ID: 960713934

View in Genome Browser
Species Human (GRCh38)
Location 3:120557774-120557796
Sequence CCATGAAATGCAGAAATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960713930_960713934 0 Left 960713930 3:120557751-120557773 CCAGATAGATTTGGAGACAGGGA No data
Right 960713934 3:120557774-120557796 CCATGAAATGCAGAAATTAGGGG No data
960713926_960713934 9 Left 960713926 3:120557742-120557764 CCAATAGAGCCAGATAGATTTGG No data
Right 960713934 3:120557774-120557796 CCATGAAATGCAGAAATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960713934 Original CRISPR CCATGAAATGCAGAAATTAG GGG Intergenic
No off target data available for this crispr