ID: 960713930

View in Genome Browser
Species Human (GRCh38)
Location 3:120557751-120557773
Sequence TCCCTGTCTCCAAATCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960713930_960713934 0 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713934 3:120557774-120557796 CCATGAAATGCAGAAATTAGGGG No data
960713930_960713932 -1 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713932 3:120557773-120557795 ACCATGAAATGCAGAAATTAGGG No data
960713930_960713935 1 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713935 3:120557775-120557797 CATGAAATGCAGAAATTAGGGGG No data
960713930_960713931 -2 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713931 3:120557772-120557794 GACCATGAAATGCAGAAATTAGG No data
960713930_960713936 2 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713936 3:120557776-120557798 ATGAAATGCAGAAATTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960713930 Original CRISPR TCCCTGTCTCCAAATCTATC TGG (reversed) Intergenic
No off target data available for this crispr