ID: 960723477

View in Genome Browser
Species Human (GRCh38)
Location 3:120647313-120647335
Sequence AAGGGGTAGCAGAAATAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960723471_960723477 22 Left 960723471 3:120647268-120647290 CCAGGCAAGGAACTTGTATATGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG 0: 1
1: 0
2: 0
3: 35
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960723477 Original CRISPR AAGGGGTAGCAGAAATAGGA TGG Intronic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
901905232 1:12403222-12403244 AAGGAGTAGCAGGAGTAGCATGG - Intronic
902919929 1:19659620-19659642 AAGGGGAAGAAGAGAAAGGAAGG + Intergenic
903885299 1:26537486-26537508 CAGGGGAAGCAGAGATAGCAGGG - Intronic
904348510 1:29889849-29889871 AAGGAGCAGGAGAAATGGGAAGG + Intergenic
904818172 1:33220985-33221007 AAGGGTCAGCAGAAAGAGGGTGG + Intergenic
905108936 1:35580366-35580388 AAGGGGTTGGAGCAAGAGGAAGG - Intronic
905601512 1:39256191-39256213 AAAGGTTAGCAGAGATTGGAAGG + Intronic
905865196 1:41372640-41372662 AAGGGGTTGCTGAACTAGTATGG + Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906283486 1:44569895-44569917 AAGGGGTAGCAGGCCTATGATGG + Intronic
906849308 1:49230749-49230771 AAGAGGTAACTGAAATAGAAGGG - Intronic
906936878 1:50222057-50222079 AAAGGGTTGCAGAGATTGGAGGG - Intergenic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
907628845 1:56060031-56060053 AGGGGGTAGCAGGAACAGGATGG + Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908390661 1:63680699-63680721 AAGAGGCAGCAGAATTAGCATGG + Intergenic
909546792 1:76857282-76857304 AAGGGGTAGCAGCTGCAGGAAGG - Intergenic
910080417 1:83334904-83334926 AAGCTGTAGCAGAACTAGAATGG + Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911132555 1:94404638-94404660 AAGGGGATGCAGAAATAGAATGG - Intergenic
911159204 1:94667582-94667604 AAGGGGAAGGAGGAATAGAATGG + Intergenic
911835090 1:102608582-102608604 TTGGGGTAGATGAAATAGGAGGG + Intergenic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
913060329 1:115198683-115198705 AAGGGATAACAGAAATATTAAGG - Intergenic
915138149 1:153748572-153748594 AAGGGATGGCAGTAATGGGATGG + Intronic
915632534 1:157163442-157163464 AAGGGGCTGCAGGAATGGGAAGG - Intergenic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917635646 1:176933166-176933188 AAGAGGTAGCAGAGCTATGATGG - Intronic
917643806 1:177009564-177009586 AAGAAGTTGCAGAAATAGAAGGG + Intronic
917707213 1:177646777-177646799 AATTGGTAGCAGAAACAGAAGGG - Intergenic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
918825558 1:189319373-189319395 AAGGAGTGTCAGAAATAGGTTGG + Intergenic
920248414 1:204605732-204605754 AACAGGTGGCAGGAATAGGAAGG - Intergenic
923434963 1:233959449-233959471 ATGGGGTAGCAGGCATAGGGAGG + Intronic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066761417 10:38757077-38757099 TTGGGGTAGTAGAAAAAGGAAGG + Intergenic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1070636832 10:78135229-78135251 AAGGGCTAAGAGGAATAGGAAGG + Intergenic
1071144782 10:82555873-82555895 AACAGGTAGAAGAAATAGGGTGG - Intronic
1071692777 10:87839896-87839918 AAGGTGGAACAGGAATAGGAAGG - Intronic
1073821911 10:107273840-107273862 ATGTGGTAGCAGAAAAAGCAAGG + Intergenic
1073832988 10:107408029-107408051 AAGGGGTAGCACAAATTTTAGGG + Intergenic
1073898044 10:108185319-108185341 AAGGGAGAGCAGCAATTGGATGG + Intergenic
1073898235 10:108187553-108187575 ACGGTATAGCAGAAATAGCAAGG + Intergenic
