ID: 960719330

View in Genome Browser
Species Human (GRCh38)
Location 3:120610432-120610454
Sequence CTGAATTTCCTGGAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960719326_960719330 -8 Left 960719326 3:120610417-120610439 CCTGACATCTGACCTCTGAATTT No data
Right 960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960719330 Original CRISPR CTGAATTTCCTGGAGCTGGA TGG Intergenic
No off target data available for this crispr