ID: 960696554

View in Genome Browser
Species Human (GRCh38)
Location 3:120402059-120402081
Sequence CTGGAGTCCCATCTGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960696554 Original CRISPR CTGGAGTCCCATCTGGGTCC TGG (reversed) Intronic
900156403 1:1205005-1205027 CCGGAGTCCTGTCTGGGGCCTGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901172153 1:7266900-7266922 CTGCTGTGCCACCTGGGTCCTGG - Intronic
903044516 1:20554725-20554747 TGGGAGCCCCATCTTGGTCCTGG - Exonic
903322995 1:22553706-22553728 CTGGAGACCCATGTGGTTCAGGG - Intergenic
903772618 1:25773486-25773508 CTGCAGTCCCATCTCAGTCTGGG + Intronic
906731824 1:48089506-48089528 CTGGAGTTCCAGCTGGTGCCCGG + Intergenic
908030640 1:59995637-59995659 TTGGAGTCCTCTCTTGGTCCCGG + Intronic
915965983 1:160308620-160308642 CAGGAGTCTCAGCTGGATCCTGG + Intronic
917622569 1:176811775-176811797 CTAGAGTCCCATTTGGTTCAGGG + Intronic
917793197 1:178513031-178513053 CTGGACCACCATGTGGGTCCTGG + Intergenic
919880741 1:201899094-201899116 CTGAAGTCCCCTATGGGCCCTGG + Intronic
919912809 1:202122389-202122411 CTGGAGTCAGATCTGGGTTGTGG + Intergenic
919945357 1:202315256-202315278 TTGGAGTCCCACCTGGCTCTAGG - Intronic
920500385 1:206481591-206481613 CTGGAGCCCCCTCTGTGCCCTGG - Intronic
922594058 1:226799983-226800005 CCGGAGTTCCAGCTGTGTCCTGG + Intergenic
922620005 1:226983449-226983471 CTGGCTTCCCAGCTGTGTCCTGG - Intronic
924223356 1:241900869-241900891 CTGAAGTCCAAAATGGGTCCTGG - Intergenic
924548077 1:245049020-245049042 CTGCACTCCCATCTGGGTGATGG - Intronic
1062769552 10:88058-88080 CAGGTGTCACATGTGGGTCCTGG - Intergenic
1062784906 10:256234-256256 CTGGATGCCCATCTCGGTTCAGG + Intergenic
1064372201 10:14762345-14762367 CTGTAGCCCCCTCTGGGTGCAGG - Intronic
1065817475 10:29495236-29495258 CTGGAGATCCACCAGGGTCCCGG - Intronic
1066046868 10:31602764-31602786 CTGGAGCCCCAGCTGGCTCTTGG + Intergenic
1067243346 10:44515624-44515646 CTGGATGATCATCTGGGTCCAGG + Intergenic
1069021380 10:63492154-63492176 CTGTAGTCCCAGCTGCTTCCGGG - Intergenic
1069906415 10:71735111-71735133 CTGCAGTCACATCTGCTTCCAGG - Intronic
1070329776 10:75408827-75408849 CTGGTTTCCCAGCAGGGTCCGGG - Intergenic
1070751844 10:78968516-78968538 GTGGAGTGCCATCCAGGTCCTGG - Intergenic
1071601970 10:86962764-86962786 CAGGAGGCCCCTCTGGGCCCTGG - Intronic
1072740795 10:97907948-97907970 CTGGAGTCCTCTGTGGGTCTGGG + Intronic
1074425451 10:113347467-113347489 GTGGAGTGCTGTCTGGGTCCTGG + Intergenic
1075510317 10:123067067-123067089 CAGGAGTTCTATCTGGGTTCTGG - Intergenic
1076364630 10:129914132-129914154 CTGGAGTCCTCTTTGGTTCCTGG - Intronic
1076997744 11:307204-307226 CTGGAGGCCCACCTGGGTGACGG - Intergenic
1077117568 11:892164-892186 CTGGGGTCTCACCTGTGTCCCGG - Intronic
1077181346 11:1218616-1218638 AAGGAGCCCCAACTGGGTCCTGG - Intergenic
1077920880 11:6641004-6641026 CTGGAGTCCCATCTGGACCGGGG + Exonic
1079093125 11:17494498-17494520 TTGGAGACCCCTCTGGGTGCAGG + Intronic
1081591515 11:44426406-44426428 CTGGAGACCCGTCTTGCTCCAGG - Intergenic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1083527518 11:63383271-63383293 CTGGAGTCCCATTGGCATCCCGG - Intronic
1084006339 11:66325510-66325532 GTGGGGTCCCAGCTGGGCCCAGG - Intergenic
1084222755 11:67694400-67694422 CTGGAGTGGCAGCTGGGTCAGGG + Intergenic
1084595768 11:70116186-70116208 CTAGAGTCCCCTCTGTGTCGAGG + Intronic
1085181002 11:74535976-74535998 ATGGAGTCACAGCTGGCTCCAGG + Intronic
1085453869 11:76655069-76655091 CTGGAGTCCTATCTGTCCCCAGG - Intergenic
1088554248 11:111045500-111045522 CTGGATTCATATCTGAGTCCTGG - Intergenic
1088902843 11:114131535-114131557 CTGGAGGGCCATCTGGGGACAGG - Intronic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1090260111 11:125313283-125313305 CTGGAGTCCCTAATGGGGCCTGG + Intronic
1091097867 11:132840922-132840944 CTGGAGGTCCACCTGGGCCCTGG - Intronic
1091438202 12:490909-490931 CTGCAGACCCATCTGGGCCTGGG - Intronic
1092150466 12:6244728-6244750 CTGGAGTCCCCTCTATGTCCTGG - Intergenic
1093387002 12:18569296-18569318 ATGGAGTCCCAGCTGGGGACTGG - Intronic
1096665324 12:53160421-53160443 CAGCAGTGCCATCTGGCTCCAGG - Intronic
1096816635 12:54205845-54205867 CCTGAGCCCCATCTGGGGCCAGG + Intergenic
1097904212 12:64903667-64903689 CTGAAGTCATTTCTGGGTCCTGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1102472169 12:113165521-113165543 CAGGAGTGCAATCTGAGTCCTGG + Intronic
1102651300 12:114444355-114444377 CTGGAGGCCCAGCTGTGACCAGG - Intergenic
1102762078 12:115396583-115396605 CTGCAGTCCCATATGGGCCATGG - Intergenic
1103239249 12:119399284-119399306 GAGGATGCCCATCTGGGTCCTGG - Intronic
1106428447 13:29656581-29656603 CTCAAGTCCCATCTTGGGCCTGG - Intergenic
1106645499 13:31629697-31629719 CTGGAGTCCCCTCTGGTCCAGGG + Intergenic
1110241215 13:73269132-73269154 CAGGAGCACCATCTGGGTTCAGG + Intergenic
1113599361 13:111557802-111557824 CTGGATTCCCTTCTGTGTGCTGG - Intergenic
1113741408 13:112714546-112714568 CTGGAGGCCCGTCTGGCTTCTGG + Intronic
1114600861 14:23954344-23954366 CTGGTGTCCCATCTAGGTAAGGG - Intronic
1114605086 14:23989491-23989513 CTGGTGTCCCATCTAGGTAAGGG - Intronic
1114610543 14:24037056-24037078 CTGGTGTCCCATCTAGGTAAGGG - Intergenic
1114660278 14:24339343-24339365 CTGGAGTCGCACCGGGGTCGTGG + Intronic
1115834106 14:37378366-37378388 CTTGAGACCCATCTGAGTCATGG - Intronic
1118046173 14:61974037-61974059 CTGGTGTCCCATGTGGGCCTGGG + Intergenic
1118705015 14:68472282-68472304 CTTGAGTCCCAGCTGTGTTCTGG - Intronic
