ID: 960713931 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:120557772-120557794 |
Sequence | GACCATGAAATGCAGAAATT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
960713926_960713931 | 7 | Left | 960713926 | 3:120557742-120557764 | CCAATAGAGCCAGATAGATTTGG | No data | ||
Right | 960713931 | 3:120557772-120557794 | GACCATGAAATGCAGAAATTAGG | No data | ||||
960713930_960713931 | -2 | Left | 960713930 | 3:120557751-120557773 | CCAGATAGATTTGGAGACAGGGA | No data | ||
Right | 960713931 | 3:120557772-120557794 | GACCATGAAATGCAGAAATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
960713931 | Original CRISPR | GACCATGAAATGCAGAAATT AGG | Intergenic | ||
No off target data available for this crispr |