1074790596 10:116882888-116882910 AACGGGTAGGAGAAACTGGAAGG + Intronic
1078168551 11:8911248-8911270 AAGGGGTAGATGAAAATGGAAGG + Intronic
1078586011 11:12589749-12589771 AAGAGGCAGGAGAAAAAGGATGG - Intergenic
1079047341 11:17117515-17117537 GAGGAGTAGCAGAAAAAGTAAGG - Exonic
1080202425 11:29688349-29688371 AAGTGGTAGAACAAATAGCATGG - Intergenic
1080210629 11:29781110-29781132 AAGGGGCTACAGAAACAGGAAGG + Intergenic
1081111509 11:39139562-39139584 AAGGGTGAGCAGAGATAGTAGGG - Intergenic
1082762093 11:57136910-57136932 AAGGAGGAGGAGGAATAGGAAGG + Intergenic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1085442315 11:76576206-76576228 AAGGGAGAGAAGAAATAGGGTGG + Intergenic
1087250216 11:95890537-95890559 AAAGGGGAGCAGAAACAGCAGGG + Intronic
1088303914 11:108387876-108387898 AAGGGGTAGCAGTAGTAAGAAGG - Intronic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089356639 11:117858241-117858263 GACGGGAAGCAGAAAAAGGAGGG - Intronic
1089386322 11:118070580-118070602 AAGGGTTAGAAGACACAGGAAGG - Intergenic
1089610878 11:119667916-119667938 AAGGGTCAGCAAAAATAGGGGGG + Intronic
1090075230 11:123576373-123576395 AAGTGCCAGCAGAAATGGGAAGG - Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092622860 12:10292131-10292153 CAGAGGTAGTAGAAATAGCAAGG - Intergenic
1094303431 12:28991791-28991813 AAGGCCCAGCAGAAACAGGAGGG - Intergenic
1095326482 12:40900385-40900407 AGGTGGTAGCAAAAATAGGAAGG + Intronic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1097438268 12:59577338-59577360 AAGAGGTATGAGAAAAAGGAGGG + Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1104001695 12:124864177-124864199 AAGGGGTAGGAGAAAGGGGAAGG - Intronic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1105061358 12:133154001-133154023 AGGTAGTACCAGAAATAGGATGG - Intronic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106682384 13:32021696-32021718 AAGGGGTAGCAGAAGCATAAGGG - Intergenic
1107823028 13:44303589-44303611 AGGTGGTAGAGGAAATAGGAAGG + Intergenic
1108733773 13:53261135-53261157 AAGGAGTGGCAGCAATGGGAAGG + Intergenic
1108755599 13:53498261-53498283 GAGGGGAAGCAGCAATAGGGAGG + Intergenic
1109090443 13:58036799-58036821 AATAGGTAGCAGAAAGAGTAGGG + Intergenic
1109628236 13:65007769-65007791 AAAGGGAAGCAGAAATAAGGGGG - Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1110555969 13:76859595-76859617 AAATTGTAGCAGAAATAAGAAGG - Intergenic
1110656648 13:78007886-78007908 AAGGGTGATCAGAAATAGGATGG - Intergenic
1112050947 13:95643816-95643838 CAGAGGCAGCAAAAATAGGAGGG - Intronic
1112155299 13:96810319-96810341 AAGGGGTAGAAGAGAGAAGAAGG + Intronic
1112194403 13:97210977-97210999 AAAGGGTAGCAGGGAGAGGAAGG + Intergenic
1112505267 13:99971192-99971214 AAGGGGTGGGAGGAAGAGGAGGG + Exonic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112792651 13:103019743-103019765 AAGGAGTAACAGAAAAGGGACGG - Intergenic
1113919175 13:113897140-113897162 AAGGGTTATAAGAAATCGGAAGG + Intergenic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1115604928 14:34991668-34991690 AATGTGTAGCAGCAATAGCAAGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117564704 14:56981281-56981303 AATGTGAAGCAGAGATAGGATGG - Intergenic
1117582987 14:57171698-57171720 AAGGGGAAGGAGAAAAAGTAAGG + Intergenic
1117866996 14:60160431-60160453 AAGGGAAAATAGAAATAGGATGG + Intronic
1117988661 14:61413086-61413108 AAGGGGGGAAAGAAATAGGATGG - Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118838650 14:69494828-69494850 AAGGGGCAGCTAAAATAGCAGGG + Intronic
1119321397 14:73733218-73733240 AAGGTGAATCAGAAATAGGCTGG + Intronic
1119457094 14:74764853-74764875 AAGAGGTTTCAGAAAAAGGATGG + Intronic
1119904975 14:78293469-78293491 AAACAGTAACAGAAATAGGAAGG - Intronic
1119929673 14:78532995-78533017 CAGTGGTAGCAGAAATAGAGAGG - Intronic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1121798717 14:96755971-96755993 CAGGGGGAGCAGAAATCTGAGGG + Intergenic
1125825695 15:42674441-42674463 AAGGGACAACAAAAATAGGAAGG + Exonic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126553995 15:49965965-49965987 AAGGGCAAGCAGAAATAGGGTGG + Intronic
1127136689 15:55931316-55931338 AGTGGGTAGCAGGAATAGGAGGG + Intronic
1128539548 15:68517024-68517046 AAGTTGTTGCATAAATAGGAGGG + Intergenic
1130294138 15:82631715-82631737 AGGGGGTACCAGGAATAGAAGGG - Intronic
1130721578 15:86391547-86391569 AAGGGGTAGAAGAAATGGCCAGG - Intronic
1131413239 15:92228826-92228848 AAGGGGAAGCAGAACAAGAAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1137476385 16:48812996-48813018 AATGGCTAGCAGAAGAAGGATGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1140330790 16:74054880-74054902 AAGGGGAAGAAGAAATAAAAGGG + Intergenic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1143129221 17:4665582-4665604 ATGGCTTAGCAGAAATAGGGGGG - Intergenic
1143447028 17:7015659-7015681 AAGGGGTCCCAGAAATCGGAAGG + Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1145833600 17:27937200-27937222 AAGGGCAAGAAGAAAAAGGAGGG - Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1148237021 17:45975813-45975835 GAGGGGTAAGAGAAACAGGAAGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150742068 17:67787382-67787404 AAATGGGGGCAGAAATAGGAGGG - Intergenic
1153576546 18:6527513-6527535 GAAGGGAAGCAGGAATAGGAGGG + Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1158352653 18:56578706-56578728 AAGGGGACCCAGTAATAGGATGG + Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1159192219 18:65061311-65061333 AAGGGGGAGAAAAAATAGAAAGG - Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1163020866 19:14480174-14480196 AAGGGGTTGCAGAAAGGGAAGGG - Intronic
1163358606 19:16830716-16830738 AAGGTGTAAGAAAAATAGGAGGG - Intronic
1163646083 19:18489873-18489895 AGGGGTCAGCAGAAACAGGAGGG - Intronic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164822869 19:31263902-31263924 ACGGGGTAGCAGAAACAGTGGGG + Intergenic
1165588262 19:36941455-36941477 AAGGCATATTAGAAATAGGAAGG - Intronic
1166308799 19:41950812-41950834 TTGGGGTAGGAGAAATTGGAGGG - Intergenic
1166993193 19:46705307-46705329 AAGGGGCCTCAGAAAAAGGAAGG - Intronic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
1168688204 19:58361244-58361266 AACGGGGAGCAGAGGTAGGAGGG + Intronic
926772699 2:16392567-16392589 AATGGGTGGCTGAAATGGGATGG + Intergenic
927493737 2:23538134-23538156 AATAAGTAGCAGAACTAGGATGG + Intronic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
930565985 2:53021323-53021345 TAGTGGTAGTAGTAATAGGATGG + Intergenic
931354976 2:61528914-61528936 AATAGGTAAAAGAAATAGGAAGG - Intronic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
931761403 2:65420337-65420359 AAGGGGTACTAAAAATACGAAGG - Intronic
932086267 2:68765063-68765085 AAAGGGCAGCAGAAACCGGAGGG - Intronic