1119704237 14:76774120-76774142 CAGGAGTCCCATCTGAGGGCAGG + Intronic
1119886881 14:78150935-78150957 CTGGAGACCCCTGGGGGTCCAGG - Intergenic
1120937187 14:89908992-89909014 CTGGAGCACCAACTGGATCCAGG - Intronic
1121638300 14:95468422-95468444 CTGGAGGCTCAGCTGGGCCCTGG - Intronic
1122878551 14:104679712-104679734 CTGCAGTCCTTTCTGGGGCCTGG - Intergenic
1127144043 15:56006921-56006943 TTCGGGTTCCATCTGGGTCCTGG + Intergenic
1127485126 15:59411788-59411810 CTGTAGTCCCAGCTGAGTCTGGG + Intronic
1127503355 15:59575311-59575333 CTGGACCCTCAACTGGGTCCAGG + Intergenic
1127517263 15:59708502-59708524 CTGGGGTCCCATATGGGGCTTGG + Intergenic
1128249412 15:66153951-66153973 CTGGGTTCCAATCTGGGCCCTGG + Intronic
1129456178 15:75677174-75677196 CTGCAGTCCCAGCTGGCTGCAGG - Exonic
1129712950 15:77830385-77830407 CTGGAGTCTCATCTGTGTATGGG - Intergenic
1131391035 15:92049047-92049069 CTGGAATCAAATCTTGGTCCTGG - Intronic
1131675418 15:94666190-94666212 GTGGAGTCCCATGTGGGACATGG + Intergenic
1132710775 16:1266109-1266131 CTCGAGCCCCAGCTGAGTCCAGG + Intergenic
1132743799 16:1428553-1428575 CTGGAGTTCCCTCGGGGCCCCGG + Intergenic
1133216759 16:4297241-4297263 CTGCAGCCCCAGCTGGGACCAGG + Intergenic
1134018134 16:10903543-10903565 CTGGAGTTACATCTAGCTCCTGG - Intronic
1134095777 16:11417534-11417556 CAGGAGTGCCACCTGGGTCCAGG + Intronic
1135436287 16:22428823-22428845 CCAGAGGCCCATCTGGGCCCTGG + Intronic
1135557890 16:23452649-23452671 CGGGAGTCTCAGCTGGGTGCCGG - Intronic
1138526238 16:57608999-57609021 CTGCAGTCCCAGCTCTGTCCAGG - Intergenic
1141599826 16:85118887-85118909 CTGGTGTCCCATCTTCCTCCAGG + Intergenic
1141810661 16:86373328-86373350 CTGGGGGCCCATCTGTCTCCAGG - Intergenic
1142278975 16:89137921-89137943 ATGGAGCCCCAGCTGGGCCCTGG - Intronic
1143162625 17:4881392-4881414 CAGGAGGCCCCTCTGGGTCCAGG - Intronic
1145818862 17:27815849-27815871 ATGGACTCCCATCTGGCTACAGG + Intronic
1147120230 17:38331270-38331292 CTGGTGTCCCCTCGGGTTCCTGG + Exonic
1147887750 17:43696110-43696132 CTGGGCTCCCAGCTGGGTGCTGG - Intergenic
1148670157 17:49404287-49404309 CAGGACTCACATCTCGGTCCAGG + Exonic
1148748381 17:49931032-49931054 CTGGACTCCCTCCTGGGTCACGG - Intergenic
1150835977 17:68564768-68564790 CTGGAGTCCCATTTGCTTCCTGG + Intronic
1151225985 17:72648747-72648769 CTGGGGTCCCAGCTGGGACTGGG + Intronic
1151823811 17:76512526-76512548 CTGGAGTGACATCTGGGCCAAGG - Intergenic
1152294638 17:79459509-79459531 CTGGAGTACCATCTGGTCCTTGG - Intronic
1152488244 17:80609935-80609957 CTGCAGTGCCTGCTGGGTCCTGG + Intronic
1152690596 17:81716126-81716148 CTGGAGCCTCAGCTGGGTCACGG - Intronic
1152699583 17:81812359-81812381 CTGGTGTCCTGTCTGGGTGCCGG - Intronic
1153307485 18:3645486-3645508 CTGCAGTCACATCTGACTCCTGG + Intronic
1153794925 18:8612585-8612607 CTAGTGACCCATCTTGGTCCAGG - Intronic
1153841814 18:9014699-9014721 CTTGACTCCCACCTGGGTGCTGG - Intergenic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1156475693 18:37404061-37404083 CCGGATTCCCCTCTGGGGCCCGG + Intronic
1157332003 18:46710902-46710924 CTGGAGTACCATCAGTGTCTGGG - Intronic
1157388324 18:47279387-47279409 CTGGAGTTACATCTGTGTTCTGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1162155304 19:8673732-8673754 CTGGAGTCCCTTCTGTGACTAGG + Intergenic
1163035663 19:14567512-14567534 CTGGACTAGTATCTGGGTCCCGG + Intronic
1163110909 19:15160698-15160720 CTGGGGCCCCAGCTGGGTCTGGG + Exonic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1165048594 19:33126374-33126396 CTGGAGGCGCAGCTGGGTCAGGG + Intronic
1166100769 19:40570336-40570358 CTGGGGTCCCATCTGTCTACAGG - Intronic
1166903963 19:46090789-46090811 GTGGGTTCCCATCTGGTTCCCGG + Intergenic
925004881 2:434413-434435 CAGGAATCCCATATGGGCCCAGG - Intergenic
926050207 2:9739831-9739853 CTGGAGTTCCTTCTGGATACCGG + Intergenic
926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG + Intergenic
926134048 2:10324367-10324389 CTGGAGTCAGGTCTGGGGCCAGG + Intronic
926820591 2:16847663-16847685 CTGTAGTCCCAGGTGGGTCGAGG - Intergenic
927850189 2:26494041-26494063 ATGGGGTCCCATCTGGAGCCTGG + Intronic
927932709 2:27055451-27055473 CTGCAGGCCCATCTGGGTGGAGG + Intronic
928116449 2:28548491-28548513 TTGGAGTCCCAGCTCTGTCCTGG + Intronic
928170683 2:29001137-29001159 CTTGAGCCCCAGCTGGGTCAGGG - Intronic
930108619 2:47659046-47659068 CTGCAGTTCCACTTGGGTCCAGG - Intergenic
932276875 2:70458335-70458357 TTGGAGAGCCATCTGGGTGCAGG - Intronic
932932472 2:76058428-76058450 CAGGACTCACATCTTGGTCCAGG - Intergenic
934718180 2:96555102-96555124 CTGGAGTCCAGGCTGGGTGCGGG + Intergenic
935316520 2:101840142-101840164 CTGGGGTCCAGTCTGGCTCCAGG + Intronic
935334263 2:102000663-102000685 CTGGAGGCCCCTCTAGCTCCAGG + Intronic
936368950 2:111886512-111886534 CTGGAGTCCCATCTGCTTGGGGG - Intergenic
938138650 2:128779442-128779464 CTTGCGGCCAATCTGGGTCCTGG + Intergenic
942318959 2:174719068-174719090 CTGTTGCCCCATCAGGGTCCTGG + Intergenic
943069602 2:183124832-183124854 CTGGATTCCCAGCTGGTTGCTGG + Intronic
944067577 2:195635270-195635292 CTGGAGGCCCCTCTGGGTTATGG + Intronic
944086443 2:195852552-195852574 CTGGAATCCAACCTGGGTCATGG - Intronic
946208475 2:218128382-218128404 ATTGAGTCCCCTCTGGGCCCTGG + Intronic
946737103 2:222764792-222764814 TTGGAGACCCATCTGGTTCAAGG - Intergenic
947531347 2:230910518-230910540 CTGCTGCACCATCTGGGTCCTGG - Exonic
947588663 2:231371982-231372004 CCTGAGTTCCTTCTGGGTCCTGG - Intronic
948958985 2:241316648-241316670 GTGGAGTCCCAACTGTGACCTGG + Intronic
1170740033 20:19047992-19048014 CAGGAGTCCCATCTGAGACTTGG - Intergenic
1172094063 20:32452178-32452200 CTGCAGACCCAGCTGGGTGCTGG + Intronic
1172178135 20:32984912-32984934 CTGGAGTCCCATTTGGCCCTGGG + Intronic
1172930162 20:38580813-38580835 CTGGGGACCCAGCTGGCTCCTGG + Intergenic
1173139847 20:40472195-40472217 ATGGAATCCCATCTGTGTTCTGG + Intergenic
1175681461 20:60991837-60991859 CCGGAGACACATCTGGGTCTGGG + Intergenic
1176374825 21:6081836-6081858 GTAGAGTCCACTCTGGGTCCCGG + Intergenic
1176654566 21:9577469-9577491 CCTGAGTTCCATCTGGGGCCTGG - Intergenic
1176707601 21:10127260-10127282 CCTGATGCCCATCTGGGTCCTGG + Intergenic
1176878021 21:14153644-14153666 CTGAAGTCCCAGAGGGGTCCAGG - Intronic
1179731105 21:43367861-43367883 CAGGAGCCCCACCTGGGGCCAGG - Intergenic
1179748650 21:43456409-43456431 GTAGAGTCCACTCTGGGTCCCGG - Intergenic
1180233533 21:46442563-46442585 CTGGAGTCCCACCTGGGCGAGGG - Exonic
1180362945 22:11916081-11916103 CTAAAGTCTCATCTGGGTCAAGG - Intergenic
1181698922 22:24609073-24609095 CCGGACTCCCAGCTGGGACCCGG + Intronic
1183543236 22:38441754-38441776 CTGGAGTCCCAGGAGGGCCCAGG - Intronic
1184664445 22:45980488-45980510 TTGGAGTCCCAGCTGGGTGGAGG - Intergenic
1185340357 22:50288210-50288232 CTGGGCTCCCATCGGGATCCTGG - Intronic
950018101 3:9768361-9768383 CTGACTCCCCATCTGGGTCCCGG + Intronic
952246725 3:31602029-31602051 CTGGAGTTCCACTTGAGTCCAGG + Intronic
953792931 3:45962374-45962396 TTCGAGTTCCTTCTGGGTCCTGG + Exonic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
954384043 3:50235185-50235207 CTGGACTCCAATCTGGGACCAGG - Intronic
954496507 3:50969003-50969025 CTGGAGTCCAATTTAAGTCCAGG + Intronic
956153338 3:66267022-66267044 CTGGAGTGCCTACTGGGTCTTGG + Intronic
956835831 3:73095311-73095333 CAGGAGTCCCTGCTGGGTGCTGG + Intergenic
958466894 3:94470686-94470708 CTGAAGTACTATCTGGTTCCAGG + Intergenic
958843864 3:99241733-99241755 CAGGAGTACCATTTGGGGCCAGG + Intergenic
960696554 3:120402059-120402081 CTGGAGTCCCATCTGGGTCCTGG - Intronic
961326008 3:126109804-126109826 CTGCAGCCCCATCTGGGACCTGG - Intronic
961627467 3:128273927-128273949 CTAGAGTCCCACTTGGGCCCAGG + Intronic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
964543559 3:157807078-157807100 CTAGAGACCAATGTGGGTCCCGG + Intergenic
967171078 3:186824403-186824425 CTGGAGCACCATGGGGGTCCTGG - Intergenic
967968844 3:194984778-194984800 CTGGAGTCCCGCATGGGGCCAGG - Intergenic
968704086 4:2069995-2070017 CTGGGGTTCCTTCAGGGTCCTGG - Intergenic
968927306 4:3556326-3556348 CTGAACTCCCATCTGCCTCCCGG + Intergenic
968931411 4:3581483-3581505 CTCGAGCCCCATCTGGAGCCAGG - Intronic
968968593 4:3781872-3781894 TGGGAGTCCCCTCTGCGTCCAGG + Intergenic
970199932 4:13593854-13593876 CTGGAATACCATGTGGATCCAGG + Intronic
975723950 4:77274269-77274291 CTGGAGGCTCAACTGGATCCAGG - Intronic
975773473 4:77756895-77756917 TTCGGGTTCCATCTGGGTCCTGG + Exonic
982863370 4:160481859-160481881 TTGGAGCCCCAGCTGGCTCCAGG + Intergenic
983713204 4:170745520-170745542 TTGGAGTACCTTCTGGATCCTGG - Intergenic
984888657 4:184473266-184473288 CCGGCGTCCCCTCGGGGTCCCGG - Intronic
985158797 4:187021925-187021947 CAGGAGGCCCATCTGTATCCAGG - Intergenic
985511450 5:316256-316278 CTGGATTCCTACCTGGGTCAGGG + Intronic
985896156 5:2751105-2751127 CCTGAGCCCCGTCTGGGTCCCGG + Intronic
989504764 5:42215100-42215122 CTCTGGACCCATCTGGGTCCTGG - Intergenic
990329085 5:54707702-54707724 CAGGAGCCGCATCTGGGTCTAGG + Intergenic
997580704 5:135015018-135015040 CAGCAGACCCATCTGGGGCCAGG - Intergenic
998213661 5:140220844-140220866 CTGGAGTCCAGGCTGGCTCCAGG + Intronic
999018439 5:148135602-148135624 CTGAAGTTCCACCTGTGTCCAGG - Intronic
999276070 5:150330931-150330953 GTGTGGTCCCATCGGGGTCCAGG - Intronic
1001982705 5:176047494-176047516 CTCGACTCCCACCTGGGGCCTGG + Intergenic
1002044644 5:176535068-176535090 CTGGAGGCCCTTCTGTCTCCTGG - Intronic
1002104845 5:176874932-176874954 CTGGAGTCCCCACTGCATCCTGG + Intronic
1002234758 5:177796563-177796585 CTCGACTCCCACCTGGGGCCTGG - Intergenic
1002450269 5:179314729-179314751 CAGGAGCCCCACCTGGGTGCAGG - Intronic
1003135292 6:3430483-3430505 CTGCAGTCCCTCCTGGGGCCTGG - Intronic
1004958625 6:20759044-20759066 CTGGAGGATCATTTGGGTCCAGG + Intronic
1007271575 6:40641367-40641389 CTGGAGTCCCTTCTGGCTGTGGG + Intergenic
1007551392 6:42732653-42732675 CTGGAGTCAAAGCTGGTTCCCGG - Intergenic
1011916494 6:92512193-92512215 CCGAAGTCCCATCTGAGTCAAGG - Intergenic
1017609334 6:156167967-156167989 CTGCACTCCCGCCTGGGTCCTGG + Intergenic
1018484820 6:164230390-164230412 CTGTAGACCCATCTGGCTCAGGG + Intergenic
1019410114 7:903045-903067 CTGCAGCCTCATCTGGTTCCTGG - Intronic
1019480468 7:1264467-1264489 CTGGAATCCCAGCCGGGCCCCGG - Intergenic
1020030442 7:4929163-4929185 ATGGAGTCCCAGCTGGATGCAGG - Intronic
1022119566 7:27294857-27294879 CTGGAGACCTCTCTGGGTCTTGG + Intergenic
1022236044 7:28461128-28461150 CAGGAGTACCGTTTGGGTCCAGG + Intronic
1023819881 7:43974818-43974840 CTGGTGTCCCTCCAGGGTCCAGG + Intergenic
1023833960 7:44057733-44057755 CTGGCCTTCCACCTGGGTCCAGG + Intronic
1026634029 7:72065578-72065600 CTGGAGTCCCATTGAGATCCCGG + Intronic
1027196652 7:76035182-76035204 CAGGGGTACCATCTTGGTCCAGG + Intronic
1029748156 7:102528271-102528293 CTGGTGTCCCTCCAGGGTCCAGG + Intergenic
1029766103 7:102627358-102627380 CTGGTGTCCCTCCAGGGTCCAGG + Intronic
1030033825 7:105391580-105391602 CTGGAGGATCATCTGAGTCCAGG + Intronic
1033601902 7:142894394-142894416 GTGGTGTCCCAGCTGGGTACAGG + Intergenic
1035440244 7:158891215-158891237 CTGGAGTCCCACCTGTGTCCTGG + Intronic
1039259659 8:35757514-35757536 CTGTCCTCCCATCTGGGTCAGGG + Intronic
1039466569 8:37789054-37789076 CTGGCTTCCCATCTGGTTTCAGG - Intronic
1039923154 8:41907019-41907041 CTGTAGTCCCCACTGGGCCCTGG - Intergenic
1041197032 8:55410666-55410688 AGGGAGGCCCATCAGGGTCCCGG - Intronic
1042561805 8:70077541-70077563 CTGTAGTCCCAGCTCAGTCCTGG - Intergenic
1044610044 8:94082420-94082442 ATGGAGCCCCCTCTGGGCCCTGG + Intergenic
1045050398 8:98319411-98319433 CTAAAGTCTCATCTGGGTCAAGG + Intergenic
1045120811 8:99032115-99032137 AGGGAGTCCCTTCTGGCTCCAGG + Intronic
1046329895 8:112700750-112700772 GTGGAGTCAAATCTGGGTACTGG - Intronic
1048308135 8:133297511-133297533 CTGCAGTCCCCTCCGAGTCCAGG + Exonic
1049155640 8:141065215-141065237 CTCAAGTCCCATCTGGGTTCTGG - Intergenic
1049230916 8:141480706-141480728 CTGGAGTCCTGACTGTGTCCTGG + Intergenic
1049615323 8:143573334-143573356 GTGCAGGCCCCTCTGGGTCCTGG + Intergenic
1049799902 8:144512909-144512931 ATGCAGACCCTTCTGGGTCCTGG + Exonic
1051896643 9:21995179-21995201 CGGGGGTCCCAGCTGGGTCCGGG + Intronic
1054143041 9:61543553-61543575 CTGAACTCCCATCTGCCTCCTGG - Intergenic
1054458716 9:65450446-65450468 CTCGAGCCCCATCTGGAGCCAGG + Intergenic
1054462748 9:65474434-65474456 CTGAACTCCCATCTGCCTCCCGG - Intergenic
1056913859 9:90728330-90728352 CTGCAGTCTCAGCTGGGACCTGG - Intergenic
1057794687 9:98146727-98146749 CTGGGCTCCCATTCGGGTCCTGG + Intronic
1058581830 9:106466977-106466999 CTGGATTCACACCTGGCTCCAGG + Intergenic
1059331752 9:113539939-113539961 CAGTAGTCCCATCTGGGCACTGG + Intronic
1061220475 9:129247627-129247649 CTGGAGCCGCATTTGGGCCCTGG + Intergenic
1061502894 9:131013859-131013881 CAGGAGACCCAGCTGGCTCCAGG - Intronic
1062416540 9:136454097-136454119 CTGCAGCCCCACCTGGGTCTGGG + Exonic
1062583092 9:137236883-137236905 CTGGAGTCCCATCAGGTGCGTGG + Intergenic
1202792347 9_KI270719v1_random:96140-96162 CCTGATGCCCATCTGGGTCCTGG + Intergenic
1203632285 Un_KI270750v1:80927-80949 CCTGAGTTCCATCTGGGGCCTGG - Intergenic
1185751632 X:2614803-2614825 TCAGAGTCCCAACTGGGTCCAGG + Intergenic
1187251068 X:17598258-17598280 CTGGACTCCCAACAGGCTCCGGG - Intronic
1190702651 X:52999950-52999972 CTGGAGTTTCATCTGGATCTGGG - Intergenic
1191687990 X:63912421-63912443 CTGGAGGTCTATCTGGGTGCTGG + Intergenic
1197721783 X:129750281-129750303 TTTGAGCCCCATCTGGGTCCAGG + Intronic
1199523806 X:148768846-148768868 CGACAGTCCCATCTGTGTCCTGG + Intronic
1202024246 Y:20503506-20503528 CTGGAGTTCTATCTGTATCCTGG + Intergenic