGTTGTAGG + Intergenic
1196233940 X:113257183-113257205 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1196238520 X:113311487-113311509 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1196244669 X:113386693-113386715 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1196550069 X:117013986-117014008 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1196778765 X:119363245-119363267 GTCAAAGGTCAGATGGCTGTAGG + Intergenic
1196926477 X:120638464-120638486 GTCAAAAATCAGATGGCTGTAGG - Intergenic
1197089259 X:122517442-122517464 GTCAAAAATCAGATGGTTGCAGG - Intergenic
1197179354 X:123517657-123517679 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1197183944 X:123565471-123565493 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1197349400 X:125364608-125364630 GTAAAAGGTCAGATGGTTGTAGG + Intergenic
1197553312 X:127921932-127921954 GTCAAAAATCAGCTGGTTGTAGG - Intergenic
1198650027 X:138852405-138852427 GTCAAAGATCAGATGGTTGTAGG - Intronic
1198658250 X:138938190-138938212 GTCAACAGATGGATGGTGCTAGG + Intronic
1198687498 X:139242872-139242894 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1198879380 X:141262895-141262917 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1198885274 X:141328534-141328556 GTCAAAGATCAGATAGTGGTAGG - Intergenic
1199165137 X:144663639-144663661 GTCAAAGGTCAGATGGCTGTGGG + Intergenic
1199269673 X:145868293-145868315 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1199407638 X:147481278-147481300 GTCAAAAGTCAGATGGTTTTAGG + Intergenic
1199466072 X:148138843-148138865 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1199946734 X:152675775-152675797 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1199994940 X:153017447-153017469 GTCAAAGATCAGATGGTTGTCGG - Intergenic
1200330154 X:155287244-155287266 GTCAAAAATCACATGGTTGTAGG + Intronic
1200591507 Y:5081160-5081182 GTCAAAGATCAGATGGTTGTAGG + Intronic
1200618523 Y:5411724-5411746 GTCAATGATCAGATGGTTGTAGG + Intronic
1200646373 Y:5789180-5789202 GTTAAAAATCAGATGGTTGTAGG - Intergenic
1200667804 Y:6049292-6049314 GTCAAACATCAGATGGTTGTAGG - Intergenic
1201399419 Y:13588075-13588097 GTCAAAGATCAGATGGTTGTAGG - Intergenic
1201964117 Y:19713020-19713042 GTCAAAGATCAGATGGTTGTAGG - Intronic
1202300682 Y:23410537-23410559 GTCAAAGATCAGATGGTTGTAGG + Intergenic
1202332987 Y:23774272-23774294 GTCAAAGATCAGATGGTTGTGGG + Intergenic
1202340863 Y:23865364-23865386 CTCAGAAGTCAGAAGGTGGTGGG - Intergenic
1202529903 Y:25804722-25804744 CTCAGAAGTCAGAAGGTGGTGGG + Intergenic
1202537782 Y:25895791-25895813 GTCAAAGATCAGATGGTTGTGGG - Intergenic
1202570129 Y:26260061-26260083 GTCAAAGATCAGATGGTTGTAGG - Intergenic