ID: 960702258

View in Genome Browser
Species Human (GRCh38)
Location 3:120450600-120450622
Sequence GCGGGTGGGCGCGCGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960702258_960702268 4 Left 960702258 3:120450600-120450622 CCCCAGGACGCGCGCCCACCCGC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 960702268 3:120450627-120450649 CGCGCAGACCCAAGAGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 175
960702258_960702269 5 Left 960702258 3:120450600-120450622 CCCCAGGACGCGCGCCCACCCGC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 960702269 3:120450628-120450650 GCGCAGACCCAAGAGGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 159
960702258_960702270 6 Left 960702258 3:120450600-120450622 CCCCAGGACGCGCGCCCACCCGC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 960702270 3:120450629-120450651 CGCAGACCCAAGAGGCCCCGGGG 0: 1
1: 0
2: 2
3: 17
4: 135
960702258_960702277 26 Left 960702258 3:120450600-120450622 CCCCAGGACGCGCGCCCACCCGC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 960702277 3:120450649-120450671 GGGACCGAGTTCGGACTCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 43
960702258_960702265 -2 Left 960702258 3:120450600-120450622 CCCCAGGACGCGCGCCCACCCGC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 960702265 3:120450621-120450643 GCCCAGCGCGCAGACCCAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 108
960702258_960702273 17 Left 960702258 3:120450600-120450622 CCCCAGGACGCGCGCCCACCCGC 0: 1
1: 0
2: 2
3: 16
4: 145
Right 960702273 3:120450640-120450662 GAGGCCCCGGGGACCGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960702258 Original CRISPR GCGGGTGGGCGCGCGTCCTG GGG (reversed) Intronic