ID: 960699065

View in Genome Browser
Species Human (GRCh38)
Location 3:120423483-120423505
Sequence TCATCTCACAAAGATCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960699064_960699065 -1 Left 960699064 3:120423461-120423483 CCTGTTCATATAGGGCTGAAAAT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 960699065 3:120423483-120423505 TCATCTCACAAAGATCTGTGAGG 0: 1
1: 0
2: 1
3: 24
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960699065 Original CRISPR TCATCTCACAAAGATCTGTG AGG Intronic
900661259 1:3785173-3785195 TCTTCTCACAGAGATCTTCGTGG + Exonic
900873818 1:5326863-5326885 CCATCTCACAAAACTCTGTGGGG + Intergenic
901214873 1:7549609-7549631 TCATCTCACAAATATTTTTAAGG + Intronic
902922150 1:19672427-19672449 TGATCACAGAAATATCTGTGAGG + Intronic
906568569 1:46817729-46817751 TCATCTCACAAATGTCTATCAGG + Intronic
907663088 1:56411583-56411605 TCATGTCAGACAGATCTGCGTGG - Intergenic
908482360 1:64554752-64554774 TCATCTCAGAAAGTTCTCTTTGG - Intronic
908799741 1:67867043-67867065 ATGTCTCTCAAAGATCTGTGGGG + Intergenic
910053721 1:83007000-83007022 CCATTTCACAAAGATGTGTCGGG + Intergenic
911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG + Intronic
913019549 1:114774865-114774887 TTATCTCACAATAATCTGTAGGG + Intronic
913087810 1:115455422-115455444 TCATTTTACAAACATTTGTGGGG - Intergenic
915920336 1:159971575-159971597 TCACCTCACTAAGAGCTGGGTGG - Intergenic
917546727 1:175977016-175977038 TCATTTCACAAAGATATGTTTGG + Intronic
917786437 1:178463461-178463483 TCATCTCATAGGGAGCTGTGAGG - Intronic
919091256 1:192980859-192980881 TCTTTTCACACAGCTCTGTGAGG + Intergenic
922870680 1:228899709-228899731 GCCTCTCCCAGAGATCTGTGAGG - Intergenic
923396878 1:233574534-233574556 TTATCTCACATAGTTCTCTGAGG + Intergenic
924262119 1:242242772-242242794 ACATATACCAAAGATCTGTGGGG + Intronic
924871244 1:248047687-248047709 GCTTCTCACAAAACTCTGTGTGG - Intronic
1063197225 10:3754786-3754808 TCATCTCCCAAACCTCTTTGAGG - Intergenic
1063256715 10:4336415-4336437 TCAACGCACCAAGATCTGTTAGG - Intergenic
1063511993 10:6654710-6654732 TCATCTCACAAACCTCTGTTTGG - Intergenic
1064255889 10:13742448-13742470 TCCTCTGTCAAAGCTCTGTGAGG + Intronic
1066458421 10:35592386-35592408 TCACCTTGCAAATATCTGTGTGG - Intergenic
1068753656 10:60625282-60625304 TCATCTCTCATGGCTCTGTGGGG - Intronic
1068883032 10:62070272-62070294 TCTTCTTACCAAGCTCTGTGTGG + Intronic
1071947781 10:90667009-90667031 TAATCTTACAAAAATGTGTGTGG - Intergenic
1072181631 10:92987951-92987973 TAAGCTCACAAAAATCTGTAGGG - Intronic
1072380704 10:94866878-94866900 TCATCTCATAGAAATATGTGAGG - Intergenic
1074176333 10:111007605-111007627 TCAGCTCACAAAGATCCCTGAGG + Exonic
1075322532 10:121503679-121503701 TCATCACACCAAGACCTTTGTGG + Intronic
1079468401 11:20755511-20755533 TCATGTAAAAAAGACCTGTGTGG + Intronic