932162618 2:69475733-69475755 AAGGGGTAGGAGAAAAGGGCTGG + Exonic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
933018274 2:77159645-77159667 GAGGAGGAGGAGAAATAGGAGGG + Intronic
933606185 2:84386655-84386677 AAGAATTAGCACAAATAGGAGGG + Intergenic
935313672 2:101810133-101810155 AATAGGTAGCAAAAACAGGAGGG + Intronic
935670647 2:105554137-105554159 AAGGCCTGGAAGAAATAGGAAGG + Intergenic
936925403 2:117731366-117731388 AAGGGGTAGGAAGAACAGGAAGG + Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937398148 2:121556948-121556970 ATTTGGTAGCAGAACTAGGATGG - Intronic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938708281 2:133953026-133953048 AAGGGAGAACAGAAACAGGAAGG + Intergenic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
942607751 2:177710097-177710119 AAGGGACAGCAGATACAGGAGGG + Intronic
943051323 2:182916541-182916563 AAGGTTTAGAAGAAACAGGATGG + Intronic
943319303 2:186428055-186428077 AAGGGGTGGTAGAAAAAAGAAGG + Intergenic
946501852 2:220257370-220257392 AGGGGGGAGGAGGAATAGGAGGG + Intergenic
947557715 2:231111273-231111295 GAGGGGTAGCAGGACAAGGAAGG - Intronic
947706856 2:232283237-232283259 TAGAGGTGGCAGAACTAGGATGG + Intronic
947806875 2:232975262-232975284 AAAGGGTGGCAGAAATAGTGAGG + Intronic
947955725 2:234189185-234189207 AAGAGGCAGCAGCAAGAGGATGG + Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1170351652 20:15448004-15448026 AAGGGGAGGCAGAGATGGGATGG - Intronic
1173164475 20:40676995-40677017 TAGGAGTAGGAGAAGTAGGAGGG + Intergenic
1173555948 20:43965764-43965786 AATGGGTAGAAGACATGGGAGGG + Intronic
1174102550 20:48138504-48138526 AAGGGGTAGGTGATATAGGCTGG - Intergenic
1175315900 20:58046483-58046505 CAGAGGTGGCAGAGATAGGATGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1176016044 20:62933347-62933369 AATGGTTAGCAGAAGTAGGTAGG - Intronic
1179475021 21:41637481-41637503 AAGGCAGAGCAGAAAAAGGAAGG - Intergenic
1181629250 22:24141955-24141977 ATGGGGTACCAGAAATTGGGTGG - Intronic
1183144264 22:35974800-35974822 AAGTGGTAGCAGTAAGATGAGGG - Intronic
1183302151 22:37063714-37063736 GAGGGGTGGCAGCAATAGGGAGG - Intergenic
1183538683 22:38417451-38417473 ATGGGGCAGCAGGAATAGGGGGG - Intergenic
1184232556 22:43166495-43166517 AAGTGGGAGAAGAAATAAGATGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184418675 22:44366717-44366739 AAGCTGGAGGAGAAATAGGATGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949295321 3:2514917-2514939 AGGGGGTAGCAGAAGATGGAGGG - Intronic
949740988 3:7233994-7234016 AATGAGTAGCAGTTATAGGAAGG - Intronic
949947115 3:9199047-9199069 AAGGGGGGGCAGATATTGGATGG - Intronic
950858180 3:16125016-16125038 AGGGGGAGGCAGAAATATGATGG + Intergenic
950865862 3:16188597-16188619 AAGGGGTTGGAGCACTAGGAGGG + Intronic
952415749 3:33090294-33090316 CAGGGGTAGCTGAGAAAGGATGG + Intronic
952783701 3:37130680-37130702 AATGGGTAGCATAGACAGGATGG - Intronic
954955177 3:54512515-54512537 AAGGTGCAGGAGAAAAAGGAAGG - Intronic
956586348 3:70869285-70869307 AAGAGGCAGCAGAAATTGGCAGG - Intergenic
957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG + Intergenic
957589520 3:82177557-82177579 AAATGGTAGAAGAAATAGGAGGG - Intergenic
958032668 3:88131745-88131767 AAGAGGTAGAAGAAATAAGAGGG - Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG + Intronic
961235309 3:125361362-125361384 ATTGGGTAGGGGAAATAGGAGGG - Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961937224 3:130598029-130598051 AAGGGGTGGCAGTAACAAGAGGG + