ID: 960684759

View in Genome Browser
Species Human (GRCh38)
Location 3:120285280-120285302
Sequence GGGCGGCGCCAGGGAGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1388
Summary {0: 1, 1: 1, 2: 18, 3: 150, 4: 1218}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960684759_960684777 20 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684777 3:120285323-120285345 GCTCTCCCGCGAGGGCCGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 130
960684759_960684782 28 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684782 3:120285331-120285353 GCGAGGGCCGGGAGGGCTCCGGG 0: 1
1: 0
2: 5
3: 46
4: 405
960684759_960684776 17 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684776 3:120285320-120285342 CCTGCTCTCCCGCGAGGGCCGGG 0: 1
1: 0
2: 5
3: 19
4: 196
960684759_960684778 21 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684778 3:120285324-120285346 CTCTCCCGCGAGGGCCGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 114
960684759_960684781 27 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684781 3:120285330-120285352 CGCGAGGGCCGGGAGGGCTCCGG 0: 1
1: 0
2: 1
3: 33
4: 293
960684759_960684772 12 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684772 3:120285315-120285337 TCGACCCTGCTCTCCCGCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 36
960684759_960684774 16 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684774 3:120285319-120285341 CCCTGCTCTCCCGCGAGGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 189
960684759_960684771 11 Left 960684759 3:120285280-120285302 CCCGCCCCTCCCTGGCGCCGCCC 0: 1
1: 1
2: 18
3: 150
4: 1218
Right 960684771 3:120285314-120285336 CTCGACCCTGCTCTCCCGCGAGG 0: 1
1: 1
2: 0
3: 7
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960684759 Original CRISPR GGGCGGCGCCAGGGAGGGGC GGG (reversed) Intergenic
900118938 1:1040476-1040498 GGGCGGGGTCTGCGAGGGGCAGG + Intronic
900124742 1:1064423-1064445 GGGCGGCCTCTGGGAAGGGCGGG + Intergenic
900127036 1:1073267-1073289 GGGAGGGCCCAGGCAGGGGCAGG + Intronic
900187181 1:1337936-1337958 GGGCGGAGCCGGGGAAGGGCAGG + Intronic
900190075 1:1349510-1349532 GGGCGGGGCCGGGGCGGGGCGGG - Intergenic
900287648 1:1909191-1909213 GGGCCGAGACAGGGTGGGGCGGG + Intergenic
900291269 1:1924551-1924573 GGGGGCAGCCAGGCAGGGGCTGG - Intronic
900418722 1:2546493-2546515 CTGCGGGGCCAGGCAGGGGCGGG + Intergenic
900422396 1:2561209-2561231 TGGCTGCCCCAGGGAGGGGGCGG + Intronic
900427215 1:2586308-2586330 GGGGGGCGCCGGGGAGCGGCTGG - Intergenic
900511546 1:3063204-3063226 GGGAGGAGACAGGGACGGGCCGG + Intergenic
900658696 1:3772548-3772570 GGGCGGGGCGAGAGGGGGGCGGG - Intergenic
900673636 1:3870726-3870748 AAGCGGCCCCAGGGAGGGGGTGG + Intronic
900965190 1:5952648-5952670 GGGTGGGGCCAGGCAGGGGTGGG - Intronic
900986691 1:6077430-6077452 GGGTGGCGCCTGGGATTGGCAGG - Intronic
901199383 1:7458005-7458027 AGGCAGCGCCAGGCAGGCGCAGG - Intronic
901489415 1:9589087-9589109 GGGCGGCGCGGGGGCGGGCCTGG - Intronic
901551131 1:9997151-9997173 GGGCCGCGCGCGGGAGGAGCAGG - Intergenic
901696537 1:11012281-11012303 GGGCGGGGCCTGGAGGGGGCGGG - Intergenic
901796254 1:11681180-11681202 GGGCGTGGCCTGGGCGGGGCGGG - Exonic
902056737 1:13606902-13606924 ATGGGGCCCCAGGGAGGGGCTGG + Intronic
902131336 1:14263634-14263656 GAGCGGGGGCAGGGTGGGGCTGG + Intergenic
902177466 1:14661664-14661686 GGGGGGCGGGAGGGAGGGGAGGG + Intronic
902450013 1:16490988-16491010 GGTGGGTGCCAGGGTGGGGCAGG - Intergenic
902478549 1:16700288-16700310 GGGCGGGCCCAGGGGCGGGCCGG + Intergenic
902516428 1:16992125-16992147 GGGCACTGCCAGGGAGAGGCAGG + Exonic
902870031 1:19308351-19308373 GGGCAGTCCCAGGGTGGGGCAGG - Intronic
902922162 1:19672459-19672481 GGGCCGAGCCAGGGAGAGGCTGG + Intronic
902929090 1:19717718-19717740 GGAGGGCGCCAGGGAGGAGAGGG - Intronic
903044310 1:20553927-20553949 GGCCGGCCCCAGGGAGCGGGCGG + Exonic
903164142 1:21509302-21509324 GGGCGGGGCCGGGGCCGGGCTGG + Intergenic
903211049 1:21818879-21818901 AGGCGGGGCCAGGGAGGGGTGGG - Intronic
903211066 1:21818912-21818934 AGGCGGGGCCAGGGAGGGGGTGG - Intronic
903263639 1:22143710-22143732 GGTGAGCGCCAGGGAGGGGCTGG - Intronic
903324834 1:22563735-22563757 CGGCGGCGGCGGGGCGGGGCAGG + Intronic
903501343 1:23801548-23801570 CGGGAGCGCCAGGGAGAGGCCGG + Intergenic
903672751 1:25046187-25046209 GGGTGGGGCCCGGGAGGTGCAGG + Intergenic
903771902 1:25769602-25769624 GGGCTGTGCCAGGAAGGGCCTGG - Intronic
904028476 1:27519642-27519664 AGGCGGGGCCACGGAGGGGTTGG - Intergenic
904237366 1:29123938-29123960 AGGCGGGGCCGGGGCGGGGCTGG - Intergenic
904467799 1:30718528-30718550 GGGCGGGGCCGGGGAGGAGCCGG - Intronic
904467858 1:30718696-30718718 GGGCGGAGCCAGGGCAGGGGCGG - Intronic
904563334 1:31413155-31413177 GGGCGGGGCCGGGGCGGGGCCGG + Intronic
905183236 1:36179052-36179074 GGGCGGGGCCTGGGCAGGGCGGG + Intronic
905442777 1:38005557-38005579 GGGCGGGGTCCGGGCGGGGCGGG - Intronic
905515633 1:38559839-38559861 GGGGGGCGAGCGGGAGGGGCGGG + Intergenic
905617109 1:39408928-39408950 GGGCGGGGCCCGGCGGGGGCGGG - Intronic
905648275 1:39639693-39639715 AGGCGGGGCCGGGGCGGGGCCGG - Exonic
905773627 1:40654152-40654174 GGGCGGGGAGGGGGAGGGGCGGG - Intronic
905773637 1:40654168-40654190 CAGCGGCGCGGGGGAGGGGCGGG - Intronic
905807046 1:40884568-40884590 GGGCGGGGGCAGGGGGTGGCGGG + Intergenic
905847117 1:41242245-41242267 GGGAGGCGCGGGGGAGGGGCCGG - Intergenic
906069664 1:43007676-43007698 GGGCGGGGACGGGGAGGGGAGGG - Intergenic
906153920 1:43603201-43603223 GTGCGGCTCCTGGGATGGGCGGG + Intronic
906211929 1:44016938-44016960 GGTCTGTGCCAGGGAGGGGCAGG - Intronic
906299887 1:44674218-44674240 GGGCGGCCCGAGGGAGGGCGGGG + Intronic
906509394 1:46402257-46402279 GGGAGGGGAAAGGGAGGGGCTGG - Intronic
906531541 1:46526680-46526702 GGGCCGAGCCAGGGAGGAGCTGG - Intergenic
906534522 1:46544180-46544202 CGGCGGCGGCAGCGATGGGCTGG + Intergenic
906617232 1:47241773-47241795 GGGCTGTCCCAGGAAGGGGCTGG - Intergenic
907277668 1:53326278-53326300 GGGCGGGGCCGGGGCAGGGCAGG + Intronic
907484078 1:54764793-54764815 GGGCGGGGCCTGGCAGGGGCAGG - Intergenic
907526539 1:55057139-55057161 GGGGAGCACCAGGGCGGGGCAGG + Intronic
910200072 1:84690314-84690336 GCGCCCCGCCAGGGAGGGGCGGG - Intronic
910232117 1:84997515-84997537 TGGCGCGGCCAGGGAGCGGCAGG + Intergenic
910773231 1:90850989-90851011 GGCCGGCAGCGGGGAGGGGCAGG + Intergenic
911027290 1:93448536-93448558 GGGCGGCGCCCGGGACGGCCGGG + Intronic
911176135 1:94820309-94820331 GGGCCGGGCCGGGGAGGGGCGGG - Intergenic
911335247 1:96573823-96573845 GAACGGGGACAGGGAGGGGCAGG - Intergenic
912246388 1:107965282-107965304 GCGGGGCGCGGGGGAGGGGCCGG + Intergenic
912429087 1:109619811-109619833 AGGCGGGGCCAGGCGGGGGCGGG + Intronic
912625910 1:111204381-111204403 GGGCGGGGCCAGCGCGGAGCTGG - Intronic
912800190 1:112715334-112715356 GGGCGGGGCCTGGGCGGGGGCGG - Exonic
912927906 1:113929720-113929742 CGGCGGCGGCGGGAAGGGGCTGG + Exonic
913270412 1:117087650-117087672 GAGGTGCCCCAGGGAGGGGCAGG - Intronic
913671116 1:121097875-121097897 CGGCGGCGGCAGGGAGGGAGCGG + Intergenic
913958263 1:143321849-143321871 GGGCAGGGCCAGGGCAGGGCGGG + Intergenic
914022883 1:143885296-143885318 CGGCGGCGGCAGGGAGGGAGCGG + Intergenic
914052578 1:144147224-144147246 GGGCAGGGCCAGGGCAGGGCGGG + Intergenic
914126619 1:144819317-144819339 GGGCAGGGCCAGGGCAGGGCGGG - Intergenic
914661370 1:149793240-149793262 CGGCGGCGGCAGGGAGGGAGCGG + Intronic
914676320 1:149909734-149909756 GAGAGGGGCCAGGTAGGGGCTGG + Intronic
914743856 1:150486897-150486919 GGGGGGCGGGAGGGGGGGGCGGG - Intergenic
914753134 1:150549289-150549311 CGGCGGCCCCGGGGTGGGGCCGG - Intergenic
915309776 1:155001211-155001233 GGGCGGCGCCAGGGGGGCCCTGG - Intergenic
915310195 1:155002620-155002642 GGGCGGGGGGAGGGAGGGGAGGG + Exonic
915315496 1:155026449-155026471 GGGGGGCGCCAGGGGTGGGCTGG - Intronic
915333511 1:155127804-155127826 GGGCGGGGCGAGGGCGGGGCGGG + Exonic
915341528 1:155179240-155179262 GAGGAGCCCCAGGGAGGGGCAGG - Intronic
915348341 1:155209185-155209207 GGGCGGGCCCAGGCAGGGGAGGG + Exonic
915526821 1:156481091-156481113 GGGAGGGGCCAGGGAGATGCTGG - Intronic
915539694 1:156558196-156558218 GGGAGGCGCGGGGGGGGGGCCGG + Intronic
915544992 1:156592022-156592044 GGGCGGGGCCTGGGACGGCCGGG + Intronic
915552250 1:156642041-156642063 GGGCGGCCCCGGGGAGGGCGGGG + Exonic
915552851 1:156645219-156645241 GGGTGGGGGAAGGGAGGGGCTGG + Intronic
915581154 1:156814150-156814172 AGGCGGGGCTCGGGAGGGGCGGG - Intronic
915913422 1:159928123-159928145 AGGCGGAGGCAGGGATGGGCAGG + Intronic
915937664 1:160098684-160098706 GGGCGGTGCCGGGGCGGGCCGGG - Exonic
915937727 1:160098853-160098875 GGGCGGGGCCGGGGCGGGGCTGG - Intronic
915937768 1:160098942-160098964 GGGCGGGGCGGGGGAGGGGCCGG - Intronic
916179317 1:162070123-162070145 CGGCGGCTGCAGGAAGGGGCTGG - Exonic
916882350 1:169032192-169032214 GGGAGGAGCCAGGGAGGTCCAGG - Intergenic
917438612 1:175045679-175045701 GGGTGGCGCCCGGGCGGCGCGGG + Intergenic
919101831 1:193105454-193105476 GGGCGGGGCAAGGCGGGGGCCGG - Intronic
919748718 1:201023779-201023801 TGGCGGCTCCTGGGCGGGGCGGG - Intergenic
919764010 1:201114881-201114903 GGGCGGCGCGGGGCAGGGCCCGG + Exonic
920236369 1:204509232-204509254 GGGTGGCGGCAGGAGGGGGCAGG - Intergenic
920528753 1:206686174-206686196 GGGCGGCTCCGGGGAGAGGCCGG + Intronic
921089696 1:211830773-211830795 GGGCGGCGGGAGGAAGCGGCGGG + Intergenic
922233359 1:223704992-223705014 GGGAGTTGCCAGGAAGGGGCTGG - Intronic
922496509 1:226062257-226062279 GGGCCGCGGCGGGGAGGGGAGGG - Intronic
922561085 1:226570058-226570080 GAGGGCCTCCAGGGAGGGGCGGG - Intronic
922574813 1:226654626-226654648 GGGCAGCTCCAAGGATGGGCTGG - Intronic
922739360 1:228006863-228006885 GGCCGGGGCCCGGGCGGGGCAGG - Intergenic
922753744 1:228082883-228082905 CGGCGGCGACAGGGCCGGGCCGG + Intronic
922802705 1:228371556-228371578 GGAGGCCGCCAGGGAGGAGCAGG + Exonic
923107901 1:230868544-230868566 GGGCGGGCACAGCGAGGGGCGGG - Exonic
923505269 1:234600139-234600161 GGGCGGCGGAGCGGAGGGGCGGG + Intergenic
924436637 1:244048799-244048821 GGTGGGCGGGAGGGAGGGGCGGG + Intergenic
1062873883 10:930965-930987 GGGCAGGGCCTGGGCGGGGCCGG - Intronic
1063114990 10:3067105-3067127 GGGGCGCGCCAGGGCGGGGCGGG - Intronic
1063434268 10:6017980-6018002 GGGGGGAGGCAGGGTGGGGCTGG + Intronic
1063536756 10:6891214-6891236 AGGAGGGGCCAGGGAGGGACGGG - Intergenic
1064009600 10:11725043-11725065 GGGCGGGGGCAGGGGGGAGCTGG + Intergenic
1064060047 10:12129664-12129686 GGGCGGAGCCTGCGCGGGGCCGG + Intronic
1064274192 10:13891762-13891784 GGGCGGCGGCGGGGACGGGGCGG - Intronic
1064354308 10:14604043-14604065 GCGCGGCGCCCGGGAGGTGCCGG - Intronic
1065177612 10:23095192-23095214 GGGCAGGGCGAGGGAGGAGCAGG + Intergenic
1065342994 10:24723724-24723746 CGGCGGTGCCTGGGAGCGGCCGG - Intergenic
1066429212 10:35336441-35336463 GGGCGGTGACGGGGCGGGGCGGG + Intronic
1066732650 10:38449271-38449293 GGGAGGAGCCAGTGAGAGGCAGG - Intergenic
1066961708 10:42232274-42232296 TGGCAGAGCCAGGGAAGGGCTGG + Intergenic
1066961774 10:42232505-42232527 GGCCAGGGCCAGGGAGGGCCAGG + Intergenic
1067038920 10:42938382-42938404 AGGAGGGGCCAGGGAGGGCCTGG - Intergenic
1067112260 10:43408886-43408908 GGGCGGAGCCTACGAGGGGCGGG + Intronic
1067116178 10:43437088-43437110 GGGCGGGGCCGCCGAGGGGCGGG - Intronic
1067448827 10:46368948-46368970 GGGCGGCAGCAGGAAGGGGCTGG - Intergenic
1067478011 10:46578947-46578969 GGCCTGGGCCAGGGACGGGCTGG + Intronic
1067588545 10:47491817-47491839 GGGCGGCAGCAGGAAGGGGCTGG + Intergenic
1067635671 10:47999908-47999930 GGGCGGCAGCAGGAAGGGGCTGG + Intergenic
1067750792 10:48969791-48969813 GGGCAAGGCTAGGGAGGGGCTGG - Intronic
1067794624 10:49311779-49311801 GCCCTGTGCCAGGGAGGGGCAGG - Intronic
1068783156 10:60943652-60943674 TGGCTGCGCCAGGGAGGGGGTGG - Intronic
1069042852 10:63712671-63712693 GGGCTGCCCCAGGCAGGGCCAGG + Intergenic
1069403501 10:68074890-68074912 TGACGGCGTTAGGGAGGGGCAGG - Intronic
1069557783 10:69408872-69408894 GGGCGGGGCCTGGAGGGGGCGGG - Intronic
1069651653 10:70053573-70053595 GGGCCGCGCCGGGGAAGGTCAGG + Intronic
1069684435 10:70308613-70308635 GGGGTGTGGCAGGGAGGGGCTGG + Intronic
1069905113 10:71727580-71727602 GGACAGCCCCAGTGAGGGGCCGG + Intronic
1069907781 10:71741933-71741955 GGGTGGCCACAGGGAGGAGCGGG + Intronic
1069945559 10:71983068-71983090 GGGAGGCCCCAGGAAGGGGAGGG + Intronic
1070132229 10:73663915-73663937 GGGCGGCAGCAGGAAGGGGCTGG + Intergenic
1070162580 10:73874710-73874732 GGGCGGCTCCGGGGCGGGGCGGG - Intergenic
