ID: 960709613

View in Genome Browser
Species Human (GRCh38)
Location 3:120514579-120514601
Sequence AAGAAGAAGGAGAGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960709613_960709621 2 Left 960709613 3:120514579-120514601 CCCCCCTCCCTCTCCTTCTTCTT No data
Right 960709621 3:120514604-120514626 CAGAGTCTTGCTCTGTGTCCAGG No data
960709613_960709622 16 Left 960709613 3:120514579-120514601 CCCCCCTCCCTCTCCTTCTTCTT No data
Right 960709622 3:120514618-120514640 GTGTCCAGGCTAGAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960709613 Original CRISPR AAGAAGAAGGAGAGGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr