ID: 960713931

View in Genome Browser
Species Human (GRCh38)
Location 3:120557772-120557794
Sequence GACCATGAAATGCAGAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960713926_960713931 7 Left 960713926 3:120557742-120557764 CCAATAGAGCCAGATAGATTTGG No data
Right 960713931 3:120557772-120557794 GACCATGAAATGCAGAAATTAGG No data
960713930_960713931 -2 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713931 3:120557772-120557794 GACCATGAAATGCAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960713931 Original CRISPR GACCATGAAATGCAGAAATT AGG Intergenic
No off target data available for this crispr