1079896321 11:26123472-26123494 TCATTTCACAAAGATCAAGGTGG + Intergenic
1081610400 11:44559343-44559365 TCATTTCAGAAAGATCAGTGAGG - Intergenic
1083040268 11:59679286-59679308 TTATCTCACAAAGATTTTGGGGG + Intergenic
1084132008 11:67143314-67143336 TCATTTCATAAACATCTGAGAGG + Intronic
1086918287 11:92556578-92556600 TGATATCAGAAATATCTGTGAGG + Intronic
1089795653 11:120978535-120978557 GCATTTCAGAAAGATCAGTGAGG + Intronic
1091088435 11:132746397-132746419 TTCTCCCACAAAGCTCTGTGAGG + Intronic
1091326955 11:134698385-134698407 TGACCTGACAAACATCTGTGAGG - Intergenic
1094336966 12:29369785-29369807 CCAGCTCACACAGATCAGTGAGG + Intronic
1094499594 12:31010160-31010182 TCATCTCACAAGGGTGTGAGGGG - Intergenic
1095329674 12:40943458-40943480 TCATCTTACAAAAATGTCTGTGG + Intronic
1095899648 12:47314682-47314704 TCATCTGTCAAAGAGCAGTGAGG + Intergenic
1095988285 12:48015474-48015496 TCATCACAGAAAGTTCTTTGGGG - Intergenic
1096440836 12:51642665-51642687 TCATCTCACAGGGTACTGTGAGG - Intronic
1097733602 12:63156055-63156077 TCATTCCACAAAGATGTGTTAGG - Intergenic
1097809489 12:64002985-64003007 TTATCTAACAAAGATCTTGGGGG + Intronic
1098024836 12:66190466-66190488 CCATCTCAAAAAGATCTGATGGG - Intronic
1101202662 12:102453090-102453112 GTATCTCACTAAGAACTGTGGGG - Intronic
1104262659 12:127198664-127198686 CCATCCCACAAATATTTGTGAGG - Intergenic
1105278627 13:18950359-18950381 GCATCCCTCAAAGAGCTGTGTGG + Intergenic
1106974496 13:35191134-35191156 TAGTGTCACAAAGGTCTGTGAGG - Intronic
1107284396 13:38773884-38773906 TCAATTTACAAAGATCTCTGAGG + Intronic
1108238294 13:48432293-48432315 TCATGTCCCCAAGATCTTTGGGG + Intronic
1109049182 13:57456431-57456453 TCATCTCACAAAAACCAGTATGG - Intergenic
1111430558 13:88144473-88144495 TCTTCTCACCTAGATCTGTGGGG - Intergenic
1112578762 13:100660481-100660503 TCATCTCACAGGGATCTATGTGG + Intronic
1113083098 13:106537149-106537171 TCTGCTCTCAAAGATCTGTTTGG - Intergenic
1113960009 13:114120871-114120893 TCTTCTCACACAGATCTAAGAGG + Intronic
1114511204 14:23262728-23262750 TCATCTCACACAGATATTTAGGG - Intronic
1115168029 14:30471498-30471520 GCAGCTCACAAAGATCATTGAGG - Intergenic
1116741223 14:48757554-48757576 TCATTTCACAAAGGTCTGTATGG - Intergenic
1117659121 14:57985940-57985962 CCAGCCCACAAAGTTCTGTGTGG - Intergenic
1120306739 14:82780559-82780581 TCCTTTCACAAACAGCTGTGAGG + Intergenic
1120784442 14:88519306-88519328 TCATCACACTAAGTTCTGTTGGG - Intronic
1124504840 15:30263776-30263798 TCATTTGACAAACATCAGTGGGG - Intergenic
1124738712 15:32274859-32274881 TCATTTGACAAACATCAGTGGGG + Intergenic
1125978939 15:43982137-43982159 TCATTTCACACAGAACTGTATGG - Intronic
1126491054 15:49236168-49236190 GCATCTGACAAACATCTGTCTGG + Intronic
1126920870 15:53522346-53522368 TCAGCACACAAAGATGTGAGAGG + Intronic
1127563065 15:60159665-60159687 TCCTCTCCCAGATATCTGTGTGG - Intergenic
1129009594 15:72403151-72403173 TCATTTCACTGAGATCTGAGGGG + Intronic
1129142037 15:73607991-73608013 TGATTTCAGAAACATCTGTGTGG - Intronic
1129414851 15:75369892-75369914 TCATCCCACAAAGCTCTTTTTGG + Exonic
1131994401 15:98120208-98120230 GGATCTCACAAGGAGCTGTGAGG + Intergenic
1132170517 15:99648257-99648279 TCATTTGACAAAGATTTGAGGGG + Intronic
1132749146 16:1449318-1449340 TCACCTCCCACAGATCTGGGCGG - Exonic
1136089774 16:27910413-27910435 TCATCACAAAAACCTCTGTGAGG + Intronic
1139930279 16:70520674-70520696 TCATTTCAGCAAGATGTGTGTGG - Intronic
1140950868 16:79816185-79816207 TCACTTCACAAAGTTCTTTGTGG - Intergenic
1141368687 16:83467482-83467504 TCAATTCACAAAGAGCTGTAAGG - Intronic
1147816208 17:43212412-43212434 TTAGCCCAGAAAGATCTGTGTGG + Intronic
1151681921 17:75626894-75626916 TCCTCTCCCAAACATCTGTCAGG + Exonic
1151781823 17:76251794-76251816 TCATCTCACCAGCCTCTGTGGGG + Intergenic
1153652063 18:7249587-7249609 TCATCTCAGAAAGGGCTGAGGGG - Intergenic
1153896963 18:9572219-9572241 TCAACTCAGAAAGATGTGTGGGG + Intronic
1156842932 18:41630627-41630649 TCATATCACAAAGTGCTGGGAGG + Intergenic
1157242898 18:46027826-46027848 TAACCTCAGAAAGATCTTTGAGG - Intronic
1157605779 18:48925028-48925050 TCTCCCCACAAAGGTCTGTGTGG + Intronic
1158706607 18:59797997-59798019 TCATCTCAAAGAGAACAGTGTGG - Intergenic
1158727469 18:59986576-59986598 TCAACTCCCACAGTTCTGTGGGG + Intergenic
1161653025 19:5496838-5496860 TCATCTCACATGGCTCTTTGAGG + Intergenic
1161697228 19:5776153-5776175 GCAGCTCACATAGTTCTGTGGGG - Exonic
1163058847 19:14743556-14743578 TCAGCTCACAGAGAGCAGTGAGG + Intronic
1164101696 19:22060339-22060361 TCATCTCACACAAATCTGAATGG - Intronic
1164861592 19:31566084-31566106 TCATCTCATAAAAATCCCTGGGG + Intergenic
1164919996 19:32082413-32082435 TCATCTCACAAAGAATGTTGGGG - Intergenic
927072115 2:19541632-19541654 TAAACTCACAAAGACCTATGTGG - Intergenic
927834542 2:26382956-26382978 TCACTTCTCAAAGCTCTGTGGGG + Intronic
928151675 2:28836127-28836149 TTATCACACAAATAGCTGTGGGG + Intronic
928397225 2:30952005-30952027 TCATCTCAGAAAGAAATGAGGGG - Intronic
928449315 2:31364620-31364642 TCTTCTGACCAAAATCTGTGAGG - Intronic
930283490 2:49399701-49399723 TCATCTTGCTAAGCTCTGTGTGG - Intergenic
932608857 2:73183694-73183716 TCATTTAACAAATATCTGTGGGG + Intergenic
932939880 2:76151564-76151586 AAATCTCAAAAAGATCAGTGTGG + Intergenic
934213935 2:90010864-90010886 TCATCTTACAAATAGTTGTGTGG + Intergenic
936984322 2:118294366-118294388 TCAGCTTACAAAAATCTGTAGGG + Intergenic
941140439 2:161774193-161774215 TCATCTCACATTGATGTGGGAGG - Intronic
942684218 2:178513803-178513825 TTATCTGACAAAAATCTGGGTGG - Exonic
945081390 2:206089725-206089747 TCATTTCACAAATAGCTGTTTGG + Intergenic
947002744 2:225476071-225476093 TGAACTGACAAAAATCTGTGAGG + Intronic
948346112 2:237299680-237299702 TGATCCCAGAAAGATCTGTCAGG + Intergenic
1169296644 20:4405683-4405705 TCTTCTCTTAAAGATCTATGAGG + Intergenic
1170066530 20:12316768-12316790 TCATCTCAAAGAGAGCTCTGTGG - Intergenic
1170127719 20:12984578-12984600 TCATCACAGAAAGTTCTGTTTGG - Intergenic
1170744146 20:19083656-19083678 TCTACTCACACAGCTCTGTGAGG + Intergenic
1171744622 20:28956806-28956828 TCATCTCACAGAGCGCTTTGAGG + Intergenic
1176202592 20:63869152-63869174 TCTTCTCTGAAAGGTCTGTGAGG - Intronic
1176318111 21:5270890-5270912 TCATCTCACAGAGCGCTTTGAGG - Intergenic
1176475972 21:7207667-7207689 TCATCTCACAGAGCGCTTTGAGG - Intergenic
1176931939 21:14823758-14823780 ACATCTCACAAATATATCTGTGG + Intergenic
1177186659 21:17805043-17805065 TCATCACAGAAAGTTCTGTTGGG - Intronic
1177617606 21:23543648-23543670 TCATCTGAGAAACATTTGTGGGG - Intergenic
1177682020 21:24384048-24384070 TCATTTCTCACAGTTCTGTGAGG + Intergenic
1180395781 22:12335075-12335097 TCATCTCACAGAGCGCTTTGAGG - Intergenic
1180403966 22:12529689-12529711 TCATCTCACAGAGCGCTTTGAGG + Intergenic
1181871044 22:25899581-25899603 TCATCTGACAAAGGTCTTTGGGG + Intronic
1182693557 22:32180472-32180494 TCATCTCCCAAAGATCCTTCAGG + Intergenic
1184185663 22:42863385-42863407 TCATCTGACATTCATCTGTGTGG - Intronic
1184620892 22:45675693-45675715 TGATCTCACACAGATCTGAGAGG - Intronic
950137989 3:10596012-10596034 GCAGCTTACAAAGATCTGAGAGG - Intronic
951697488 3:25460944-25460966 ACAGCTCACACAGAACTGTGAGG - Intronic
952796707 3:37245251-37245273 TAATCTCACATAAACCTGTGAGG + Intronic
953065874 3:39470381-39470403 TCTTCTCAACAAAATCTGTGAGG + Intronic
957497128 3:81007034-81007056 TTTTCTCACAGAGGTCTGTGGGG - Intergenic
958518266 3:95149808-95149830 TCATGTCAGAAAGATTTGTGTGG + Intergenic
958992346 3:100861299-100861321 TAATTTCACCAAGATCTGTGGGG + Intronic
959584841 3:108016287-108016309 TGATCTCACAGAGTTTTGTGAGG + Intergenic
960078334 3:113514143-113514165 TCAATTAACAAAGATCTGAGAGG + Intronic
960699065 3:120423483-120423505 TCATCTCACAAAGATCTGTGAGG + Intronic
962252304 3:133843116-133843138 TCATAACACAAAGATATGGGGGG + Intronic
969105047 4:4800918-4800940 TCATCTCCCAAAGTTTTCTGGGG - Intergenic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
969931991 4:10639786-10639808 TCATCACAGAAAGGTCTGTTGGG + Intronic
970218790 4:13786112-13786134 TCATCTCACAAAAATGTTTTGGG - Intergenic
971108647 4:23556936-23556958 TCAGCTCACATATATCTGTGAGG - Intergenic
975442968 4:74433969-74433991 TCCTCTCATAAAGATTTATGGGG - Intergenic
977076640 4:92460457-92460479 TCATCACCCAAAGTTCTGTGTGG - Intronic
977314462 4:95428308-95428330 TCATGTGAAAAAGATCTGGGAGG - Intronic
981064115 4:140463220-140463242 TTATCTCACAGAGTTCTTTGGGG + Intronic
981139859 4:141255180-141255202 TCAGCTGACAGACATCTGTGTGG + Intergenic
982713510 4:158782577-158782599 TCATTTCACAAACATTTATGAGG + Intronic
983137051 4:164097786-164097808 AAATCTCACAAAAATATGTGTGG - Intronic
983757139 4:171353427-171353449 TCATCTCACAAAAATATGGAAGG + Intergenic
984015797 4:174425314-174425336 TTATTTCATAAGGATCTGTGGGG + Intergenic
984322794 4:178214125-178214147 TCATCTCGCAAAGATCAGAGAGG + Intergenic
985877322 5:2609972-2609994 TCATCTCACACAGTTCCTTGGGG + Intergenic
988567629 5:32332088-32332110 GCATCTCACAAAGGTCTGTGAGG + Intergenic
988859746 5:35265291-35265313 TTACCTCCCAAAGATCTATGTGG - Intergenic
989236810 5:39157702-39157724 TCATCTCCCAAAGCTCAGGGGGG + Intronic
989450739 5:41583802-41583824 TCATCGCAGAAAGTTCTGTTTGG + Intergenic
990496465 5:56353258-56353280 TCATCTCAGAAATATCACTGGGG + Intergenic
993741643 5:91548432-91548454 TCATGTCCCACAGATCTCTGAGG + Intergenic
994300682 5:98143408-98143430 TTATTGCACAAAGGTCTGTGGGG + Intergenic
996473132 5:123883945-123883967 GCATCACAGAAATATCTGTGTGG + Intergenic
996519391 5:124410019-124410041 TTATCTCACATAACTCTGTGGGG - Intergenic
996693292 5:126364824-126364846 ACATCTCAGAAAGATTTGTTTGG - Intronic
997366444 5:133328298-133328320 TTATCTAACAAAGGTCTGGGTGG - Intronic
997847211 5:137297753-137297775 TTATCTCACTAAGATCTAGGAGG + Intronic
998175387 5:139898681-139898703 TCCTTTCACAAAGAGCTATGTGG + Intronic
998274602 5:140740683-140740705 TCATCTAACAAAGAATTGTTAGG - Intergenic
998548965 5:143058052-143058074 TAATCCCACAAAATTCTGTGTGG - Intronic
998565694 5:143214101-143214123 TCCCCTCACAAAGATATGGGCGG + Intronic
1000250830 5:159493423-159493445 TGATCTCTCAGAGATTTGTGAGG + Intergenic
1000709903 5:164560117-164560139 ACATCTCCCATAGATATGTGTGG - Intergenic
1000782035 5:165494190-165494212 TCACCTCACACAGAGGTGTGAGG + Intergenic
1001047377 5:168385159-168385181 GCATCTCACAAATATCTGTTGGG - Intronic
1002942521 6:1730646-1730668 TCAGCCCACAGAGAGCTGTGTGG - Intronic
1003361597 6:5431737-5431759 GCATTTCAGAAAGATCTGTCTGG + Intronic
1004012138 6:11700031-11700053 TCATCTAACAAATATTTATGGGG - Intergenic
1008069088 6:47081062-47081084 TCAACACACAAATATTTGTGGGG + Intergenic
1008863622 6:56182338-56182360 TCATCTCAAAATTATCTCTGAGG + Intronic
1012176173 6:96087667-96087689 TAATAGCACAAAGATTTGTGGGG - Intronic
1014122333 6:117739841-117739863 TCACCTCACCCAGATCTCTGGGG + Intergenic
1015599749 6:134900797-134900819 TCAACTTACATAGATTTGTGGGG + Intergenic
1016571693 6:145520666-145520688 TTATTTCACAAAGATCTTTGTGG - Intronic
1016884837 6:148949703-148949725 TCATTTCATAAATATTTGTGGGG + Intronic
1017016175 6:150101239-150101261 ACATGTCACAGAGAGCTGTGGGG + Intergenic
1018477354 6:164156940-164156962 TCATCACACATTGATCTGGGAGG - Intergenic
1018734560 6:166677843-166677865 TTATCTGAGACAGATCTGTGGGG + Intronic
1018738902 6:166712500-166712522 TTATCTAACAAGTATCTGTGAGG + Intronic
1021335870 7:19401561-19401583 TCCTTTCACAAAGAGCTGTTAGG - Intergenic
1023746921 7:43330445-43330467 TTATCTCTCAAAGTTCTGTGAGG - Intronic
1026866291 7:73826061-73826083 TCAGCTCACAGAGATCTTTTTGG + Intronic
1028010246 7:85633445-85633467 TCTTCTCTCTGAGATCTGTGAGG - Intergenic
1029864371 7:103610686-103610708 TCATCTCACCAAGTTTTCTGGGG + Exonic
1032410427 7:131690233-131690255 TCACCTCACAGAGAGCTCTGGGG - Intergenic
1034705559 7:153139911-153139933 TTGTCTCACAGAGATCTTTGGGG - Intergenic
1045652849 8:104357621-104357643 TCATCTCACAAATCTCTGTCTGG + Intronic
1047828309 8:128603323-128603345 ACATCTCATAAAGTTTTGTGGGG - Intergenic
1047961494 8:130015241-130015263 TCATCTCACAATTATCTATGGGG + Intronic
1048604985 8:135958526-135958548 GCATCTCACTAAGATCATTGAGG + Intergenic
1050273698 9:3973936-3973958 AAATCTAACATAGATCTGTGAGG - Intronic
1051273115 9:15374389-15374411 TTATCTCACAGAGGTCTTTGGGG + Intergenic
1051315919 9:15831726-15831748 TAATATTACAAAGATCTGTCAGG - Intronic
1052636262 9:31109204-31109226 TCAAGACAGAAAGATCTGTGAGG + Intergenic
1053222706 9:36325429-36325451 TCATCTCACAAAGATGTGGACGG - Intergenic
1053222715 9:36325480-36325502 TCATCTCACAAAGATGTGGACGG - Intergenic
1053224746 9:36344524-36344546 TCATCTTAGAAAGTTCTGTTAGG - Intronic
1055600557 9:77913526-77913548 TCACCACAGAAAGTTCTGTGAGG + Intronic
1056247283 9:84708391-84708413 AAATCTCACAAAGATGGGTGGGG - Intronic
1058173254 9:101708007-101708029 TCATTGCAAAAAGGTCTGTGGGG + Intronic
1203381150 Un_KI270435v1:44973-44995 TCATGTCACAGAGCTCTTTGAGG + Intergenic
1203411404 Un_KI270579v1:10353-10375 TCATCTCACAGAGCGCTTTGAGG - Intergenic
1185781332 X:2849753-2849775 TTATCCCTCAAAGATCTTTGAGG + Intronic
1186299628 X:8185708-8185730 TCATCACAGAAAGTTCTGTTGGG - Intergenic
1186299879 X:8188985-8189007 TCATCTCAGAAAAATATATGGGG - Intergenic
1189064002 X:37786677-37786699 TCAGCACACAAAAATCTCTGAGG + Intronic
1190277802 X:48910433-48910455 TCATCTCCAAAAGAACTGCGAGG + Intronic
1190963942 X:55280071-55280093 TCTTCTCACAAAGCTCTGCATGG - Intronic
1192428318 X:71096295-71096317 GCATCTCAGAAAGAGCTTTGAGG + Exonic
1193448396 X:81635720-81635742 TCATCTAACTAACATCTGTTAGG - Intergenic
1196575528 X:117313802-117313824 TCATTTCCCAAAGATATGTTTGG - Intergenic
1196971101 X:121109671-121109693 TTATCTCACAGGGATCTTTGGGG + Intergenic
1198092185 X:133342376-133342398 TCATCTCAGAGAGATCTTTCCGG + Intronic
1200867467 Y:8060172-8060194 TTATGTCACAATGATCTATGTGG - Intergenic
1200901564 Y:8437680-8437702 TCATGTCACAATGTTCTCTGTGG + Intergenic
1201561982 Y:15327606-15327628 TCATCACAGAAAGATCTTTAGGG + Intergenic
1202244686 Y:22808027-22808049 TTATGTCACAATGCTCTGTGTGG - Intergenic
1202255288 Y:22914350-22914372 TTATATCACAAAGATCCATGTGG - Intergenic
1202397675 Y:24441773-24441795 TTATGTCACAATGCTCTGTGTGG - Intergenic
1202408279 Y:24548099-24548121 TTATATCACAAAGATCCATGTGG - Intergenic
1202462503 Y:25121981-25122003 TTATATCACAAAGATCCATGTGG + Intergenic
1202473106 Y:25228314-25228336 TTATGTCACAATGCTCTGTGTGG + Intergenic