1070314292 10:75295389-75295411 GTCCAGGGCCAGGGAGGGGCGGG + Intergenic
1070793802 10:79205294-79205316 GGGAGGGGCCAGGGCAGGGCAGG - Intronic
1070923910 10:80205564-80205586 AGGCAGTGCAAGGGAGGGGCGGG + Exonic
1071086770 10:81875103-81875125 GGACGGGGCCGGGGAGGGGGCGG - Intergenic
1071609453 10:87020160-87020182 GGGCGGCAGCAGGAAGGGGCTGG - Intergenic
1072679756 10:97498523-97498545 AGGCAGTTCCAGGGAGGGGCGGG + Exonic
1072713982 10:97737280-97737302 GGGAGGCGGCAGGGTCGGGCAGG - Exonic
1072717292 10:97760418-97760440 GGGCAGCTCCAGGGAAGGGAAGG - Exonic
1073049137 10:100656476-100656498 GTGCGGGGCGAGGGCGGGGCGGG - Intergenic
1073114894 10:101086309-101086331 AGTAGGCGCTAGGGAGGGGCTGG + Intergenic
1073214615 10:101829588-101829610 GGGCGGGGCAAGGCTGGGGCTGG - Intronic
1074165829 10:110872537-110872559 GGTCGGCCCCCGGAAGGGGCTGG - Intronic
1074769117 10:116722085-116722107 GGCCTGCGCCTGGGAGGGACAGG - Intronic
1075129480 10:119726018-119726040 GGGCGGAGCCAGGGAAGGGGAGG + Intergenic
1075336667 10:121613633-121613655 AGGGAGCGCCAGGGAGGGCCAGG - Intergenic
1075587168 10:123666349-123666371 GGGCAGCGCCATGGCGGCGCCGG + Exonic
1075621913 10:123934346-123934368 CAGCGGAGCCTGGGAGGGGCAGG - Intronic
1075785724 10:125048754-125048776 GGACGGTGCTGGGGAGGGGCCGG + Intronic
1076035393 10:127195711-127195733 TGGCGACGTCAGGGAGGAGCGGG - Intronic
1076058371 10:127393582-127393604 GGGCGGGGGCAGGGAGAGACGGG + Intronic
1076107303 10:127833997-127834019 GGGTGGGGACAGGGAGGTGCTGG - Intergenic
1076306154 10:129467056-129467078 GGGCGGAGCCCGGGAGGGGCGGG - Intergenic
1076524976 10:131106711-131106733 GGGCAGGGTCAGGGAGGGGAAGG + Intronic
1076554312 10:131311860-131311882 GGGGAGCGCGAGGGCGGGGCGGG - Intergenic
1076630176 10:131847589-131847611 GGCCGAGGCCAGGGAGGGACAGG + Intergenic
1076668448 10:132105739-132105761 AGGCAGCTCCAGGAAGGGGCTGG + Intronic
1076683517 10:132186876-132186898 GGGCGGAGCCGGGGTGGGGGCGG + Intergenic
1076704277 10:132292881-132292903 GGGAGGGACCAGGGAGGGACCGG - Intronic
1076733285 10:132448640-132448662 GGGAGGGGCCAAGCAGGGGCTGG - Exonic
1076733489 10:132449103-132449125 GGGAGGGGCCAAGCAGGGGCTGG - Exonic
1076733565 10:132449288-132449310 GGGCAGGACCAGGCAGGGGCTGG - Exonic
1076734589 10:132452946-132452968 GGGCGGGGCCTGGGAAGGACAGG + Intergenic
1076792870 10:132786083-132786105 GGGCGGCTCCGGCGCGGGGCGGG + Intergenic
1076826195 10:132970899-132970921 AGGCTGCCCCAGGAAGGGGCAGG + Intergenic
1076850029 10:133088160-133088182 GGGCGGCGGGAGGGACGCGCGGG + Intronic
1076861512 10:133140256-133140278 GGGCGGGGCAGGGGCGGGGCAGG - Intergenic
1076873413 10:133204534-133204556 TGGCGGTGCCACGGAGGGCCAGG - Intronic
1076889786 10:133277763-133277785 GGGCAGGGCCAGCAAGGGGCTGG + Intergenic
1076890488 10:133280884-133280906 GGGCGGTGCTGGGCAGGGGCAGG + Intronic
1076890518 10:133280997-133281019 GGGCTGAGCCAGGGCGGTGCTGG + Intronic
1076890524 10:133281008-133281030 GGGCGGTGCTGGGCAGGGGCAGG + Intronic
1076890575 10:133281191-133281213 GGGCTGAGCCAGGGCGGTGCTGG + Intronic
1076890581 10:133281202-133281224 GGGCGGTGCTGGGCAGGGGCAGG + Intronic
1076909336 10:133379373-133379395 GGGCGGCGGCATCGCGGGGCTGG + Exonic
1076917796 10:133433124-133433146 GGGCGGCTGCGGGGAGGGGCTGG + Intergenic
1076919935 10:133446181-133446203 GGGCTCCGCCAGGGCAGGGCTGG - Intergenic
1076920721 10:133453329-133453351 GGGCGGCACCAGGAAGAGTCAGG - Intergenic
1076937790 10:133577199-133577221 GGGCGGCTGCGGGGAGGGGCTGG + Intergenic
1077069601 11:662528-662550 GGGGGGCGCCTGGGCTGGGCGGG - Intronic
1077076906 11:706153-706175 GGGCCGGGCCGGGGCGGGGCCGG - Exonic
1077090749 11:777261-777283 TGGGGGCGCCGGGCAGGGGCCGG - Intronic
1077094558 11:793777-793799 GGGCGGGGCCAGGCAGGGATGGG + Intronic
1077103663 11:832895-832917 GGGCGGGGCCGGGGCGGGGCGGG + Exonic
1077227226 11:1443654-1443676 GGGCGGCCCCAGAGCGTGGCGGG + Intronic
1077227471 11:1444680-1444702 GGGGTGCTCCAGGTAGGGGCAGG - Intronic
1077229140 11:1450808-1450830 CGGAGGCGCCAGAGTGGGGCTGG + Intronic
1077230385 11:1455933-1455955 GGGAGGTGCAAGGGCGGGGCTGG - Intronic
1077235857 11:1481730-1481752 GGGCAGGGGCAGGGAGGGGCAGG + Intronic
1077235868 11:1481752-1481774 GGGCAGGGGCAGGGAGGGGCAGG + Intronic
1077477470 11:2797208-2797230 GGGCTGGGCCACGGAGAGGCCGG + Intronic
1077677771 11:4212213-4212235 GGGCTGCGGCAGGGAGGGAGAGG + Intergenic
1078256592 11:9664042-9664064 GGGCGGGGCCTGGCGGGGGCGGG + Intergenic
1079076814 11:17389411-17389433 GGGAGGGGCGCGGGAGGGGCGGG - Intergenic
1079090489 11:17476917-17476939 GGGCGGGGTGAGGGAGGGGGAGG - Intergenic
1080012331 11:27472006-27472028 GGGCGGCGGCGGGGCGGGGTGGG + Intronic
1081566428 11:44263851-44263873 GGGAGGGGCCAGGGTAGGGCAGG + Exonic
1081607269 11:44535274-44535296 GGGCGCCTCGAGGGCGGGGCTGG + Intergenic
1081619903 11:44613277-44613299 AGGTGGAGCCAGGCAGGGGCTGG + Intronic
1081860945 11:46333083-46333105 GCGCTGCGCCTGGGAGAGGCGGG - Intronic
1082260327 11:50072918-50072940 GGGCGCCAACAGGCAGGGGCTGG + Intergenic
1082808066 11:57462387-57462409 GGGCTGCTTCAGGGAAGGGCTGG - Intronic
1083048233 11:59755311-59755333 GGGCGCGGCCAGGTAGGGGCGGG + Exonic
1083225420 11:61281630-61281652 GGGCGGGGCCGGGGTAGGGCGGG + Intronic
1083246052 11:61429425-61429447 GGGCGGCGCGAGGCCGGGGGCGG - Intronic
1083303770 11:61752582-61752604 GGGCCGGGCCAGGGACGCGCGGG + Intergenic
1083329622 11:61891490-61891512 CCGCGGCGGCAGGGCGGGGCCGG - Exonic
1083419948 11:62546890-62546912 GGGCGGGGCCGGAGCGGGGCTGG + Intronic
1083616264 11:64028167-64028189 GGGAGGCGCATGGGAAGGGCCGG + Intronic
1083648450 11:64186395-64186417 GGGCGGCGGCGGGGAGGTGAGGG + Intronic
1083660925 11:64251486-64251508 CGGCGGGGCCCGGGCGGGGCGGG - Intergenic
1083670986 11:64299854-64299876 GGCCGGGGCCAGGGAGGAGGCGG - Exonic
1083672041 11:64305311-64305333 ACGCGGCCCCTGGGAGGGGCGGG - Intergenic
1083709446 11:64539127-64539149 TGGCGGAGCCAGAGGGGGGCGGG + Intergenic
1083731120 11:64653309-64653331 GGGAGGAGCCTGAGAGGGGCTGG - Intronic
1083842857 11:65314767-65314789 GGGCGGGGCCTGGGCGGGGATGG + Intergenic
1083875967 11:65524849-65524871 TGGGGGGGCTAGGGAGGGGCGGG - Intergenic
1083875981 11:65524874-65524896 TGGGGGGGCTAGGGAGGGGCGGG - Intergenic
1083875995 11:65524899-65524921 TGGGGGGGCTAGGGAGGGGCGGG - Intergenic
1083922215 11:65787120-65787142 GGGCGGCGCGGGGAAGCGGCAGG - Exonic
1083933279 11:65857582-65857604 TGCCTGCGCCCGGGAGGGGCGGG - Intronic
1084150339 11:67285197-67285219 GGGCTGAGCCAGGGATGGGAGGG + Intronic
1084151330 11:67289258-67289280 GGGCTGCGCCGGGCCGGGGCGGG - Intronic
1084195132 11:67520202-67520224 AGGGAGGGCCAGGGAGGGGCAGG - Intronic
1084238831 11:67805395-67805417 GGGCGGGGGCAGAGAGGGGGCGG + Intergenic
1084332869 11:68439922-68439944 GGGCGGGGCCGGGGAGGGGCGGG + Intronic
1084547040 11:69819655-69819677 GGGCGGCGGCAGGGAGGCTCCGG + Intergenic
1084890589 11:72235046-72235068 GGGCAGCGCGTAGGAGGGGCAGG + Intronic
1084978128 11:72814383-72814405 GGACGGCGCCAGGCCGGGGCGGG - Exonic
1085522804 11:77148034-77148056 GGGCCCCGGCAGGGCGGGGCCGG - Intronic
1085666076 11:78417148-78417170 GGCCGGCGGCCGGGAGGGGCAGG + Intronic
1086981065 11:93198015-93198037 GGGCACCGCCGGCGAGGGGCGGG + Intergenic
1088604476 11:111514722-111514744 GGGCGGGGCAGGGGCGGGGCGGG + Intergenic
1088823479 11:113475284-113475306 GGGCCGCGGCGGGGCGGGGCGGG + Exonic
1089177723 11:116560487-116560509 GGGCTGAGGCAGGGAGAGGCTGG + Intergenic
1089198670 11:116710482-116710504 AGGGGGAGCCAGGGAGGGGCTGG + Intergenic
1089270742 11:117300020-117300042 AGGGGGAGGCAGGGAGGGGCAGG - Intronic
1089338201 11:117740118-117740140 GGGAAGAGCCAGGCAGGGGCTGG + Intronic
1089533844 11:119149203-119149225 GGGCGGGGCCGGGGCGGGGCAGG - Exonic
1089543564 11:119205989-119206011 GGGCGGGGCCAGGCTGGGGCGGG - Intergenic
1089631530 11:119787450-119787472 GGTGGGGGCTAGGGAGGGGCAGG - Intergenic
1089785338 11:120903447-120903469 GGGTGGAGGCAGGGTGGGGCGGG - Intronic
1089790114 11:120936833-120936855 GGGCCAGGCCAGGGAGGGGTGGG - Intronic
1089845054 11:121452054-121452076 TCCCCGCGCCAGGGAGGGGCCGG + Intergenic
1090002739 11:122976872-122976894 GCGCGGCGCCAGCGCGCGGCGGG - Intergenic
1090233664 11:125129414-125129436 AGGCGTCGTCAGGGAGGTGCAGG + Intergenic
1090640940 11:128728261-128728283 GGGAGGCAGCAGGGAGGGTCTGG + Intronic
1091103040 11:132893374-132893396 GGGCTGCACCGGGGTGGGGCAGG - Intronic
1092036947 12:5344343-5344365 GGGCGGCAGCAGGTTGGGGCAGG + Intergenic
1092060661 12:5547833-5547855 GGGGGCCTCCAGGGAGGAGCTGG + Intronic
1092092123 12:5812104-5812126 AGGCGAGGCCAGGGAAGGGCAGG + Intronic
1092183807 12:6464044-6464066 GGTAGGAGCTAGGGAGGGGCTGG - Exonic
1092236975 12:6816409-6816431 GGGCCAGGCCAGGGAGGGGTGGG + Intronic
1092286623 12:7132408-7132430 GGGAGGGGGCAGAGAGGGGCAGG - Intronic
1092409517 12:8243025-8243047 GCGCGGGGGCAGGGAGGGGGCGG + Intergenic
1092880703 12:12885689-12885711 GGGGGGCGGCAGGGAGGGGCGGG + Intergenic
1093109546 12:15132964-15132986 GGGCGGGGGCAGGGAGGGCAGGG - Intronic
1094147329 12:27244232-27244254 GGGCGGGGCGAGGGCGGAGCGGG + Exonic
1094703843 12:32896476-32896498 GGGCGGCGCCGGGGAGCGGCGGG + Intronic
1095753009 12:45730462-45730484 GGGCGGCGCGGGAGCGGGGCGGG - Intronic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1096094393 12:48925003-48925025 GGGCGGGGCCTGGGAGGGGGCGG - Intronic
1096529268 12:52233124-52233146 GGGCGGCCCCAGGAGGGGCCTGG + Exonic
1096675146 12:53222003-53222025 GGCGGGCGCGGGGGAGGGGCGGG + Intronic
1096695275 12:53344828-53344850 GGGCGGGGCGCGGGCGGGGCCGG + Intronic
1096870346 12:54588682-54588704 GGGAGGGGGCCGGGAGGGGCGGG - Intergenic
1097013050 12:55966754-55966776 GGGCGGAGCCAGGGAAACGCGGG + Exonic
1097189485 12:57212633-57212655 CGGCGGGGCCAGGGAAGGGCTGG - Exonic
1097246415 12:57610095-57610117 GGGCGGAGCCGGGCAGGGGGCGG + Intergenic
1097694709 12:62764967-62764989 GGGAGGCTCGAGGGATGGGCTGG + Intronic
1098178711 12:67821755-67821777 GGGTGGGGCGAGTGAGGGGCAGG - Intergenic
1098223623 12:68297938-68297960 GGGCACAGCCAGGCAGGGGCTGG - Intronic
1101340962 12:103841378-103841400 GGGCGGAGACGGGGCGGGGCGGG + Intergenic
1102101299 12:110281065-110281087 GGGCGGCGCGCGGGAGGGGGCGG + Intronic
1102136972 12:110583343-110583365 GGGCAGGGCCAGGGAGGGGGCGG - Intergenic
1102222501 12:111204020-111204042 GGGAGGTGCCTGGGAAGGGCTGG - Intronic
1102241830 12:111329306-111329328 AGGCGACGACAGGGAGAGGCAGG - Intronic
1102471418 12:113161860-113161882 GGGCGTGGCTGGGGAGGGGCGGG - Intronic
1102884043 12:116508419-116508441 GGGCGGGGCCGTGCAGGGGCTGG + Intergenic
1102933868 12:116881324-116881346 GGGCGGCCCGAGCGCGGGGCGGG - Exonic
1103309021 12:119989687-119989709 CGCCGGCGCGGGGGAGGGGCGGG + Intergenic
1103348296 12:120265538-120265560 GGAGGGCGCCAGCGAGCGGCAGG - Intronic
1103400523 12:120640524-120640546 GGGCTCCCCCAGGGCGGGGCGGG + Intergenic
1103433139 12:120904520-120904542 GGGCGGCACCAGGCAGCGGGAGG - Intergenic
1103561311 12:121794446-121794468 AGACGTCGTCAGGGAGGGGCAGG + Intronic
1103601436 12:122057145-122057167 TGGCGTCAGCAGGGAGGGGCTGG + Intronic
1103698575 12:122835735-122835757 GGGAGGCGCCGGCCAGGGGCGGG + Intronic
1104030891 12:125065343-125065365 GGGCGGGGCCTGGAAGGGGGCGG + Intergenic
1104069398 12:125331158-125331180 GGACAGCGCCGGGGAGGGCCTGG + Intronic
1104376178 12:128267090-128267112 GGGCGGGGCCCGGGCGGGGGCGG + Intergenic
1104448809 12:128853451-128853473 GCGCGGCCTCGGGGAGGGGCGGG + Intronic
1104623752 12:130337435-130337457 GGGCGGGGCCTGGGTGGGGCTGG + Intergenic
1104658429 12:130591565-130591587 GAGAGGCTCCGGGGAGGGGCGGG + Intronic
1104697093 12:130872005-130872027 GGGCGGGGCCGGCGCGGGGCGGG - Exonic
1104733292 12:131120940-131120962 GAGCGGGGCTGGGGAGGGGCAGG + Intronic
1104759205 12:131287036-131287058 GGTGGAGGCCAGGGAGGGGCAGG - Intergenic
1104821406 12:131679460-131679482 GGTGGAGGCCAGGGAGGGGCAGG + Intergenic
1104860133 12:131919292-131919314 GGGCAGCGCCAGTGAGGCGGCGG + Exonic
1104887349 12:132118495-132118517 GGGCTGCCCAGGGGAGGGGCGGG - Intronic
1104889287 12:132132617-132132639 GGGCTGCGCCGGGCAGGGGTGGG - Intergenic
1104897497 12:132171517-132171539 GGGCTGCACCTGGGAGGGCCCGG - Intergenic
1104901089 12:132189878-132189900 GGGAGGCGCCGGGGAGGGCGGGG - Intergenic
1104961332 12:132489900-132489922 CGGGAGCGCCCGGGAGGGGCGGG + Exonic
1104961357 12:132489953-132489975 GGGCGGAGCCTGCGGGGGGCGGG + Exonic
1104964455 12:132502750-132502772 GGGCGGGGACAGGAGGGGGCGGG - Intronic
1104964476 12:132502798-132502820 GGGCGGGGACAGGAGGGGGCGGG - Intronic
1104989677 12:132618662-132618684 GGGCGGGGCCGGGGCGAGGCGGG + Intergenic
1104989791 12:132619022-132619044 GCGGGGCGCAGGGGAGGGGCTGG + Intronic
1105006542 12:132724582-132724604 GGGAGAAGGCAGGGAGGGGCAGG + Intergenic
1105019387 12:132805742-132805764 GGGCAGCGCTAGGGCAGGGCTGG + Intronic
1105378346 13:19864155-19864177 GGGCGAGGCCGGGGAGGTGCTGG + Intergenic
1105388875 13:19958193-19958215 GGGCGAGGCCGGGGAGGCGCTGG - Intergenic
1105409803 13:20161644-20161666 GAGTGGCGCCCGGGCGGGGCGGG + Intergenic
1105447821 13:20472868-20472890 GGCTGGGGCCAGGGAGGGGAGGG + Intronic
1105636484 13:22220535-22220557 TGGGGGCTGCAGGGAGGGGCTGG - Intergenic
1106101170 13:26695996-26696018 GCTGGGCGACAGGGAGGGGCAGG - Intergenic
1106157517 13:27171847-27171869 GGGCGGAGCCGGGGGCGGGCCGG - Exonic
1106308285 13:28532462-28532484 GCGCGGCGCCAGGCTCGGGCTGG + Intergenic
1106422437 13:29595315-29595337 GGGCCGCGGCAGGGCGGCGCGGG - Intronic
1106512321 13:30422121-30422143 GAGCGGCCCCAGGGAGCGGCGGG + Intergenic
1107058516 13:36131226-36131248 GGGCGGCGGCGGGGCCGGGCTGG + Exonic
1107595667 13:41960892-41960914 GGGTGGCGACAGGCAGCGGCCGG - Exonic
1107603924 13:42040497-42040519 GGGCGGCGGGGGGGAGGGGCGGG + Intronic
1108750139 13:53439898-53439920 GGGAGGGGCAAGGGAGGGGGAGG - Intergenic
1112431060 13:99350559-99350581 AGGGGGTGCCAGAGAGGGGCAGG + Intronic
1113065485 13:106370108-106370130 GGGCAGCTCCAGGGAGGGTAAGG - Intergenic
1113247051 13:108408840-108408862 GTGCAGCTGCAGGGAGGGGCAGG - Intergenic
1113379222 13:109787027-109787049 GGGCCGCGGCTGGGCGGGGCGGG + Intergenic
1113581064 13:111429459-111429481 GGGCGGAGCCACCGAGGGGTCGG - Intergenic
1113610934 13:111644835-111644857 GGGCAGCGCCAGGGGGGGAAAGG + Intronic
1113831286 13:113297508-113297530 AGGCGGGGCCTGGGAGCGGCGGG + Intronic
1113893351 13:113748184-113748206 GGACAGCGTCAGGGAGGGGCAGG - Intergenic
1114525860 14:23366453-23366475 GGGCAGGGCCAGGGCGGGACGGG - Intergenic
1114618571 14:24081631-24081653 GGGCGGAGCCAGGTAGCGTCGGG - Intronic
1114655064 14:24311035-24311057 CCGAGGCGCCAGGAAGGGGCGGG - Exonic
1117046313 14:51816731-51816753 GGGAGGGGGCAGGGAGGTGCTGG - Intergenic
1117424400 14:55580194-55580216 GGGCGGCTTCGGGGCGGGGCGGG - Intronic
1119263152 14:73250127-73250149 GCCCGGAGGCAGGGAGGGGCTGG - Intronic
1119492784 14:75051194-75051216 GGGGCTGGCCAGGGAGGGGCTGG - Intronic
1119539525 14:75428942-75428964 GGGCTGGGCAAGGGAGAGGCTGG - Intronic
1121199669 14:92106632-92106654 GGGGCGGGCCGGGGAGGGGCGGG - Intergenic
1121312766 14:92944134-92944156 GGGCCCCTCCAGAGAGGGGCTGG - Intronic
1121473424 14:94174184-94174206 GCGCGGCGCCCGGGAAGGGGCGG + Intronic
1121592360 14:95125673-95125695 GGGAGGGGACAGGGAGGGGGAGG + Intronic
1121617066 14:95320104-95320126 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1121645858 14:95516669-95516691 GGGCGGCTCCGGGGCGGGGCAGG + Intronic
1121798757 14:96756136-96756158 TGGCAGGGCCAGGGAGGGGATGG - Intergenic
1122097170 14:99380722-99380744 GGGAGTGGTCAGGGAGGGGCAGG - Intergenic
1122145079 14:99684175-99684197 GGGCGGGGCGGGGGAGGGCCCGG + Intergenic
1122293712 14:100693483-100693505 GAGCAGAGCCAGGCAGGGGCAGG - Intergenic
1122418296 14:101560706-101560728 GGGCGCGGCCAGGGCGGCGCGGG + Intergenic
1122688428 14:103520810-103520832 GGGCGGGGCCAGGGACCGCCAGG + Intronic
1122779669 14:104138429-104138451 GGGCGGCGCGTGGGGGGGGTAGG - Intergenic
1122779706 14:104138519-104138541 GGGCGGGGCCGGGGAAGGGCGGG - Intergenic
1122787370 14:104170005-104170027 GGGCCTCCCCAGGGAGGGGATGG - Intronic
1122787511 14:104170816-104170838 GGCAGACGCCGGGGAGGGGCAGG - Intronic
1122813491 14:104300692-104300714 GGGGTGCGCTAGGCAGGGGCCGG + Intergenic
1122840772 14:104461617-104461639 GGGCGGGGCGGGGGCGGGGCGGG + Intergenic
1122920700 14:104878785-104878807 GGGAGGGGCCTGGGAGGAGCCGG + Intronic
1123004487 14:105314788-105314810 GGGCGGCGGAGGGGACGGGCCGG - Exonic
1202930620 14_KI270725v1_random:29986-30008 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1123421737 15:20141431-20141453 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1123530963 15:21147971-21147993 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1123684257 15:22786445-22786467 ACGCGGCGGCAGTGAGGGGCCGG - Intronic
1124095950 15:26648890-26648912 GTGGGGTTCCAGGGAGGGGCTGG + Intronic
1124125828 15:26937523-26937545 GTGCAGCTGCAGGGAGGGGCAGG - Intronic
1124484808 15:30104324-30104346 GGACCGCGACAGGGCGGGGCAGG + Intergenic
1124515114 15:30361222-30361244 GGCAGGCGCCAGGGAGGGGATGG - Intronic
1124518772 15:30392914-30392936 GGACCGCGACAGGGCGGGGCAGG - Intronic
1124539884 15:30573332-30573354 GGACCGCGACAGGGCGGGGCAGG + Intergenic
1124632770 15:31346862-31346884 TGGCGGCATCAGGGAGGGTCTGG + Intronic
1124727808 15:32169505-32169527 GGCAGGCGCCAGGGAGGGGATGG + Intronic
1124758767 15:32434250-32434272 GGACCGCGACAGGGCGGGGCAGG - Intergenic
1125541295 15:40471294-40471316 GGGCAGGGCCCGGGCGGGGCTGG + Exonic
1125677656 15:41511438-41511460 CGGAGGCGCCCGGGAGCGGCGGG - Exonic
1125834449 15:42737148-42737170 GCGGGCGGCCAGGGAGGGGCGGG + Intergenic
1125852726 15:42920402-42920424 GGGCGGCGCCCTGGGGGGTCGGG + Intronic
1127834956 15:62783414-62783436 GGGCTGCGCTGGCGAGGGGCTGG + Intronic
1128078309 15:64841817-64841839 GGGCGGGGCCGGGGAGGGGGCGG - Intergenic
1128350553 15:66885553-66885575 GTGCTGGGCCTGGGAGGGGCAGG - Intergenic
1128582772 15:68820582-68820604 GGGGGGCGCCCGGGAGGTGCGGG - Intronic
1128742988 15:70096325-70096347 GGGCGCCGTTGGGGAGGGGCCGG - Intronic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1128933721 15:71727903-71727925 GGGGGGCAACAGGGAGGGGTGGG + Intronic
1128944450 15:71811443-71811465 GGGCTGGGCCAGGGCAGGGCTGG - Intronic
1128945218 15:71815092-71815114 TGGCTGCGCGAGGGTGGGGCAGG + Intronic
1128995014 15:72289334-72289356 GGGGCGCGCCTGGGAGGGGCCGG - Intronic
1128999450 15:72320055-72320077 GGGCGGGGCCGGGGCGGGGCGGG + Exonic
1129261051 15:74367504-74367526 GAGTGCCCCCAGGGAGGGGCTGG - Exonic
1129326014 15:74800653-74800675 GGGAGGGGCCAGTGAGGGCCTGG - Intronic
1129743217 15:78000276-78000298 CTGCGGTGCCAGGGAAGGGCGGG + Intronic
1129780225 15:78264901-78264923 GGGCGGCGCGGGGCACGGGCCGG + Intronic
1129871627 15:78945116-78945138 GGGCGGAGCGAGCGCGGGGCGGG + Intronic
1130010841 15:80152480-80152502 GGGCGGGGCCAGGGGAGGGGCGG + Intronic
1130010955 15:80152765-80152787 GGGCGGGGCCAGGGGCGGGGCGG + Exonic
1130652894 15:85772383-85772405 TGGCAGGGCCAGGGTGGGGCAGG - Intronic
1131144364 15:90001736-90001758 GGCCGTCCCCAGGGAGAGGCGGG - Intronic
1131256615 15:90867066-90867088 GGAAGGGGGCAGGGAGGGGCGGG - Intergenic
1131512497 15:93056987-93057009 GAGCTTCACCAGGGAGGGGCAGG - Intronic
1131517625 15:93089346-93089368 CGGGGCCGGCAGGGAGGGGCGGG + Intergenic
1131721803 15:95177396-95177418 AGACGAAGCCAGGGAGGGGCAGG + Intergenic
1131977567 15:97961206-97961228 CTGCGGGGCCGGGGAGGGGCTGG + Intronic
1132055242 15:98647473-98647495 GGGCGGCTGCGGGGAGCGGCCGG - Intergenic
1132105338 15:99059070-99059092 GGGCGGCGCCGGGCAGCGCCGGG - Intergenic
1132292912 15:100715618-100715640 GGGCTGGGCAAGGCAGGGGCAGG + Intergenic
1132482306 16:172738-172760 GGGCGGGGCCTGCGCGGGGCCGG - Intergenic
1132483154 16:176542-176564 GGGCGGGGCCTGCGCGGGGCCGG - Intergenic
1132496650 16:266526-266548 GTGTGGCGGCAGTGAGGGGCAGG + Intronic
1132543862 16:524182-524204 GGCCAGAGCCAGGGAGGGGAAGG + Intergenic
1132547181 16:538683-538705 GGGAGGAACCAGGGAAGGGCTGG + Intronic
1132557503 16:579012-579034 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1132576989 16:668711-668733 GCGCGGGACGAGGGAGGGGCTGG + Intronic
1132588104 16:715011-715033 GGGCGGAGCGGGGGCGGGGCCGG - Intronic
1132599065 16:765867-765889 CTGCAGAGCCAGGGAGGGGCAGG - Intronic
1132604615 16:788518-788540 GGGCTGCGCGAGGGGTGGGCGGG - Intergenic
1132604770 16:789064-789086 GGGCGGCGCCAGGAAGAGGCAGG + Exonic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132623364 16:878742-878764 GGGCGGGGGCAGGGGCGGGCAGG + Intronic
1132663771 16:1072735-1072757 GGGCGCCGGCTGGGAGGGGGCGG - Intergenic
1132698467 16:1212273-1212295 GGGCTGGGCCTTGGAGGGGCTGG + Intronic
1132724487 16:1333045-1333067 GGGAGCCACCCGGGAGGGGCTGG + Intergenic
1132821226 16:1872210-1872232 GGGCGGAGCCAGTGAGCGGTGGG - Intronic
1132821233 16:1872232-1872254 GGGCGGAGCCAGTGAGCGGTGGG - Intronic
1132826342 16:1907476-1907498 GGGCAGAGCCAGGGAAGGGAAGG - Intergenic
1132889081 16:2195576-2195598 GGCCGGCCCCAGGAAAGGGCTGG - Intronic
1132892402 16:2210706-2210728 GGGCTGGGGAAGGGAGGGGCTGG + Intronic
1132897595 16:2236393-2236415 GTCCTGGGCCAGGGAGGGGCCGG - Exonic
1132900423 16:2251287-2251309 GGGCGGCGCCGAGGGAGGGCGGG - Intronic
1132950906 16:2562052-2562074 AGGCAGCGCCAGGGTGTGGCTGG + Intronic
1132963443 16:2638118-2638140 AGGCAGCGCCAGGGTGTGGCTGG - Intergenic
1132970004 16:2682587-2682609 GGGCGGCATCGGGGCGGGGCTGG + Exonic
1133029176 16:3001525-3001547 GAGCTGGGCTAGGGAGGGGCGGG - Intergenic
1133212887 16:4272894-4272916 GGGAGGCGGGCGGGAGGGGCGGG + Exonic
1133213104 16:4273779-4273801 GGGCCCCGGCAGGGAGGGGAGGG + Intergenic
1133272279 16:4616108-4616130 GGACGGCGCCTGGGACAGGCTGG + Intergenic
1133328721 16:4958196-4958218 GGGCGGGGCCAGAGTGGGGCGGG + Intronic
1134149692 16:11796577-11796599 GGGCGCCGCCCGGGAGGACCGGG - Intronic
1134566728 16:15258058-15258080 GGGCGGGGGCAGGAGGGGGCAGG - Intergenic
1134614860 16:15643202-15643224 AGGCGGGGCGAGGAAGGGGCGGG - Intergenic
1134735765 16:16498641-16498663 GGGCGGGGGCAGGAGGGGGCAGG + Intergenic
1134931761 16:18213581-18213603 GGGCGGGGGCAGGAGGGGGCAGG - Intergenic
1136083433 16:27867823-27867845 GGGCGTGGCCAGGAAGTGGCTGG - Intronic
1136247723 16:28985094-28985116 GGCGGGCGCCGAGGAGGGGCAGG + Intronic
1136293972 16:29291402-29291424 GGGCTGCGGCACAGAGGGGCAGG + Intergenic
1136377259 16:29872788-29872810 GGGAGGAGGCTGGGAGGGGCCGG + Intronic
1136397607 16:30001542-30001564 TGGGGGTGCTAGGGAGGGGCAGG + Intronic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1136408974 16:30065601-30065623 AGGCCGCGCTAGGAAGGGGCGGG - Intronic
1136532858 16:30881672-30881694 GAGCGGAGGGAGGGAGGGGCAGG - Intronic
1136578061 16:31135769-31135791 GGGCGGGGCCAGGGGAGGGGCGG - Intergenic
1136590350 16:31214662-31214684 GGGCTGGGCCAGGGCTGGGCCGG + Intronic
1136607582 16:31346876-31346898 GGGCCGTGCCTGGGAGGGGCTGG - Intergenic
1136628702 16:31477023-31477045 GGGCGGGGCGTTGGAGGGGCGGG + Intronic
1136628718 16:31477065-31477087 GGGCGGGGCCTTGGAGGGGCGGG + Intronic
1136722894 16:32338782-32338804 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1136841215 16:33544781-33544803 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1136863106 16:33714226-33714248 TGGCAGAGCCAGGGAAGGGCTGG - Intergenic
1136913639 16:34162583-34162605 GGGGGAGGCGAGGGAGGGGCGGG - Intergenic
1138105884 16:54286948-54286970 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1138265289 16:55656034-55656056 GGGCGGGGCCGGGGAAGAGCTGG - Intronic
1138349422 16:56338628-56338650 GGGCAGGTCCAGGGAGAGGCTGG - Intronic
1138514160 16:57526758-57526780 GGGCCGGGCCAGGAAGAGGCTGG - Intronic
1138619259 16:58198228-58198250 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1139364973 16:66427449-66427471 GGGCGGCGCGGGGGAGGGGCGGG + Intronic
1139483282 16:67242501-67242523 GGGTGACCCCAGGAAGGGGCCGG - Intronic
1139509330 16:67417517-67417539 TGGCAGCCCCAGGGAGAGGCAGG - Intergenic
1139511554 16:67431048-67431070 GGGCGGGGAGCGGGAGGGGCGGG - Intronic
1139528575 16:67530539-67530561 GGGCGGCCCCGGGGTGGGGCGGG + Intronic
1139534243 16:67562068-67562090 GGGCGGAGACTGGGCGGGGCCGG + Intergenic
1139850943 16:69951417-69951439 AGGCGGTGCCAAGGAGGGCCAGG - Exonic
1139879925 16:70174329-70174351 AGGCGGTGCCAAGGAGGGCCAGG - Exonic
1139909984 16:70391726-70391748 GGCCGGGGCCTGGGCGGGGCAGG + Intronic
1140700318 16:77575303-77575325 GGCCAGGGCCAGAGAGGGGCAGG + Intergenic
1141054557 16:80803836-80803858 GGGCGGAGCCGGGGCGGGGGAGG - Intronic
1141132360 16:81444953-81444975 GGCGGGCGACGGGGAGGGGCGGG - Intergenic
1141283917 16:82653638-82653660 GGGAGCAGCCAGGGAGGGGGTGG + Intronic
1141509688 16:84504480-84504502 GTGGGAGGCCAGGGAGGGGCAGG + Intronic
1141608541 16:85169139-85169161 CGGCGGCGGGCGGGAGGGGCGGG - Intergenic
1141620501 16:85234734-85234756 GGGCGGAGCCGGGGCGGGGCCGG - Intergenic
1141650562 16:85390708-85390730 GGGCGGTGGCGGGGAGGGGTGGG - Intergenic
1141709412 16:85689164-85689186 GGGCGGGGCCGGGGTGGGGGCGG - Intronic
1141733151 16:85835555-85835577 GGGCGGCTCCATGCAGGGGGAGG + Intergenic
1141943420 16:87293797-87293819 GGGCTGTGTCGGGGAGGGGCAGG - Intronic
1142077313 16:88127634-88127656 TGGAGGCGGCAGGGAGGGCCTGG + Intergenic
1142099876 16:88265448-88265470 GGGCTGCGGCACAGAGGGGCAGG + Intergenic
1142136157 16:88452959-88452981 GGGCCGAACCAGGAAGGGGCGGG + Intergenic
1142136218 16:88453160-88453182 GGGCGGAGCCGGAGAGGTGCAGG + Intergenic
1142173271 16:88633882-88633904 GGGCACCCCCTGGGAGGGGCTGG - Intergenic
1142177293 16:88651079-88651101 GGGCGGGGCCTGGGCGGGGCGGG - Exonic
1142221385 16:88856714-88856736 GGGCAGGGCCGGGGTGGGGCGGG - Intronic
1142261661 16:89045311-89045333 GGGCGGGGCCAGTAAGGAGCAGG + Intergenic
1142264695 16:89058340-89058362 GGGAGGTGCCAGGGCTGGGCTGG + Intergenic
1142269450 16:89081594-89081616 GGGCAGAGACAGCGAGGGGCTGG - Intergenic
1142285869 16:89171358-89171380 GGGTGGGGCCGGGGTGGGGCCGG - Intergenic
1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG + Exonic
1142345292 16:89550125-89550147 GGGCCCAGCCAGGGAGAGGCCGG + Intronic
1142367564 16:89657994-89658016 GCGCGGGCCCAGGGCGGGGCTGG + Intronic
1142429727 16:90019525-90019547 GGGGGGCGCCGGGAGGGGGCCGG - Intronic
1203003537 16_KI270728v1_random:178982-179004 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1203124592 16_KI270728v1_random:1562379-1562401 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1203135145 16_KI270728v1_random:1715389-1715411 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1203151380 16_KI270728v1_random:1845078-1845100 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1142645040 17:1306046-1306068 TGGGGCCGCCAGGGAGGGGTAGG + Intergenic
1142699147 17:1649103-1649125 GGGCGGAGCGAGGCAGGCGCTGG - Intronic
1142762343 17:2050016-2050038 GGACGGCGCCGGCGCGGGGCGGG + Intergenic
1142811944 17:2399640-2399662 GGGCGGGGCCTGGGCGGGGCTGG - Intronic
1142886930 17:2918671-2918693 GGACGGCACCAGGGAGGGGATGG + Intronic
1142960189 17:3547720-3547742 GGGCAGCGGAGGGGAGGGGCAGG + Intronic
1143028193 17:3953206-3953228 GGGCAGGGCCAGGGAAGGCCAGG + Intronic
1143031699 17:3971511-3971533 GGGGGGCAGCGGGGAGGGGCAGG + Intergenic
1143515600 17:7417824-7417846 TGGCCGGGCCAGGGAGGGCCGGG - Exonic
1143830210 17:9645394-9645416 GGGCGGCACCAGGCAGGGGTAGG + Intronic
1143893970 17:10122515-10122537 GGAGGGCGCCAGGGAGGGCGAGG - Intronic
1144292226 17:13837665-13837687 GGGCGGTGCCAGAGAAGGCCAGG + Intergenic
1144470446 17:15535497-15535519 GGAAGGAGCCAGGGAGTGGCAGG - Intronic
1144625914 17:16844434-16844456 GCACGGGGCAAGGGAGGGGCTGG - Intergenic
1144704975 17:17362308-17362330 GGGCTGGGCCAGGGAGAGGCCGG + Intergenic
1144747392 17:17625071-17625093 GGGAGGCGGCAGTGAGGGGAGGG - Intergenic
1144784370 17:17823677-17823699 GGGCGGGGCTGGGGCGGGGCTGG - Intronic
1144880519 17:18428286-18428308 GCACGGGGCAAGGGAGGGGCTGG + Intergenic
1144925895 17:18808175-18808197 GGAAGGAGCCAGGGAGTGGCAGG + Intergenic
1145151716 17:20516101-20516123 GCACGGGGCAAGGGAGGGGCTGG - Intergenic
1145265905 17:21379514-21379536 GGGCAGGCCCGGGGAGGGGCAGG - Intronic
1145925644 17:28644934-28644956 CGGCGGCGGGAGGGAGGGGGCGG - Intronic
1146163087 17:30570382-30570404 GCACGGGGCAAGGGAGGGGCTGG - Intergenic
1146176266 17:30668101-30668123 CGGCGGCCCCAGGGAGGGAGGGG + Intergenic
1146318481 17:31827689-31827711 GGTCGGAGCCAGGCAGGTGCTGG - Intergenic
1146349721 17:32084211-32084233 CGGCGGCCCCAGGGAGGGAGGGG + Intergenic
1146371004 17:32265776-32265798 GGGCGGCGCGCGGGCGGGGGCGG - Intergenic
1146413903 17:32614239-32614261 GGGCGGGGGCATGGAAGGGCAGG - Intronic
1146469185 17:33110776-33110798 GGGTGGCAACAGGTAGGGGCTGG + Intronic
1146624440 17:34424828-34424850 GGGAGGCCCCAGGGAGCAGCTGG + Intergenic
1146644539 17:34568320-34568342 GGGCTGCCTCAGGGAAGGGCTGG - Intergenic
1146903224 17:36601555-36601577 GGAAGGGGCCGGGGAGGGGCGGG + Exonic
1146957133 17:36942387-36942409 GGGCGCGGCCAGGTCGGGGCGGG + Intronic
1146958100 17:36948940-36948962 GGGAGGCGCGCGGGAGGGGGCGG - Exonic
1147249601 17:39145154-39145176 GGGCAGCCCCGGGGTGGGGCTGG + Intronic
1147258219 17:39194671-39194693 GGGAGGGGCCGGGCAGGGGCGGG + Intronic
1147260998 17:39209838-39209860 GCGGGGCGCCAAGGAGAGGCGGG - Intergenic
1147382011 17:40061852-40061874 CGGCGGGGCCAGGGGGGTGCTGG + Intronic
1147384680 17:40074279-40074301 GGGAGGGGCCAGGGAGTGGCAGG - Exonic
1147424972 17:40342077-40342099 GGGCGGTGCCTGGACGGGGCGGG + Intronic
1147580064 17:41623132-41623154 GCACGGGGCAAGGGAGGGGCTGG - Intronic
1147884552 17:43675981-43676003 GGGCAGCTCCAAGGATGGGCTGG + Intergenic
1147965804 17:44193646-44193668 GGGCTGCCCCTGTGAGGGGCAGG + Exonic
1148081155 17:44968261-44968283 GGGAGGCGCGAGGCAGGAGCCGG - Intergenic
1148403322 17:47386880-47386902 AGGCGGCGGCGGGGAGGGGGTGG - Intronic
1148475880 17:47928225-47928247 CGGCAGGGCCAGGGAGGTGCAGG - Exonic
1148491284 17:48025338-48025360 GGGCGGGGCCGGGGTGGAGCCGG + Intergenic
1148748669 17:49932209-49932231 GGGCAGAGCCAGGGTGGGCCAGG - Intergenic
1148786649 17:50149107-50149129 GGGCGGCGCGGGGGCAGGGCGGG + Intronic
1148821102 17:50360188-50360210 GCAGGGCTCCAGGGAGGGGCAGG - Exonic
1148852546 17:50561831-50561853 GGGGGCTGCCAGGGAGGGGAGGG + Intronic
1148896287 17:50841025-50841047 GGGAGGGGGCAGGGAGGGGTGGG - Exonic
1148906741 17:50917233-50917255 GCGGGGGGCCAGGGCGGGGCGGG - Intergenic
1149314081 17:55422129-55422151 GGGCCTCGCTGGGGAGGGGCGGG + Intergenic
1149347169 17:55750918-55750940 GGGTGGGGCCCTGGAGGGGCGGG - Intergenic
1149512835 17:57256902-57256924 GGGGGGCGCGCGGGAGAGGCGGG - Intronic
1149664614 17:58357225-58357247 GGGAGGTCCCAGGGAGGTGCTGG - Intronic
1150002662 17:61451651-61451673 CGGCGGCGGCAGGGAAGTGCTGG - Intergenic
1150134800 17:62689813-62689835 AGGCGGGGGCAGGAAGGGGCAGG - Intronic
1150137612 17:62704201-62704223 GGGCGGCGGCGGGGAGCCGCGGG + Intronic
1150168368 17:62966234-62966256 CGGCGGCGCTAGCGAGCGGCCGG + Intergenic
1150212045 17:63446790-63446812 GGGCAGGGCGAGGGCGGGGCAGG - Intergenic
1150227858 17:63533563-63533585 GGGTGGAGCCAGGCAGGGGAGGG - Intronic
1150373676 17:64662392-64662414 GGGCGGGGCCGGGGCGGGGCCGG + Intergenic
1151453545 17:74213481-74213503 GCGCGGGCCCAGGGAGAGGCGGG + Intergenic
1151557225 17:74852620-74852642 GGGCGGGGCCTGAGCGGGGCGGG + Intronic
1151562543 17:74878285-74878307 GGGCCAGGCCAGGGAGGGGCAGG + Exonic
1151565068 17:74893212-74893234 TGGCGGCGGCAGGGAGGCGGAGG - Intronic
1151570469 17:74923166-74923188 GGACGGGGCCGGGCAGGGGCCGG + Exonic
1151625073 17:75271246-75271268 GCGCGGCGCCGGGGAAGGGTCGG + Intergenic
1151821956 17:76501388-76501410 GTGCGGCGCCTGCGAGCGGCTGG + Exonic
1151939029 17:77281368-77281390 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1152318227 17:79593217-79593239 GGGAGCTGCCAGGGAAGGGCAGG - Intergenic
1152357435 17:79813798-79813820 CGCCGGCCCCCGGGAGGGGCGGG - Intergenic
1152362639 17:79839626-79839648 GGAGGGCGCCGGGGAGGTGCAGG + Intergenic
1152396378 17:80035941-80035963 CGGCGGGGGCAGGCAGGGGCCGG - Intergenic
1152512452 17:80799710-80799732 GGCGGCCGCCAGGGAGGGGAGGG - Intronic
1152574070 17:81132558-81132580 GGGTGGGGCCAGGCCGGGGCTGG - Intronic
1152581196 17:81166247-81166269 GAGCGGCGCGGGGGAGGGGGGGG + Intergenic
1152699492 17:81812006-81812028 GGCCTGAGGCAGGGAGGGGCCGG + Intronic
1152711159 17:81871086-81871108 GGGCGGGGCCGGGGCGGGACCGG - Intronic
1152732090 17:81977479-81977501 TGGCGGCCCAAGGGCGGGGCCGG + Intronic
1152738510 17:82008907-82008929 GGCCGGGGCCAGGGAGGGAGTGG + Intronic
1152744271 17:82031858-82031880 GGGCGCAGCCGGGGCGGGGCGGG + Intronic
1152774883 17:82194915-82194937 GGGCTGCGCCCGGCATGGGCAGG + Intronic
1152786497 17:82250649-82250671 TGCAGGGGCCAGGGAGGGGCGGG - Intronic
1152801719 17:82333779-82333801 GGGAGGGGCCAGGGAGGAGGCGG + Exonic
1152809670 17:82375543-82375565 GGGGGGCTCCCGGGAGTGGCTGG - Exonic
1152844839 17:82593431-82593453 GGGCTCCGCCAGGGGGGCGCGGG - Intronic
1152870632 17:82751573-82751595 GGGCGGGGCGGGGGCGGGGCGGG - Intergenic
1152932975 17:83119932-83119954 GGGCGGGGCTTGGGAGGGGTTGG + Intergenic
1152933009 17:83119997-83120019 GGGAGGGGCTGGGGAGGGGCTGG + Intergenic
1152933015 17:83120008-83120030 GGGAGGGGCTGGGGAGGGGCTGG + Intergenic
1153201881 18:2655669-2655691 GGCGGGCGACAGCGAGGGGCGGG - Intergenic
1153282321 18:3425958-3425980 GGGCGGGGGCAGGGCAGGGCAGG - Intronic
1153805222 18:8705089-8705111 GGCGGGCGCCCGGCAGGGGCGGG - Intergenic
1153805375 18:8705530-8705552 GGGCGCAGCCCGGGCGGGGCTGG + Intergenic
1154176333 18:12088755-12088777 GGCCAGCGCCAGGCAGGGCCAGG - Intergenic
1154355198 18:13619506-13619528 GGGTGGGGCCGGGGGGGGGCGGG + Intronic
1154414622 18:14170498-14170520 GGGTGGGGCCAGGGCAGGGCAGG + Intergenic
1154492892 18:14934658-14934680 GGGCTGGGTCAGGGAGGGGCTGG + Intergenic
1155055332 18:22177180-22177202 AGGCCGAGCCAGGGCGGGGCCGG - Intronic
1156008564 18:32470929-32470951 GGGCGGCGCCTGGGAGGCGGAGG - Intergenic
1156350428 18:36297653-36297675 GGGCGGGGCGGGGGCGGGGCCGG - Intergenic
1156452556 18:37274919-37274941 AAGCAGGGCCAGGGAGGGGCCGG + Intronic
1156657696 18:39308586-39308608 GGACGGGGGCAGGGAAGGGCTGG + Intergenic
1158718284 18:59899902-59899924 GGGCGGGGACAGGGGCGGGCCGG + Intergenic
1159040561 18:63319994-63320016 GGCCGCCGGCAGGGAGGGCCCGG + Exonic
1159369941 18:67516784-67516806 GGGCGGAGGCAGGACGGGGCGGG + Exonic
1160114422 18:76064271-76064293 AGGCTGGGCCAGGGATGGGCCGG + Intergenic
1160158080 18:76449031-76449053 GGGAGGAGCCAGGGAGGACCTGG - Intronic
1160164109 18:76495310-76495332 GGGCGGCGCGAGGAGGGGGCCGG - Intergenic
1160184059 18:76660904-76660926 GGGCCCCGCCCTGGAGGGGCTGG + Intergenic
1160535478 18:79589363-79589385 GGGAGGCCCCTGGGAGGGACCGG + Intergenic
1160585606 18:79911800-79911822 GGGAGGCAGCAGGGAGGGGATGG + Intronic
1160682505 19:418207-418229 GGGCTGGGACAGGCAGGGGCTGG - Intronic
1160710549 19:549188-549210 GAGGGGCGCCCGGGTGGGGCTGG + Intronic
1160719077 19:589801-589823 GGGAGGGGCGGGGGAGGGGCGGG - Intergenic
1160724933 19:613719-613741 GGCCGGCACCAGGGAGAGCCTGG + Intronic
1160735970 19:662624-662646 GCGCGGCGCGGGGCAGGGGCTGG - Intronic
1160736562 19:665336-665358 GGGAGGGGTCAGCGAGGGGCAGG - Intergenic
1160798312 19:955694-955716 GGGCTGTGCCAGGGAAGGGGGGG + Intronic
1160856318 19:1219426-1219448 GGCAGGGGCCAGGGTGGGGCGGG + Intronic
1160875850 19:1295910-1295932 GGGCGGGGCCAGGAAGTGGGCGG + Intronic
1160930755 19:1568438-1568460 GGGCGGGGCCGGGGCGGGGCCGG + Intergenic
1161014858 19:1978517-1978539 GGGCGGCCCGCGGGTGGGGCGGG + Intronic
1161050996 19:2164087-2164109 GGCGGGCGGGAGGGAGGGGCGGG - Intronic
1161149696 19:2701518-2701540 GGGGTGAGCCAGGGAGTGGCTGG - Intronic
1161210358 19:3062421-3062443 GGCGGGCGGCGGGGAGGGGCGGG - Intronic
1161262512 19:3345637-3345659 GGGCGGCGGGAGGGGGGGGCGGG - Intergenic
1161394737 19:4038949-4038971 GGGTGGGGCCTGCGAGGGGCCGG - Exonic
1161505076 19:4639503-4639525 GGCCGGGGCCGGGGCGGGGCGGG - Intronic
1161556606 19:4946190-4946212 GGGCGGTGCCAGGGACTGGGAGG - Intronic
1161620031 19:5292957-5292979 GGGGGGCGCCAGGCAGCAGCAGG + Intronic
1161723406 19:5915647-5915669 GGGACCCGCAAGGGAGGGGCAGG - Exonic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161793273 19:6373272-6373294 GGGCGGGGCCACGCTGGGGCGGG + Intronic
1161967223 19:7555356-7555378 GGGCGGGGCCAGGTGAGGGCGGG + Exonic
1162034443 19:7931641-7931663 GGGCAGCGAGAGGGAGGGGTGGG + Intronic
1162034804 19:7933041-7933063 GGGTGGGGTCAGGGAGGGGACGG + Intronic
1162109210 19:8390941-8390963 GGGTGGGGCCCGGGAGAGGCGGG + Intronic
1162299260 19:9835104-9835126 GGGCGGGGCCAGGCTGAGGCTGG + Intergenic
1162340943 19:10091402-10091424 GGGCCAGGGCAGGGAGGGGCAGG - Intronic
1162377917 19:10316029-10316051 GCGCCGCGCCAGGGAGGCGAGGG + Exonic
1162416898 19:10543847-10543869 GGGCGGGGAGAGGGCGGGGCGGG + Intergenic
1162508970 19:11105605-11105627 GGGCGGGGCCAGGGTGGGGGCGG + Intronic
1162537968 19:11275343-11275365 GGGCAGCGCCAGGGAGCTTCAGG + Intergenic
1162720167 19:12657394-12657416 GGGTGGAGACAGGAAGGGGCGGG - Intronic
1162744759 19:12792146-12792168 GGGCGGCGTCACCGAGGAGCAGG + Exonic
1162788660 19:13051859-13051881 GGGCGGCTCCCGGGAGCAGCCGG + Intronic
1162802271 19:13118187-13118209 GGGCGGTGCGCGGGCGGGGCCGG + Intronic
1162948581 19:14057644-14057666 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1162951112 19:14072659-14072681 GGGCGGGGCCAGGGCGGGGCGGG + Intronic
1162954496 19:14090770-14090792 CGGCGGCGGCGGGGAGGGGCCGG - Intronic
1163029913 19:14537258-14537280 AGGCGGGACCAGGGAGGGGGAGG + Intronic
1163029923 19:14537278-14537300 AGGCGGGACCAGGGAGGGGGAGG + Intronic
1163233937 19:16020403-16020425 AGCTGGCGCCTGGGAGGGGCTGG - Intergenic
1163478341 19:17539868-17539890 GGGCGTGGTCAGAGAGGGGCGGG + Intronic
1163518747 19:17779746-17779768 GGGTGGAGTCAGGGAGGGGTGGG + Intronic
1163579893 19:18132082-18132104 GGGCGGGGCCAGAGAGGATCAGG + Intronic
1163591173 19:18194911-18194933 GGGCGGGGCCAGAGCTGGGCGGG - Intronic
1163595946 19:18221068-18221090 GGGCGGGGCGGGGGCGGGGCCGG - Intronic
1163664489 19:18596864-18596886 GGGCGGAGTCAGGGAAGGGGAGG + Intronic
1163700740 19:18785391-18785413 GGGCGGGGCCAGAAGGGGGCTGG - Intronic
1163829414 19:19540637-19540659 GGGCGGGGCCAGGCAGGGCGGGG + Intronic
1163830464 19:19545003-19545025 GGGCGGGGCAAGGAAGGGGCCGG - Exonic
1163851134 19:19664099-19664121 GGGCGGGGCTTGTGAGGGGCGGG + Intergenic
1164639076 19:29811819-29811841 GGCCGGCGCCGTGGAGGGGCGGG + Intergenic
1164639092 19:29811847-29811869 GGGCGGGGCGAGGGACGGGGCGG + Intergenic
1164639118 19:29811919-29811941 GGGCGGTGCGAGGGCGGGCCGGG + Exonic
1164879059 19:31715476-31715498 AGGGGGCGCCGGGAAGGGGCGGG - Intergenic
1165071893 19:33260683-33260705 GGGCTGCACCAGGGAGGGGCCGG - Intergenic
1165114679 19:33521827-33521849 GGGCGGGGTAAGGGCGGGGCAGG + Intergenic
1165247593 19:34506033-34506055 GGGCTGGTCCAGGGACGGGCTGG - Exonic
1165313059 19:35040156-35040178 GGGAGGAGGCGGGGAGGGGCTGG - Intronic
1165331003 19:35141235-35141257 AGGTGGGGCCAGGGAGAGGCGGG - Intronic
1165331015 19:35141267-35141289 AGGCGGGGCCAGGGAGAGGCGGG - Intronic
1165331036 19:35141314-35141336 GGGCGGGACCAGGGAGAAGCGGG - Intronic
1165331041 19:35141330-35141352 GGGCGGGGCCAGGGAGGGGCGGG - Intronic
1165396218 19:35565039-35565061 GGGCAGCAGCAGCGAGGGGCTGG + Intergenic
1165481792 19:36068963-36068985 GGGCGGCGGCAGGGCGGAGGCGG + Intronic
1165784470 19:38453057-38453079 GGGCGGGACCACTGAGGGGCGGG + Intronic
1165793858 19:38507368-38507390 AGGCGGGGCCAGAGAGGGGTGGG + Intronic
1166094527 19:40530677-40530699 TGGCCGCGGGAGGGAGGGGCGGG + Intronic
1166094538 19:40530698-40530720 GGGCGGCGCGGGGGCGGGCCGGG + Intronic
1166104071 19:40589062-40589084 GGCCTGGGCCAGGCAGGGGCAGG - Exonic
1166150961 19:40875642-40875664 GGGCGGGGCCAGGGAAAGGCGGG - Exonic
1166304258 19:41928601-41928623 CGGCGGCGCGGGGGAGGGGGCGG + Intronic
1166305687 19:41935851-41935873 GGGGGGAGCCTGGGAGGGGGTGG - Intergenic
1166546970 19:43639716-43639738 CGGCGGGGCCAGGTAGGGTCGGG - Exonic
1166547057 19:43639910-43639932 GGGCGGGGCCGGGGAGGGGAGGG + Intergenic
1166679306 19:44757476-44757498 GGGCGGGGCCAGTGTGGGGCTGG + Intronic
1166695126 19:44847706-44847728 TCGCCGAGCCAGGGAGGGGCGGG + Intronic
1166734153 19:45074949-45074971 GGGTTGGGCCAGGGAGGGTCTGG - Intronic
1166780595 19:45340719-45340741 GGGCGGCTCCTCCGAGGGGCGGG - Intronic
1166780717 19:45341050-45341072 GGGCGGGGCCTGGGAGGGAGAGG + Intronic
1166835945 19:45668157-45668179 GGGCGGGGCCAAGGCGGGACAGG - Intergenic
1167008239 19:46788798-46788820 GGGCGGGGCCAGGAAGGGGCGGG + Intergenic
1167040605 19:47020781-47020803 GGGCGGCGCGGGGGAGGCGGCGG + Intronic
1167072981 19:47231243-47231265 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
1167080754 19:47274856-47274878 GGGCGGGGCCTGGTGGGGGCGGG + Exonic
1167245918 19:48373193-48373215 GGGCTGTGGCAGGGAGGGGCAGG + Intronic
1167251339 19:48399881-48399903 GGGCGGGGCCAGCGAGGGGCGGG + Intronic
1167270091 19:48501604-48501626 GGGCGGGGTCAGGGCGTGGCTGG - Intronic
1167291128 19:48625825-48625847 TGGCAGGGGCAGGGAGGGGCAGG - Intronic
1167310924 19:48737565-48737587 GGGCGGAGCCGCTGAGGGGCCGG - Intronic
1167391848 19:49200477-49200499 GGGTGGGGCCAGGGAGGGAGTGG + Intronic
1167661061 19:50796452-50796474 GGGCAAGGCCTGGGAGGGGCGGG - Intergenic
1167706263 19:51082937-51082959 GGGCGGCGGGAGGTGGGGGCAGG - Intronic
1167889348 19:52527520-52527542 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1167940563 19:52942710-52942732 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1167943060 19:52962932-52962954 GGGCGGGGCCTGGGCGAGGCCGG + Intergenic
1168002940 19:53463532-53463554 GGGCGGGGCCTGGAGGGGGCGGG + Intergenic
1168230387 19:55027276-55027298 GGGCGGCGCCAGAGGTGGGAAGG - Intronic
1168303304 19:55419393-55419415 GGGTGGTGCCAGGAACGGGCAGG + Intergenic
1168347025 19:55654930-55654952 GGGCGGAGCCCGGGCGGGGCGGG + Intronic
1168465157 19:56595595-56595617 GGCCGGGGCCAGGGAGGGAGAGG + Intronic
1168663060 19:58182915-58182937 GGGCGGGGACAGGGAGGGCGGGG - Intergenic
1202691975 1_KI270712v1_random:99648-99670 GGGCAGGGCCAGGGCAGGGCAGG + Intergenic
924987999 2:288495-288517 GGGTGGCGCCGGGCAGGTGCGGG - Intronic
924991990 2:320184-320206 TGGTGACTCCAGGGAGGGGCTGG + Intergenic
925069617 2:956225-956247 GGGCGGGGCAGGGGTGGGGCAGG - Intronic
925069625 2:956241-956263 GGGAGGCGCAGGGGCGGGGCGGG - Intronic
925730705 2:6917882-6917904 GGGCGCCGCCTGCGAGAGGCAGG - Intronic
925919260 2:8627982-8628004 GGGTGGAACCAGGGTGGGGCAGG - Intergenic
926130916 2:10302771-10302793 GGGCGGGGCCCGGAGGGGGCGGG + Intergenic
926422933 2:12716835-12716857 GGGCGGGGGCGGGGCGGGGCCGG + Intergenic
927199999 2:20572153-20572175 GGGCGGCCCAGGGGAGAGGCTGG + Intronic
927679775 2:25131922-25131944 GGGCCGGGCCGGGGCGGGGCGGG + Intronic
927708511 2:25311394-25311416 GGGCGGCTCCCTGGAGGTGCTGG + Intronic
928093430 2:28390460-28390482 CGGCGGCGCCTGGCCGGGGCTGG + Intergenic
928149143 2:28810697-28810719 GGCGGGGGGCAGGGAGGGGCGGG + Intronic
928278311 2:29921642-29921664 GGGCGGGGCCCGGAGGGGGCGGG + Intergenic
929075484 2:38076218-38076240 GGGCGGGGCCTGCGGGGGGCGGG + Intronic
929188626 2:39120534-39120556 GCGCGGCGCCCGGAGGGGGCCGG - Intronic
929453857 2:42053176-42053198 GGGTGGGGACAGGGAAGGGCTGG - Intronic
929557833 2:42936636-42936658 AGGCTGCCCCAGGCAGGGGCAGG - Intergenic
929574061 2:43041332-43041354 GGAAGGTGGCAGGGAGGGGCTGG - Intergenic
930177311 2:48314511-48314533 GGGCGGGAACCGGGAGGGGCCGG + Intergenic
931283916 2:60816992-60817014 GGGCGGGGCCAGGGGGGAGGAGG - Intergenic
931291955 2:60881413-60881435 GCGCGGGGACAGGCAGGGGCGGG + Intergenic
931321378 2:61177383-61177405 GCGCCGCGGCAGGGCGGGGCGGG + Intergenic
931348829 2:61470819-61470841 GGGCGGCGGCGGGGACGGGGCGG + Intergenic
932434382 2:71694658-71694680 GGGCGTCTCCAAGGAGAGGCTGG - Intergenic
932469333 2:71943732-71943754 GGGCGGTGTCAGTGAGAGGCAGG - Intergenic
932494181 2:72138364-72138386 GGGCGGCGTCAGGGCGGGCTGGG + Intronic
932592952 2:73078130-73078152 GGGCTGTGCCAGGGAAGGGGAGG + Intronic
932599386 2:73113138-73113160 GGGCGCCCCCAGCCAGGGGCGGG - Intronic
932812423 2:74835617-74835639 GGCCGGGGCCGGGGACGGGCAGG + Intronic
932820706 2:74897498-74897520 CGGCGGCGGCGGGGAGGGGGAGG - Intergenic
934059924 2:88284109-88284131 AGGCGCCCCCAGGGAGTGGCTGG - Intergenic
934323232 2:91984835-91984857 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
934461546 2:94215626-94215648 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
934638295 2:96010485-96010507 GGGCGGGCCCAGTGCGGGGCGGG - Intergenic
934710513 2:96511157-96511179 GGGCCGTGCCGTGGAGGGGCTGG + Intergenic
934746470 2:96762744-96762766 GGGTGGAGTCAGGAAGGGGCTGG + Intronic
934795358 2:97094925-97094947 GGGCGGGCCCAGTGCGGGGCGGG + Intergenic
935249958 2:101252711-101252733 GGGCGGGGCCCGGGAAGGGAGGG - Intronic
935563656 2:104584326-104584348 GGGGGGCGGCGGGGAGGGGGAGG + Intergenic
935692588 2:105744780-105744802 GGGCGGCGTCACGGCGCGGCCGG + Intergenic
936234609 2:110732480-110732502 GGGCGGGGCCGGGGAGGGAGGGG + Intergenic
937203738 2:120223053-120223075 GGGCGGGGCCCGGGAGGCGGCGG - Exonic
937271273 2:120654575-120654597 GGGCGGGGCCTGGGCGAGGCCGG + Intergenic
937439845 2:121906339-121906361 AGGCAGCGGCAGGGTGGGGCGGG - Intergenic
937869358 2:126776698-126776720 GGGCGGGGCCAGGGCGGGGCCGG - Intergenic
937869370 2:126776720-126776742 GGGCGGGGCCTGGGCGGGGCTGG - Intergenic
937956169 2:127422846-127422868 GGGGCGCGCCCGGGTGGGGCAGG - Intronic
938080927 2:128369750-128369772 CGGCAGGGCCTGGGAGGGGCAGG + Intergenic
938340248 2:130531369-130531391 GGGCAGCCCCAGGGTGGGCCGGG + Intergenic
938349588 2:130589379-130589401 GGGCAGCCCCAGGGTGGGCCGGG - Intergenic
938949583 2:136244246-136244268 GGGGGCCCCCAGGGAGGGCCGGG + Intergenic
939612958 2:144332353-144332375 GGCGGGCGCCGGGGAGGGGAGGG + Intronic
939990716 2:148875351-148875373 GGGGGGCGCTGGGCAGGGGCGGG + Exonic
940145666 2:150542481-150542503 GGGGGGGGCCGGGGAGAGGCGGG + Intergenic
940372948 2:152922920-152922942 GGGCAGGGGCAGGGAGGGGAAGG - Intergenic
941029197 2:160493017-160493039 TGGCCGGGCCAGGAAGGGGCTGG + Intronic
941274021 2:163467427-163467449 GGGCAGCGCAAGGGCAGGGCGGG + Intergenic
941978935 2:171434153-171434175 GGGCCGCGGCAGGCAGAGGCAGG + Intronic
942471900 2:176269382-176269404 GGACGGCGCGGGGGCGGGGCCGG + Intronic
943597928 2:189879642-189879664 GAGCGGCGACAGGGAAGCGCTGG + Intronic
946163092 2:217847882-217847904 GGGAGGATCCAGAGAGGGGCTGG + Exonic
946185495 2:217978558-217978580 GGGCGGGGGCAGGGGCGGGCTGG - Intronic
946310348 2:218879641-218879663 AGGTGGGGCCAGGGAGGGCCAGG + Intergenic
946394289 2:219435381-219435403 GGGCCGCGCCCGGCAGGGGCGGG + Intronic
946395528 2:219442101-219442123 GGGCGGCGCCGGGAGGGGGCAGG + Intronic
946396417 2:219445753-219445775 GGGCTGGGAAAGGGAGGGGCTGG + Intronic
946416719 2:219543603-219543625 GGGCGGGACCGGGGAGGGGGCGG + Exonic
946725357 2:222656412-222656434 GGGGCGCGTCAGGGAGGGGGTGG + Intergenic
946865667 2:224039337-224039359 CGGGGGCGGCAGGAAGGGGCGGG - Intergenic
947399135 2:229714609-229714631 GGGCGGGGCGAGCGGGGGGCGGG + Intergenic
947749261 2:232524223-232524245 GGGCCGGGCCAGGGCTGGGCTGG - Intronic
947860493 2:233354471-233354493 GGGCGGGGGCGGGGCGGGGCCGG - Intergenic
948024310 2:234764913-234764935 GGGAGGCCCAGGGGAGGGGCTGG - Intergenic
948362817 2:237434882-237434904 GGGCGGAGCTAGGGAAGGGGTGG - Intergenic
948617906 2:239213218-239213240 AGTAGGGGCCAGGGAGGGGCGGG + Intronic
948678402 2:239612424-239612446 GGTTGGCTCCAGGGAGGTGCCGG + Intergenic
948827115 2:240578186-240578208 GGGCGGCACCTGGCAGGTGCTGG - Exonic
948910245 2:240999070-240999092 GCGGGGCGCCCGGGAGGGGAGGG + Intronic
948940094 2:241191106-241191128 GGACGGCTTCAGGGTGGGGCGGG + Intronic
948991740 2:241559091-241559113 GGGCGGCCCCGGGCCGGGGCGGG + Intronic
949035214 2:241813047-241813069 GGGGAGCGGCAGGAAGGGGCCGG + Intronic
1168769769 20:407975-407997 GGGCGGGGCCGGGGTGGGCCGGG - Intronic
1168769803 20:408026-408048 GGGCGGGGCCGGGGCGGGGCCGG - Intronic
1168790302 20:571883-571905 GGGTGGGGCGAGGGCGGGGCGGG - Intergenic
1169278614 20:4249317-4249339 GGGCAGCGCCAGGAAGGAGGAGG + Intergenic
1170226287 20:13995277-13995299 GGGCGGAGCCAGGGAGCGAGGGG - Intronic
1170226295 20:13995298-13995320 GGGCGGAGCCAGGGAGCGAGGGG - Intronic
1171175892 20:23050489-23050511 CTGCGGCGCCGGGTAGGGGCGGG + Intergenic
1171208947 20:23302416-23302438 GGGGGGCGGCAGGGAGGGGGAGG - Intergenic
1171223200 20:23420479-23420501 GGGCCCCGCCGGGGAGGGGGCGG - Intronic
1171256196 20:23690651-23690673 GGGGGCTGCCAGGGTGGGGCGGG - Intergenic
1171278786 20:23879799-23879821 GGGCGGGGCCAGGGAGCAGGTGG - Intergenic
1171480825 20:25454518-25454540 GGGTGGCCCCAGGGAGGGACTGG + Intronic
1172252545 20:33490050-33490072 GGGCGGGGCCAGCCGGGGGCGGG + Intergenic
1172275791 20:33678359-33678381 GGGAGGCACCAGGGAGGGTAGGG + Intronic
1172295943 20:33811356-33811378 CTGCGGCGGCAGGGAGCGGCGGG + Exonic
1172439614 20:34956135-34956157 TGGAGGCCCCAAGGAGGGGCAGG + Intergenic
1173852399 20:46227450-46227472 GGGCGGGGCCAGGGGCGGGGCGG - Intronic
1173873295 20:46355001-46355023 GGGCGGAGGCAGGGCAGGGCCGG - Intronic
1174467999 20:50731893-50731915 GGCCGGGGCCTGGGAGAGGCCGG + Intronic
1174504709 20:51009741-51009763 GGGCCGCGACAGCGAGGGCCCGG - Exonic
1175237565 20:57525190-57525212 GGGCGGAGCCAGGCAGGGTTGGG + Intronic
1175265853 20:57703214-57703236 GGGGAGGGCCGGGGAGGGGCCGG - Intronic
1175314741 20:58039536-58039558 GGACGGACCCAGGGAGGGCCTGG + Intergenic
1175720048 20:61280361-61280383 GGGAGGCGCCAGAGAGGGATTGG - Intronic
1175736014 20:61387851-61387873 GGGCGGGGCCAGAGGGGGGTGGG - Intronic
1175871128 20:62210046-62210068 GGGCTGGAGCAGGGAGGGGCAGG - Intergenic
1175873829 20:62220347-62220369 GGGCGGGGGCGGGGAGGGGGCGG - Intergenic
1175939447 20:62531318-62531340 GGGCAGGCTCAGGGAGGGGCAGG - Intergenic
1175939453 20:62531334-62531356 GGGCAGGCTCAGGGAGGGGCAGG - Intergenic
1175997064 20:62816691-62816713 GGCCGCCTTCAGGGAGGGGCAGG - Intronic
1176042228 20:63071962-63071984 GGGCGGGGGCGGGGAGGAGCGGG - Intergenic
1176098880 20:63356145-63356167 GGACAGGGCCAGGGTGGGGCAGG + Intronic
1176098935 20:63356275-63356297 GGGCAGGGCCAGGGTGGGGCAGG + Intronic
1176129023 20:63488438-63488460 GGGCGGCGTGTGGGCGGGGCCGG + Intronic
1176129223 20:63489203-63489225 GGAGGGCGCCAGAGCGGGGCTGG + Intronic
1176131777 20:63499332-63499354 AGGCGGCGGGAGGGAGGGACCGG + Intergenic
1176131835 20:63499538-63499560 GAGCAGGGCCGGGGAGGGGCCGG - Intergenic
1176132448 20:63502048-63502070 GGGAGGCGGCAAGGAGGGGCGGG - Intergenic
1176179331 20:63742068-63742090 GGCGGCCCCCAGGGAGGGGCGGG + Intronic
1176213707 20:63938640-63938662 GGGCGGGGCCAGCGCGGGGGCGG + Intergenic
1176257486 20:64159836-64159858 CGCCAGGGCCAGGGAGGGGCAGG - Intronic
1176286369 21:5021307-5021329 GGACGGCGGCGGGGAAGGGCAGG - Intergenic
1176858403 21:13987756-13987778 GGGTGGGGCCAGGGCAGGGCGGG - Intergenic
1176866368 21:14056995-14057017 GGGCAGTGCCAGGGCAGGGCAGG + Intergenic
1178636060 21:34305127-34305149 AAGCGGCGCCAGGGAGTGGGAGG - Intergenic
1179329937 21:40390084-40390106 GGGTGGGGCAAGGGAGAGGCTGG + Intronic
1179511869 21:41878933-41878955 GGGGGGCGCGAGGCAGGGGACGG + Intronic
1179612549 21:42561848-42561870 CAGGGGCACCAGGGAGGGGCGGG - Intronic
1179870812 21:44242168-44242190 GGACGGCGGCGGGGAAGGGCAGG + Intergenic
1179882650 21:44299997-44300019 GGGCGGGCCCGGGGCGGGGCGGG + Intergenic
1179891674 21:44338769-44338791 GGGAGGAGCCGGGGCGGGGCGGG - Intronic
1179891792 21:44339047-44339069 GGGCGGGGCGAGGGCGGAGCCGG - Intronic
1179909665 21:44441179-44441201 AGGGGGCACCAGGGAGAGGCCGG + Intronic
1179911904 21:44455281-44455303 GGGAGGGGCATGGGAGGGGCCGG - Intergenic
1179911969 21:44455461-44455483 GGGCGGGGCCTGGAGGGGGCGGG - Intergenic
1179967961 21:44817835-44817857 GGGCGGAGCCTGTCAGGGGCGGG + Intronic
1179999225 21:44987582-44987604 GGGCCACGGGAGGGAGGGGCAGG - Intergenic
1180005571 21:45018999-45019021 GGGCGGGGGCCCGGAGGGGCGGG + Intergenic
1180064285 21:45405038-45405060 GGGCGGGGCCGGGCAGGGGCCGG - Intergenic
1180101696 21:45590635-45590657 GGGCGGAGACATGAAGGGGCGGG + Intergenic
1180198647 21:46212065-46212087 GGGAGGGGACAGGGAGGGGCAGG + Intronic
1181003728 22:19999702-19999724 GGGTGGCTGGAGGGAGGGGCCGG + Intronic
1181089012 22:20459324-20459346 GGTAGGCGGCGGGGAGGGGCTGG - Intronic
1181440002 22:22930844-22930866 GACAGGAGCCAGGGAGGGGCTGG + Intergenic
1181673099 22:24435055-24435077 GGGCTGCTCCAGGGAAGGGGAGG + Intronic
1181734455 22:24870731-24870753 GGGCTGCTCCAGGGAGGCACTGG - Intronic
1182295782 22:29310734-29310756 GGTCAGTGCCAGGGTGGGGCTGG + Exonic
1182355244 22:29719909-29719931 GGCCGGCGGCGGGAAGGGGCGGG + Intergenic
1182357705 22:29729786-29729808 GGGTGGGGACAGGGTGGGGCTGG - Exonic
1182430677 22:30297188-30297210 TGGAGGGGACAGGGAGGGGCTGG + Intronic
1182825351 22:33260201-33260223 GGGAAGCGCCAGGGTGGGTCAGG - Intronic
1182972102 22:34588873-34588895 GGGAGGCGGCAGGGAGGCGGAGG - Intergenic
1183093744 22:35540451-35540473 GCGGGGCGCCGGGGTGGGGCGGG + Intergenic
1183201339 22:36387534-36387556 GGGGGGCGCCGGGGAGCGCCGGG + Intronic
1183323683 22:37180211-37180233 TGGCGGGGTCAGGCAGGGGCAGG + Exonic
1183434114 22:37783440-37783462 GGCCAGAGCTAGGGAGGGGCTGG - Intergenic
1183784473 22:40021563-40021585 GGGCGGCAACCCGGAGGGGCAGG + Exonic
1183931372 22:41237898-41237920 GCGCGGCCCCGGGGAGGAGCGGG - Exonic
1183945083 22:41320855-41320877 GGGAGGAGCCAGGAAGGGGCTGG + Intronic
1183966759 22:41446889-41446911 GGGCGGGGCCAGGGCCCGGCCGG + Exonic
1184085942 22:42264274-42264296 GGGCGGGGGCAGGGTGGGGGAGG + Intronic
1184222626 22:43110677-43110699 GGGCGGGACCCGGGCGGGGCGGG + Intergenic
1184236913 22:43187434-43187456 GGGCGGGGCAGGGGAGGGGTCGG - Intergenic
1184320295 22:43736864-43736886 GGGCGGCTGCAGCGTGGGGCTGG - Intronic
1184423089 22:44393043-44393065 TGGCGGCCCCAGGGAGGGAAGGG - Intergenic
1184523185 22:45007675-45007697 GGGCTGCGCGGGGAAGGGGCGGG + Intronic
1184557461 22:45240970-45240992 GGGCGGGGCCGGGGCGGGGAAGG - Intergenic
1184787694 22:46679883-46679905 GTGGGGCCCCAGGGAGTGGCGGG - Intergenic
1184796821 22:46737859-46737881 CGCAGGCGCCAGGGAGGGGTCGG - Intronic
1184804163 22:46781694-46781716 GGGGCAGGCCAGGGAGGGGCCGG - Intronic
1184807173 22:46802767-46802789 GGGCAGCTCATGGGAGGGGCTGG + Intronic
1184840985 22:47052343-47052365 GGGAGGCCCCTGGGAGGGGCAGG + Intronic
1184914877 22:47562566-47562588 GGGAGGCCCTCGGGAGGGGCTGG + Intergenic
1184942698 22:47780797-47780819 GGGCAGAGCCACTGAGGGGCTGG - Intergenic
1185047683 22:48537205-48537227 GGGTGGGGGCAGGGTGGGGCAGG + Intronic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185331918 22:50255771-50255793 GGGCGGCACCAGGGGCGGGTGGG - Intronic
1185336202 22:50271864-50271886 GGGAGGCGCAGGGGCGGGGCCGG - Intergenic
1185343036 22:50300015-50300037 GGGCGGCGCCGAGGAGGCGCGGG - Intronic
1185389207 22:50549735-50549757 GGGCGGGGGCGGGCAGGGGCAGG - Exonic
1185400438 22:50612885-50612907 GGGCGGGGCCGGGCAGGGGCGGG - Intronic
1185403058 22:50628207-50628229 GGGCGGGGCCGGGGGCGGGCCGG + Intergenic
949188646 3:1224254-1224276 AGGCTGAGTCAGGGAGGGGCAGG + Intronic
950041318 3:9920989-9921011 GGCCGGGGGTAGGGAGGGGCAGG + Intronic
950400963 3:12768915-12768937 GGCCGGGGCCGGGGCGGGGCGGG + Intronic
950421757 3:12903642-12903664 GGGCGGGGCCAGGCCGGGCCTGG - Intronic
950426753 3:12928460-12928482 GGCCGGCTCCAGGGTGGGGCTGG + Intronic
950543646 3:13626634-13626656 GGGTGGGACCAGGGAGGGGCGGG - Intronic
950638080 3:14330232-14330254 TAGGGGAGCCAGGGAGGGGCGGG - Intergenic
950650208 3:14402534-14402556 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
950683912 3:14603017-14603039 GGGCGGGGCCGGGGCCGGGCTGG - Intergenic
950729958 3:14948128-14948150 GGCCGGCGCAAGGGTGGGGGTGG + Intronic
951543926 3:23806899-23806921 GCGGGGCGCCACGGCGGGGCAGG - Intronic
951803882 3:26624591-26624613 GGGCGGAGCGAGGGAGTGGGGGG + Intronic
951954695 3:28241574-28241596 GGGCGGGGCCAGAAAGGCGCAGG + Exonic
952451875 3:33440413-33440435 GGGCGGGGTCGGGGCGGGGCCGG - Intronic
952905521 3:38137240-38137262 AGGCGGTGGCGGGGAGGGGCGGG - Intronic
953741791 3:45544894-45544916 GGGCTGAGCCAGGGAGGTACTGG + Intronic
953947760 3:47163969-47163991 GGGCGACGCGGGGGAGGGGAGGG + Intergenic
954004020 3:47578319-47578341 GGGCGGGGCCGGGGCGGGGCCGG - Intronic
954295886 3:49674317-49674339 GGGCGGAGCCTGGGACGGCCCGG - Exonic
954361312 3:50124282-50124304 GGCCGGGGCCAGGGCGGGGTTGG - Intergenic
954370100 3:50165798-50165820 GGGCAGCCCCAGGGAGAGGGTGG + Intronic
954615609 3:51967525-51967547 GGGAGGGGGCGGGGAGGGGCCGG - Intronic
954630713 3:52046374-52046396 GGGCAGTAGCAGGGAGGGGCAGG + Intergenic
954632676 3:52055787-52055809 GGGGGGCGTCAGGGAGTCGCGGG + Intronic
954649844 3:52154361-52154383 GGGCGCAGCCATGGCGGGGCTGG + Exonic
954659347 3:52218699-52218721 GAGCTGGGCCAGGGTGGGGCTGG - Intergenic
954673406 3:52302741-52302763 GGATGACCCCAGGGAGGGGCGGG + Intergenic
954674012 3:52305725-52305747 GGGCAGCTCAAGGAAGGGGCTGG + Intergenic
954681845 3:52350169-52350191 GGGCTGGGGCAGGCAGGGGCTGG + Intronic
954693980 3:52410481-52410503 GGGCGGCGAACGGAAGGGGCGGG + Intergenic
954795863 3:53161145-53161167 GGGCGGGGCCTGGCGGGGGCGGG + Exonic
955356656 3:58237712-58237734 GCGCGGCGCCGGGTCGGGGCGGG + Exonic
956080187 3:65549239-65549261 TGGCCGCGCCGGGGAGCGGCTGG - Intronic
956481236 3:69675788-69675810 AGGCTGCTCCTGGGAGGGGCTGG + Intergenic
956752176 3:72352221-72352243 GGGAGGTGCCAGGGATGGACAGG - Intergenic
957054780 3:75435192-75435214 GCGCGGCGGCAGAGAGGGGGCGG + Intergenic
958692149 3:97481682-97481704 GGGCGGGGCCGGGGCGGTGCGGG - Intronic
959398372 3:105869054-105869076 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
960684759 3:120285280-120285302 GGGCGGCGCCAGGGAGGGGCGGG - Intergenic
960747660 3:120908127-120908149 GGGCGGGGCAAGCTAGGGGCCGG + Exonic
961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG + Intergenic
961359407 3:126357535-126357557 GGGCGGGGCCAGGGCGGGGCGGG - Intergenic
961446216 3:126983002-126983024 GGGCGGGGCGGGGGCGGGGCCGG - Intergenic
961479700 3:127171870-127171892 GGGCTGCGCCAGGGAGGCATAGG + Intergenic
961663259 3:128481512-128481534 GGGCAGAGCCAGGGAGGGTGTGG - Intronic
961754917 3:129121831-129121853 GGGCGGAGCCGGGGGCGGGCGGG - Intronic
962322840 3:134405982-134406004 GGGGGGCGGCGGGGAGGGGAGGG + Intergenic
962932500 3:140051091-140051113 GGGAGGCCCCAAGGATGGGCAGG - Intronic
963133096 3:141876479-141876501 GGGCGGGGCCGGGGCGGGGTGGG + Intronic
964819593 3:160755604-160755626 GGGAGGTGCCTGGGAGAGGCAGG + Intronic
965574525 3:170204661-170204683 GGGGGACGACAGGGAGGGACTGG + Intergenic
966240189 3:177747564-177747586 GGGCCACCACAGGGAGGGGCAGG + Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966883345 3:184361825-184361847 GAGGGGCGCCCGGGAGGGGCGGG + Intronic
966912873 3:184569145-184569167 AGGCGGCGCGAGGGAGCGGCTGG + Intronic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
967921460 3:194617272-194617294 GGGCAGAGAGAGGGAGGGGCTGG + Intronic
967930419 3:194686733-194686755 GGGCCGAGCCTGGCAGGGGCCGG + Exonic
968063951 3:195747964-195747986 GGGCGGGGCCGGGCTGGGGCGGG - Intronic
968063976 3:195748013-195748035 GGGCGGAGCGCGGGTGGGGCGGG - Intronic
968078315 3:195829358-195829380 GGGCGCAGCCAGGGCTGGGCAGG - Intergenic
968081476 3:195849530-195849552 GGGCAGCCCCAGGCAGCGGCTGG + Intergenic
968133692 3:196207630-196207652 GGGCGGGGCCAGGGGCGGGGCGG - Intronic
968133739 3:196207727-196207749 GGGCGGGGCCAGGGGCGGGGCGG - Intronic
968185644 3:196632313-196632335 GGCCGGGGGCAGGGTGGGGCTGG - Intergenic
968454094 4:688562-688584 GGGCGGCTCCTGGGCTGGGCTGG - Intronic
968514263 4:1009800-1009822 GGGCGGGGACGGGGAGGGGGCGG - Intergenic
968514983 4:1012017-1012039 GGGCGGGGGCGGGGAGGGGCGGG + Intronic
968542082 4:1172858-1172880 GGGAGGGGACAGGGAGGGGAGGG - Intronic
968556348 4:1248210-1248232 GGGCGGGCCCAGGCAAGGGCAGG + Intronic
968556556 4:1248861-1248883 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
968583117 4:1403995-1404017 GGGCGGCGGGAGGGAAGGACAGG - Intronic
968650193 4:1757341-1757363 GGGCTGCTCCAGGCAGGGGGAGG + Intergenic
968657725 4:1785855-1785877 GACCGGCGCCAGGCAGAGGCAGG - Intergenic
968661806 4:1801756-1801778 GGGCGGCGCGGGGGTGGGGGCGG + Intronic
968674677 4:1871226-1871248 GGGCCGCGCACGGGCGGGGCGGG - Intergenic
968701518 4:2060074-2060096 GGCCGGAGCCGGGGAGGGTCCGG + Intronic
968809320 4:2792966-2792988 GGGACCCGCCGGGGAGGGGCGGG + Intergenic
968879756 4:3292952-3292974 GGGCGGGGACGGAGAGGGGCGGG - Intergenic
968913409 4:3486845-3486867 GGGCGGGGACAGGGCCGGGCAGG + Intronic
968979031 4:3836843-3836865 AGGCGGAGCCTGGGAGGGGGCGG - Intergenic
969285698 4:6200659-6200681 GGGCGGGGGCGGGGCGGGGCGGG - Intergenic
969295658 4:6269587-6269609 GGGCGGGGCGGGGGCGGGGCCGG + Intergenic
969422114 4:7103477-7103499 GGGCGGAGCCAAGGAAGGGCGGG - Intergenic
969466042 4:7357028-7357050 GGTGGGCTGCAGGGAGGGGCTGG + Intronic
969498656 4:7540195-7540217 AGGCAGGGGCAGGGAGGGGCAGG - Intronic
969651934 4:8473255-8473277 TGGCGGCCTCAGGAAGGGGCAGG - Intronic
969714399 4:8861299-8861321 ACGCGGGGCCTGGGAGGGGCGGG + Intronic
969724844 4:8912887-8912909 GGGGGGGGCCAGGGTGGGGGAGG - Intergenic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
970456126 4:16226229-16226251 GGGCGGCGCTAGGCCGTGGCGGG - Intronic
970878240 4:20897500-20897522 TGGCGGGGGGAGGGAGGGGCAGG - Intronic
971358286 4:25914095-25914117 GGGCGGGGCCAGGAAAGGGGTGG - Intronic
972290520 4:37686407-37686429 GGGCGGGGCAATGGCGGGGCGGG - Intergenic
972766852 4:42159183-42159205 GGGCGGGGGCAGGGAGGGGCAGG - Intergenic
973636211 4:52863461-52863483 GGGGGGCGCCATGGAGGGCTGGG - Intronic
973727514 4:53790874-53790896 GTGAGGCTCCAGGGAGGGGTTGG - Intronic
978189400 4:105895376-105895398 GAGGGGCGCCAGGGGCGGGCAGG - Intronic
978532613 4:109730094-109730116 CAGCGGCGCACGGGAGGGGCGGG + Intergenic
981504075 4:145481634-145481656 GGACGGCGCGGGGGAGCGGCCGG - Intronic
982845494 4:160247039-160247061 GGGCAAAGCCAGGTAGGGGCTGG + Intergenic
983217466 4:165015579-165015601 GGGCAGCGCCAGGCAGGTGTAGG - Intergenic
983842483 4:172474280-172474302 GGGTGGAGACAGGGTGGGGCCGG - Intronic
984639387 4:182144929-182144951 GGCTGGCGCGAGGGCGGGGCGGG - Intronic
984928254 4:184825646-184825668 GGGCGGCGCGGGCGCGGGGCTGG - Intronic
984928379 4:184826087-184826109 GGGCCGCGGGAGGGCGGGGCCGG - Intronic
985231797 4:187826802-187826824 GGGCAGAGCCACGGAGGGGGGGG - Intergenic
985530422 5:430784-430806 GGGCAGCTCCAGGGACGGCCAGG + Intronic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
985552785 5:541772-541794 GGGTGGGGCTGGGGAGGGGCCGG + Intergenic
985587787 5:749884-749906 GGGCCTCGCCAGGGTGGAGCTGG + Intronic
985602452 5:842351-842373 GGGCCTCGCCAGGGTGGAGCTGG + Intronic
985625404 5:982837-982859 GGGAATCTCCAGGGAGGGGCTGG + Intergenic
985666415 5:1183670-1183692 GGGCAGAGGCAGGAAGGGGCAGG + Intergenic
985764420 5:1769265-1769287 GGTCGTCGCCAGGGAGCGCCAGG - Intergenic
985769457 5:1799719-1799741 GGGCTGCGAGAGGGTGGGGCCGG - Intronic
985895479 5:2748306-2748328 CGGCGGCGCCCGGGAGGGGAGGG - Intronic
985896337 5:2751764-2751786 GGGCGGAGCAGGGGAGGGGCGGG - Intergenic
985896385 5:2751865-2751887 GGGCGGCGGGAGGGACCGGCAGG + Intergenic
985903233 5:2813552-2813574 AGGCGGTGGCAGGGAGGGCCTGG - Intergenic
986045009 5:4028308-4028330 GAGAGGCTCCAGGGAGGGGGTGG - Intergenic
986184399 5:5422625-5422647 GGGGCGAGCCAGGGCGGGGCGGG + Intronic
986184408 5:5422645-5422667 GGGGCGAGCCAGGGCGGGGCGGG + Intronic
986297108 5:6448785-6448807 AGCGGGCGCCAGGGCGGGGCCGG + Exonic
986608616 5:9546162-9546184 GGGCGGGGCAGGGGCGGGGCGGG - Intergenic
987088054 5:14487753-14487775 GGGCCGCGCCAGGGGGAGGCAGG - Exonic
987335673 5:16895919-16895941 GGGCGGGGGCAGGGAGGAGCAGG + Intronic
989379356 5:40798222-40798244 GGGCCGCGCCGGGGGCGGGCGGG + Exonic
991707264 5:69369771-69369793 GGTCGGCGCAAGCGAAGGGCGGG - Exonic
992393012 5:76346810-76346832 GGGAGGCGCCAGTGGGAGGCAGG - Intronic
993060791 5:83036449-83036471 GGGCGGGGGCAGGAAGGGGCGGG + Intergenic
993143827 5:84069682-84069704 GGGTGGCGACAGGGAAGTGCTGG + Intronic
994197415 5:96935879-96935901 GGGCGGGGCCTAGGCGGGGCCGG - Exonic
994510038 5:100690856-100690878 GGGCAGAGGAAGGGAGGGGCGGG - Intergenic
995511885 5:112918750-112918772 GGGAGGCACCAGAGAGGTGCAGG - Intronic
995787081 5:115841865-115841887 GGGCGGGGCCTGGGCGGGGCAGG - Exonic
996398736 5:123036886-123036908 GGAGGGCGCCAGGGACGGGAGGG + Intergenic
997700521 5:135894955-135894977 GGGAGGAGGCAGGGAGGGGGAGG + Intronic
997732686 5:136192589-136192611 GGGGCGCGCCATGGAGGCGCCGG - Intergenic
998310418 5:141124005-141124027 GGGCCGCCTCAGGGAGAGGCAGG - Exonic
998312858 5:141152261-141152283 GGGCCGCCTCAGGGAGAGGCAGG - Exonic
998313552 5:141158010-141158032 GGGCCGCCTCAGGGAGAGGCAGG - Intergenic
998320527 5:141225515-141225537 GGGCCGCCTCAGGGAGCGGCAGG - Exonic
998374506 5:141682029-141682051 GGGCAGCAGGAGGGAGGGGCGGG + Intronic
999281514 5:150369458-150369480 GGGAGGTGCTGGGGAGGGGCAGG + Intronic
999399334 5:151252752-151252774 GGGCGGGGCCGGGCAGGGGATGG - Intronic
1000052695 5:157575905-157575927 GGGAGGGGCCGGGGAGGAGCTGG + Intergenic
1001240730 5:170067897-170067919 GTGCTGGGGCAGGGAGGGGCAGG + Intronic
1001400326 5:171442541-171442563 GCTGGGAGCCAGGGAGGGGCTGG - Intronic
1001586196 5:172834951-172834973 GGGCTGAGGGAGGGAGGGGCGGG - Intronic
1001617855 5:173056883-173056905 GGGAGGGGCCCGGGAGGGGAGGG + Intronic
1001826676 5:174751174-174751196 GGGCGCTGCCAGGGCGGGGTCGG - Intergenic
1002000674 5:176194847-176194869 GGCGGGGGCCAGGCAGGGGCAGG + Intergenic
1002021228 5:176365602-176365624 GGGCGGCGCCGCGGCGGTGCTGG + Exonic
1002091765 5:176810419-176810441 GGGCGGCGGCTGGGAGGGGCGGG - Intergenic
1002093403 5:176817569-176817591 GGGCGGGGGTGGGGAGGGGCGGG - Intronic
1002160161 5:177310357-177310379 GGGCTGTGCTATGGAGGGGCTGG - Intronic
1002170326 5:177371060-177371082 GGGCGGGGCCGGGCCGGGGCCGG + Intronic
1002180047 5:177426655-177426677 GGGTGGCCCCCGGGAGGGGGCGG + Intronic
1002197628 5:177509858-177509880 GGGCGGGACGGGGGAGGGGCGGG - Intronic
1002253665 5:177944134-177944156 GGCGGGGGCCAGGCAGGGGCAGG - Intergenic
1002298076 5:178242213-178242235 GGGCGGAGGCAGGGGGAGGCTGG - Intronic
1002385069 5:178860309-178860331 GGGCGGCGCGAGCCAGAGGCAGG - Intronic
1002617410 5:180464369-180464391 GGGCGGGGGCAGGGAGAGTCAGG - Intergenic
1002844705 6:936274-936296 GTGCGGGGGCCGGGAGGGGCTGG - Intergenic
1003112079 6:3259013-3259035 GTGGGGCGGCATGGAGGGGCTGG + Exonic
1003218436 6:4135786-4135808 GGGCGGGGCCAGGGTTGGGGCGG + Intergenic
1003396830 6:5760624-5760646 GGGATGCGGCAGGGAGGGGTGGG - Intronic
1003874007 6:10421336-10421358 GGGCCGAGCCTAGGAGGGGCTGG + Intergenic
1004114127 6:12749857-12749879 GGAGGACGCCCGGGAGGGGCGGG - Intronic
1004193999 6:13487769-13487791 GGGCGGGGCCGGGGAGGAGCCGG - Intergenic
1004241310 6:13924960-13924982 CGGCGGCGCCTGGGAGGGGAGGG - Exonic
1004281357 6:14282214-14282236 CAGCGGCCCCAGTGAGGGGCCGG + Intergenic
1004395616 6:15245064-15245086 GGGCGGTGTCAGGGAGGGGTTGG - Intergenic
1005328016 6:24720891-24720913 GGGCGGTGCCGGTGAGAGGCGGG - Intergenic
1005988788 6:30890887-30890909 GGGCTGGGCCAGGGAGCAGCTGG + Intronic
1006047192 6:31308101-31308123 AGGCGGGGCCAGGGAGGGGAGGG + Intronic
1006065977 6:31462973-31462995 GGGCGGTGCCTGGGATGGGCCGG + Intergenic
1006084776 6:31587874-31587896 GGGGGGAGCCCGGGAGGGCCCGG + Intronic
1006112682 6:31758196-31758218 GGACTGCGGCAGGGAGCGGCAGG - Exonic
1006259226 6:32854128-32854150 TGGCGGCGCCGCGAAGGGGCGGG + Intronic
1006337503 6:33428119-33428141 GGGCGGTGCGAGGTAAGGGCGGG + Intronic
1006437585 6:34034209-34034231 GAGAGGAGCCTGGGAGGGGCAGG - Intronic
1006447943 6:34090442-34090464 GGGTGGCCCAAGGGAGGGGCTGG + Intronic
1006448560 6:34092937-34092959 GGGTGGCGCCCTGGAGGGGAGGG - Intronic
1006912983 6:37576084-37576106 GGGCTGGGCCAGGCTGGGGCTGG + Intergenic
1007154141 6:39725497-39725519 GGGCGGGGCTAGGGAGGGGAGGG + Intergenic
1007323178 6:41041491-41041513 GGATGGGGGCAGGGAGGGGCAGG + Intronic
1007390185 6:41546348-41546370 GGGCGGCGCGCGGGCGGGGCGGG - Intergenic
1007478310 6:42133820-42133842 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007479026 6:42137813-42137835 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007665328 6:43510041-43510063 GGGCGGCGCTGGGGCGGGGGCGG + Exonic
1007918694 6:45586552-45586574 GGGGGCCACCAGGGAGGGGCGGG + Intronic
1008278279 6:49566036-49566058 GGGAGACTCCAGGGAGTGGCTGG + Intergenic
1008760403 6:54846723-54846745 GGGCGCGGGCAGGGAGGGGAGGG - Intergenic
1010032957 6:71289044-71289066 GGGCGGCGGCAGCGAGGGCCCGG + Exonic
1011099825 6:83708845-83708867 GGGCGGCGCCGCTCAGGGGCGGG - Intronic
1011394501 6:86891896-86891918 GGGCAAAGCCAGGTAGGGGCTGG - Intergenic
1011443022 6:87407934-87407956 GGGCGGGGCCAGGTGGGGGTGGG - Intergenic
1012997961 6:105992564-105992586 AGTGAGCGCCAGGGAGGGGCGGG + Intergenic
1013117538 6:107114676-107114698 GGGCGCCGCGATGGAGCGGCCGG - Intronic
1013459017 6:110358009-110358031 GGGCGCCGCCGGGGGGCGGCGGG - Exonic
1013589084 6:111605232-111605254 GGGCGGCTGCGGAGAGGGGCCGG + Intronic
1014230370 6:118895259-118895281 GGCCGGCGCCCGGGATGCGCCGG + Intronic
1015626373 6:135183172-135183194 GGGAGGCGGCTGGGAGGGGCGGG + Intronic
1016396773 6:143632074-143632096 AGTCAGGGCCAGGGAGGGGCAGG - Intronic
1016454561 6:144216824-144216846 GGGAGGCGGCCGGGAGGGGGAGG + Intergenic
1016924905 6:149335008-149335030 GGGAGGCGGAAGGGAGGGGTGGG - Intronic
1017163799 6:151390343-151390365 GGACGGGGACAGGGAGGGGGCGG - Intronic
1018156631 6:160991650-160991672 AGACGGCGGCAGGGAGGGGCGGG - Intergenic
1018856522 6:167678979-167679001 CGGAGGAGCCCGGGAGGGGCTGG - Intergenic
1018876649 6:167827290-167827312 CGGCGGCGGGGGGGAGGGGCGGG - Intronic
1018909676 6:168094879-168094901 GGGTTGCGCGAGGGAGGGGCCGG - Intergenic
1018918144 6:168150745-168150767 GGCGGGAGCCAGGCAGGGGCAGG + Intergenic
1018947422 6:168357131-168357153 GGGCGGCCCCAGGCAGGTGTGGG + Intergenic
1018947671 6:168357955-168357977 GGGCGGCCCCAGGCAGGTGTGGG + Intergenic
1018947709 6:168358065-168358087 GGGCGGCCCCAGGCAGGTGTGGG + Intergenic
1018947860 6:168358559-168358581 GGGCGGCCCCAGGCAGGTGTGGG + Intergenic
1018947898 6:168358669-168358691 GGGCGGCCCCAGGCAGGTGTGGG + Intergenic
1019261082 7:82363-82385 GGCCCGCGCCAGGGAGGAGGCGG - Intergenic
1019284635 7:217389-217411 GGGGGGCACCCGGGAGGGGCTGG - Intronic
1019284688 7:217585-217607 GGGCGGCCCTAGAGAGGTGCCGG + Intronic
1019415877 7:926337-926359 GGGGGGCGCTGGGGTGGGGCTGG - Intronic
1019450788 7:1096782-1096804 GTGCGGGGCCTGGGAAGGGCGGG - Intronic
1019474641 7:1238203-1238225 GGGCGGCTGCGGGCAGGGGCGGG - Intergenic
1019475313 7:1241507-1241529 GGGGTGCGCCAGGGAGCCGCTGG - Intergenic
1019501995 7:1369247-1369269 GGGCGGGGTCCGGGATGGGCCGG - Intergenic
1019502020 7:1369312-1369334 GGGCGGGGTCAGGGATGGGCCGG - Intergenic
1019502026 7:1369328-1369350 GGGCGGGGCTAGGGACGGGCGGG - Intergenic
1019522982 7:1468906-1468928 GGGCTGCCCCAGGGTGGGGCTGG - Intergenic
1019542140 7:1556245-1556267 GGGCTGTGCCAGGCTGGGGCGGG + Exonic
1019562602 7:1665978-1666000 GGGCGGGCTCCGGGAGGGGCCGG + Intergenic
1019614588 7:1953389-1953411 GGCCCCCGCCAGGGAGGAGCAGG + Intronic
1019701431 7:2476496-2476518 GGGGAGCGCCGGGGTGGGGCTGG + Intronic
1019712092 7:2522439-2522461 TGGCTGCTCCTGGGAGGGGCGGG - Intronic
1019776960 7:2917529-2917551 GGGCGGGGGCAGGCAGGGGCAGG + Intronic
1019828358 7:3301693-3301715 GCGCGGCGCCAGCGAGGGGCGGG - Exonic
1019920134 7:4158071-4158093 GGGTGGCTCCAGTGAGGGGTTGG + Intronic
1019999144 7:4745066-4745088 GGGAGGTGGCAGGGAAGGGCAGG - Intronic
1020007962 7:4792309-4792331 GGGCGGAGCCAGAGTGGGGAGGG - Intronic
1020107789 7:5430182-5430204 GGGAGCCGGCAGGGAGGGGGTGG - Intergenic
1020256055 7:6503714-6503736 GGGCGGGGCCGGAGCGGGGCCGG + Intronic
1021162911 7:17298586-17298608 GGGCGGGGCCGGTGAGGGGTCGG + Intergenic
1022207801 7:28180347-28180369 GGGAGGCGGCAGGGCGGGGAGGG - Intronic
1022973484 7:35537298-35537320 GGCCCGCGGCAGGGCGGGGCGGG + Intergenic
1023287119 7:38631445-38631467 GGGCCGAGCAAGGGAGGAGCGGG + Exonic
1023638666 7:42237465-42237487 AGGCGGTGCCAGGTCGGGGCGGG - Intronic
1023703812 7:42918576-42918598 GGAAGGAGCTAGGGAGGGGCTGG - Intronic
1023777775 7:43625600-43625622 GGGAGGTGCCAGGAAGTGGCAGG - Exonic
1023881912 7:44325535-44325557 TCGCGGCGCCAGGCGGGGGCCGG + Intronic
1023937106 7:44748364-44748386 GGGCGGGGCGCGGGCGGGGCGGG + Intergenic
1023980739 7:45068637-45068659 GGGTGTGGCCAGGGTGGGGCTGG - Intronic
1024074147 7:45810287-45810309 GGCCGCCGACAGGCAGGGGCTGG - Intergenic
1024600234 7:50974076-50974098 GGGCTGAGCCTGGGAGGGGAAGG + Intergenic
1025131367 7:56375714-56375736 GGCCGCCGACAGGCAGGGGCTGG + Intergenic
1025181600 7:56826322-56826344 GGGCGCCAACAGGCAGGGGCTGG + Intronic
1025185613 7:56855997-56856019 GGGAGGAGCCAGGGAGTTGCTGG - Intergenic
1025615820 7:63114848-63114870 GGGCGGCCCCATGGAGGGGCCGG + Intergenic
1025686316 7:63720953-63720975 GGGAGGAGCCAGGGAGTTGCTGG + Intergenic
1025829555 7:65038027-65038049 GGGCGGGGCAGGGTAGGGGCGGG - Intergenic
1025916779 7:65872945-65872967 GGGCGGAGCCAGAGAGGGGCGGG - Intergenic
1026019796 7:66698043-66698065 GGGCAGCGGGAGGGAGTGGCTGG - Intronic
1026765802 7:73158787-73158809 GGGTGGAGTCAGGGAAGGGCTGG + Intergenic
1026833724 7:73624606-73624628 GGGCGGGGCCTGGGACGGGGCGG + Intergenic
1026850378 7:73719752-73719774 GGGCGGGGCCCGGGCGGGGTGGG - Intergenic
1026853632 7:73739253-73739275 GAGCGGCGCCAGGGTGGCTCTGG + Intergenic
1026877616 7:73888390-73888412 GGGCAGGGGGAGGGAGGGGCAGG + Intergenic
1026941254 7:74289359-74289381 GGGCGGGGCCTGGGGCGGGCGGG - Intergenic
1027042276 7:74968484-74968506 GGGTGGAGTCAGGGAAGGGCTGG + Intronic
1027081366 7:75233874-75233896 GGGTGGAGTCAGGGAAGGGCTGG - Intergenic
1027230216 7:76267944-76267966 GGGCTGAGGGAGGGAGGGGCTGG - Intronic
1028700910 7:93778325-93778347 AGGTGGCGACATGGAGGGGCTGG - Intronic
1029110553 7:98211372-98211394 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1029123025 7:98281288-98281310 GGGCGGGGCCTGAGAGGGGGCGG - Intronic
1029178983 7:98685734-98685756 GGGCAGCTGCAGGGAAGGGCGGG + Intergenic
1029374299 7:100168588-100168610 GGGCGGTGGCTGGGATGGGCGGG - Exonic
1029374860 7:100171480-100171502 GGACCGCGGCCGGGAGGGGCGGG - Intronic
1029381812 7:100220034-100220056 TGCCGGCACCAGAGAGGGGCAGG + Intronic
1029389952 7:100268475-100268497 GGGTGGAGTCAGGGAAGGGCTGG - Intronic
1029401979 7:100352484-100352506 TGCCGGCACCAGAGAGGGGCAGG + Intronic
1029440505 7:100584432-100584454 GGGCGGGAGCTGGGAGGGGCCGG + Intronic
1029440910 7:100586156-100586178 CGGCGGCTCCAAGGAGGGGGTGG - Intronic
1029708333 7:102286817-102286839 GGGCGGGGGCGGGGCGGGGCCGG + Intronic
1030033463 7:105388976-105388998 GGGCGGGGCGGGGGCGGGGCCGG - Intronic
1030980671 7:116182080-116182102 GGGGGGAGGCAGGGAGGGTCAGG + Intergenic
1032241439 7:130162351-130162373 TGGCGGGGGCCGGGAGGGGCTGG - Intergenic
1033230790 7:139595897-139595919 GCGCTGGGCCTGGGAGGGGCAGG + Intronic
1033273866 7:139956645-139956667 GGGCGGAGCCAGTGAGGTGACGG - Intronic
1034344707 7:150379246-150379268 GGGCGGCCCCGGGGATGGCCAGG + Intronic
1034392786 7:150799984-150800006 GGACGGGGCCAGGGAGCGGCGGG - Intronic
1034425311 7:151010853-151010875 GTGAGGGGCCAGAGAGGGGCCGG - Intronic
1034441053 7:151086345-151086367 GGCCGGCGCGCAGGAGGGGCGGG + Intronic
1034561928 7:151885887-151885909 CGGCAGGGGCAGGGAGGGGCTGG + Intergenic
1034964180 7:155381628-155381650 GCGCGGCCCCAGGGAGAGGGGGG + Intergenic
1035153401 7:156893211-156893233 GGGCGGGGCGGGGGCGGGGCAGG + Exonic
1035311929 7:157974988-157975010 GGGCAGGGCTAGTGAGGGGCTGG + Intronic
1035404254 7:158587829-158587851 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1035543427 8:459653-459675 GGGCTGCCACAGGAAGGGGCTGG + Intronic
1035553089 8:544871-544893 GGGCGGGGCTAGGCGGGGGCGGG + Intronic
1035735212 8:1882661-1882683 GGACGGCACCAAGGACGGGCTGG + Exonic
1036827215 8:11986784-11986806 GGGCAAAGCCAGGTAGGGGCTGG - Intergenic
1036950310 8:13133490-13133512 AGGCGGGGCCTGGGCGGGGCGGG - Intronic
1037609816 8:20466585-20466607 GGACACAGCCAGGGAGGGGCAGG - Intergenic
1037765362 8:21769239-21769261 GGGCGGGGCTGGGGCGGGGCTGG - Intronic
1037906729 8:22719782-22719804 GGGGAAGGCCAGGGAGGGGCAGG + Intronic
1038314046 8:26467536-26467558 GGGAGGCACCAGGGTGGGTCAGG - Intronic
1038540482 8:28386276-28386298 GGGCGCCGGCTGGCAGGGGCTGG - Intronic
1038734403 8:30156268-30156290 GGGCGGAGCCGGGGTGGGGCGGG - Intronic
1039887573 8:41663916-41663938 GGGCGGCGCCCCTGAGGGTCTGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1041044991 8:53880395-53880417 AGGCTGCGCCGGGGTGGGGCGGG + Intronic
1041552849 8:59119820-59119842 GGGTGGGGCCGGGGAGGGCCGGG - Intergenic
1041702513 8:60806896-60806918 GGGAGGTGGTAGGGAGGGGCAGG + Intronic
1043885224 8:85591639-85591661 GGGAGGGGCGGGGGAGGGGCAGG - Intergenic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1045017195 8:98010117-98010139 AGGCGGCTTCAGGGAGGGCCTGG - Intronic
1045240117 8:100393008-100393030 GGATGGAGGCAGGGAGGGGCAGG - Intronic
1045246442 8:100445493-100445515 GGCCTGGGCCAGGGAGGGGTGGG + Intergenic
1046094366 8:109539898-109539920 GGGCGGGGAGGGGGAGGGGCAGG + Intronic
1046659890 8:116938155-116938177 GGGCGGGGTCAGGGCGGGGGCGG - Intergenic
1047634384 8:126744406-126744428 GGGCAAAGCCAGGGAAGGGCTGG + Intergenic
1048261222 8:132946823-132946845 GGTAGGGGCCAGGGAGAGGCTGG - Intronic
1048304332 8:133273071-133273093 GGGCAGCACCAGGGCCGGGCAGG - Intronic
1049072229 8:140365026-140365048 TGGGGGAGCCAGGGAGGGACAGG + Intronic
1049106485 8:140616936-140616958 GAGCGGGGCCAGGGATGGACAGG - Intronic
1049199531 8:141333261-141333283 TGGAGGCGGGAGGGAGGGGCTGG + Intergenic
1049228120 8:141467364-141467386 GGGCTGGGCCAGGAAGGGCCAGG - Intergenic
1049411515 8:142475784-142475806 GGGCGGGACCAGGTAGGGGCGGG + Intronic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049509093 8:143018755-143018777 GGGAGGCGCAGGAGAGGGGCTGG + Intronic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1049580345 8:143408037-143408059 GGGCCGTGGCAGGAAGGGGCAGG - Intergenic
1049584955 8:143428741-143428763 GGGAGGGGGCAGGCAGGGGCCGG + Exonic
1049693680 8:143973567-143973589 GGGCGGGGCGGGGGCGGGGCGGG - Intronic
1049745429 8:144261230-144261252 GGGCGGCGTGGGGGTGGGGCAGG - Intronic
1049755489 8:144309645-144309667 GGGAGCCCTCAGGGAGGGGCGGG - Intronic
1049762618 8:144337961-144337983 GGGCGGCCCCGGGGAGCGTCCGG + Intergenic
1049775300 8:144401174-144401196 GGGCGGGGCCTGGGCGGGGGCGG + Intronic
1049778067 8:144415529-144415551 CTGTGGCTCCAGGGAGGGGCGGG - Intronic
1049791091 8:144473051-144473073 GGTGGGCGCCGGGGCGGGGCAGG + Exonic
1049812151 8:144580398-144580420 GGGCTGGGCCAGTGAGGGGCAGG + Intronic
1049830766 8:144699614-144699636 GCTCGGCGGCAGGGCGGGGCGGG + Intergenic
1049879447 8:145052257-145052279 GGGCGGGGCGCGGGCGGGGCGGG - Intergenic
1049879460 8:145052284-145052306 GGGCGGGGCGCGGGCGGGGCGGG - Intergenic
1052799733 9:32956220-32956242 GGGCTGCGCCCGGGAGGGTCCGG - Intergenic
1053180270 9:35962399-35962421 GGGCGGGGGCAGGGATGGGGCGG - Intergenic
1053181258 9:35972266-35972288 GGGCGGCGTGGGGGAGCGGCGGG + Intergenic
1053185479 9:36012775-36012797 GGAGGGAGCCAGGGAGAGGCTGG - Intergenic
1053411524 9:37919010-37919032 GGCAGGCCCCAGGGAGGGGAGGG - Intronic
1053462743 9:38283042-38283064 GGGCTGCGCAAGGCAGAGGCAGG + Intergenic
1053584558 9:39443292-39443314 GGGGGGCGCCAGGGAGGACAGGG - Intergenic
1053692022 9:40591279-40591301 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1054106138 9:61002038-61002060 GGGGGGCGCCAGGGAGGACAGGG - Intergenic
1054272778 9:63046206-63046228 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1054303279 9:63392245-63392267 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1054402058 9:64718755-64718777 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1054435664 9:65203070-65203092 TGGCAGAGCCAGGGAAGGGCCGG - Intergenic
1054494729 9:65818617-65818639 TGGCAGAGCCAGGGAAGGGCCGG + Intergenic
1054771852 9:69090644-69090666 GGGCGGGGGCAGGGAGTGGGGGG - Intronic
1054891702 9:70258871-70258893 CGGCGGAGCGCGGGAGGGGCGGG + Intergenic
1055447142 9:76394545-76394567 GGGCGGGGCCATGATGGGGCGGG - Intergenic
1056207519 9:84334696-84334718 TGGTGGTGCTAGGGAGGGGCGGG - Intronic
1056588314 9:87944023-87944045 GGGAGGCGCCAGGGGAGGGAAGG - Intergenic
1057208187 9:93185349-93185371 CGGCGGCCCCAGGGAGGAGGCGG + Exonic
1057294323 9:93826607-93826629 GGGCGGAGGCAGGGGCGGGCGGG + Intergenic
1057340641 9:94198324-94198346 GGGCAAAGCCAGGTAGGGGCTGG + Intergenic
1057460147 9:95253790-95253812 GGGCGGGGGCAGGGATGGGGGGG + Intronic
1057562878 9:96141749-96141771 GGGCGGAGTCAGGGATGGGGTGG - Intergenic
1057773098 9:97984228-97984250 GCGCGGAGCGGGGGAGGGGCGGG + Intronic
1057797467 9:98169196-98169218 GGGCGGCGCGGGGGCGGGGAAGG - Intronic
1057882992 9:98807581-98807603 GGGCGGCGCGCAGGTGGGGCGGG + Intergenic
1058432000 9:104928071-104928093 GGGCTGCGGCAGGGCAGGGCGGG - Exonic
1058778151 9:108305843-108305865 GGGCGGGGTCGGGGGGGGGCGGG - Intergenic
1058851288 9:109013704-109013726 GGGCGGGGCCATGTGGGGGCGGG - Intergenic
1059312961 9:113401150-113401172 GGGCGGCTCCAGGGCGAGGCGGG - Intronic
1059329152 9:113524211-113524233 TGAGGGAGCCAGGGAGGGGCTGG - Intronic
1059471148 9:114505502-114505524 GGGCGGGGCCCGGGCCGGGCTGG - Intergenic
1060279233 9:122204819-122204841 GGGGGGCAGCAGGGTGGGGCAGG - Intronic
1060477607 9:123998079-123998101 GGGCGGGGCCAGGCGTGGGCAGG - Intergenic
1060483548 9:124032393-124032415 GGGGGACGACAGGGAAGGGCTGG - Intronic
1060544832 9:124453683-124453705 GGGTGGGGCCGGGGCGGGGCGGG - Intronic
1060937396 9:127523635-127523657 GGTCGGTGGGAGGGAGGGGCAGG - Intronic
1060979362 9:127783877-127783899 GGGCACTACCAGGGAGGGGCTGG - Intergenic
1061129897 9:128702906-128702928 GAGCGGCGCCATGGAGGAGGGGG + Exonic
1061264001 9:129495321-129495343 GGGTGAGGGCAGGGAGGGGCTGG - Intergenic
1061348215 9:130043283-130043305 GGGCCGGGCCGGGGTGGGGCGGG - Intergenic
1061415443 9:130444833-130444855 GAGCGGCTCCAGGCGGGGGCCGG + Intergenic
1061428760 9:130517975-130517997 GGGAGGCACCAGGGTGGGTCAGG - Intergenic
1061482991 9:130906359-130906381 GTGCGGAGCCGGGGAGAGGCAGG - Intronic
1061501929 9:131009092-131009114 GGGAGGCTGGAGGGAGGGGCGGG - Exonic
1061559580 9:131394036-131394058 GGGCGGCGGCAGGCGGGGGGCGG + Intergenic
1061613272 9:131762669-131762691 GGGTGGCTCCTGGGAGGCGCCGG - Intergenic
1061649195 9:132032789-132032811 GGGCTGTGAGAGGGAGGGGCAGG - Intronic
1061677560 9:132226980-132227002 GGGCAGCGGCAGGTAGGAGCCGG - Exonic
1061714552 9:132510494-132510516 GTGCAGTGCCAGGGAGGTGCCGG - Intronic
1061727481 9:132589628-132589650 CTGGGGCGCCAGGGAGGGCCGGG - Exonic
1061961926 9:133992847-133992869 GGGCGGGGCAGGGGCGGGGCCGG + Intergenic
1061974473 9:134061409-134061431 GAGCAGTGGCAGGGAGGGGCAGG + Intronic
1062035140 9:134379633-134379655 GGGTGGGGTCAGAGAGGGGCTGG - Intronic
1062289567 9:135788521-135788543 GGCCGGCCACAGGGAAGGGCTGG - Intronic
1062333114 9:136053170-136053192 GGGCGCCGGGAGTGAGGGGCAGG - Intronic
1062344714 9:136109450-136109472 GGGCGGAGACTGGAAGGGGCAGG - Intergenic
1062362316 9:136193770-136193792 GGGCGGCCTGGGGGAGGGGCCGG + Intergenic
1062377158 9:136267336-136267358 GGGCGGGGCTACGGCGGGGCGGG + Intergenic
1062385974 9:136311683-136311705 TGGCGCCTCCAGGGAGGGGAGGG + Intergenic
1062408645 9:136410364-136410386 GGGTGGCGCCCGGGCGGCGCTGG + Exonic
1062459501 9:136656961-136656983 GGGCGGCTCCAGCTGGGGGCCGG + Intergenic
1062479494 9:136744788-136744810 GGGAGGGGCCGGGGAGGGGCTGG + Intronic
1062489963 9:136800228-136800250 GGGCGGGGCCACCGGGGGGCGGG + Intronic
1062532858 9:137009339-137009361 GGGCAGGGCCAGGGGTGGGCTGG - Intronic
1062547572 9:137070504-137070526 GCGCGGCCCCACGGAGGGGCCGG + Exonic
1062578992 9:137221448-137221470 AGGCGGGGGCAGGGAGGGGTGGG + Intronic
1062584188 9:137241595-137241617 GCGCGGGGCGGGGGAGGGGCGGG + Intronic
1062626066 9:137441900-137441922 GCGCGGAGCCAGGGCCGGGCTGG + Intergenic
1062656206 9:137605565-137605587 GGGCAGGGCCTGGGAGGGGCCGG + Intergenic
1062656340 9:137605976-137605998 CGGCGGCGCCGGGGAGGTCCGGG + Intronic
1062696226 9:137877670-137877692 GGGCGGCCGCGGGGCGGGGCCGG + Intergenic
1062715935 9:138010080-138010102 AGGTGGCGACAGGGAGGGACCGG + Intronic
1062718739 9:138023826-138023848 GGGCGGGGTCAGGGAGGGAAGGG + Intronic
1203622685 Un_KI270749v1:137415-137437 TGGCAGAGCCAGGGAAGGGCTGG - Intergenic
1186356715 X:8799267-8799289 AGCCAGCCCCAGGGAGGGGCTGG - Intronic
1187241670 X:17519645-17519667 GGGAAGTGCCAGGAAGGGGCAGG + Intronic
1187507276 X:19887771-19887793 GGGCGGGGCCGGAGAGGGGCGGG + Intergenic
1187518199 X:19991086-19991108 GGGCGGGGCCGGGGTGGGGGCGG - Intergenic
1187547298 X:20266688-20266710 GGGCGGCGACGGAGCGGGGCCGG - Exonic
1188242642 X:27809480-27809502 GGGCGGGGCGGGGGGGGGGCCGG - Intronic
1189211629 X:39288831-39288853 GGGCAGCAGCAGGGAGGGACAGG + Intergenic
1190024669 X:46912546-46912568 GGGCGGCCCCGGCGGGGGGCGGG + Exonic
1192165396 X:68824554-68824576 GGGCAGGGACAGGGAAGGGCTGG + Intergenic
1192795229 X:74420699-74420721 GGGCCGGGCCAGGGCCGGGCCGG - Intergenic
1193450142 X:81655441-81655463 GGGCGGGACGGGGGAGGGGCGGG + Intergenic
1194614744 X:96087042-96087064 GGGCAAAGCCAGGTAGGGGCTGG - Intergenic
1195133271 X:101876162-101876184 GGGGGGTGCCGAGGAGGGGCAGG + Intergenic
1195269484 X:103215598-103215620 GGGCGGGGCGGGGGAGGGGCCGG + Intronic
1195701688 X:107710564-107710586 GGGCGGGGCCGGGGGGGGGGCGG - Intergenic
1195743693 X:108092060-108092082 AGGCGGTGGCAGGGAGGGGGAGG - Intronic
1197745948 X:129932339-129932361 GGCGGGAGCGAGGGAGGGGCGGG - Intergenic
1197766100 X:130060373-130060395 GGGCGGGGCCAGAGCGCGGCTGG + Intergenic
1198750570 X:139933095-139933117 GGGAGGGGCCTGGGTGGGGCGGG - Intronic
1199229802 X:145423606-145423628 GGGCAAAGCCAGGTAGGGGCTGG - Intergenic
1199336048 X:146620079-146620101 GGGCTCCGCCAGGGAGGGAGGGG + Intergenic
1199471275 X:148198688-148198710 GGGGGGCGGCGGGGAGGGGCGGG + Intergenic
1199600747 X:149540047-149540069 GGGGCGGGGCAGGGAGGGGCGGG - Intergenic
1199819059 X:151426676-151426698 GGAGGGAGCCAGGGAGTGGCAGG + Intergenic
1199976529 X:152897888-152897910 GGGCGGGGCCGAGAAGGGGCGGG + Intergenic
1200014460 X:153147783-153147805 AGGCAGCCCCAGGGAAGGGCTGG + Intergenic
1200025142 X:153252171-153252193 AGGCAGCCCCAGGGAAGGGCTGG - Intergenic
1200039229 X:153353729-153353751 GGGCTGGGCCAGGCCGGGGCAGG - Intronic
1200044291 X:153392870-153392892 GGGCATGGCCAGAGAGGGGCGGG - Intergenic
1200065454 X:153502354-153502376 GGGCATCGGCAAGGAGGGGCAGG + Intronic
1200117672 X:153776485-153776507 GGGCGGGGCTGGGGCGGGGCAGG + Intronic
1200122567 X:153798042-153798064 GGGAGGTGCAAGGGAGGTGCTGG - Intronic
1200126685 X:153818639-153818661 GGTCGGAGCCCGGGAGGGGAGGG + Intronic
1200209636 X:154341571-154341593 GGGCCACGAGAGGGAGGGGCCGG + Intergenic
1200221240 X:154390557-154390579 GGGCCACGAGAGGGAGGGGCCGG - Intronic
1200235239 X:154464876-154464898 GGGCGCCGCATGTGAGGGGCTGG + Intronic
1200235878 X:154467481-154467503 GGGTGGGGGCGGGGAGGGGCGGG + Intronic
1200794212 Y:7325861-7325883 GGGCCCCGCCAGGGCAGGGCAGG - Intergenic
1201189873 Y:11436942-11436964 GGGCAGGTCCAGGGAGTGGCCGG - Intergenic
1201904634 Y:19076758-19076780 GGGGGGCTCCGGGGCGGGGCTGG - Intergenic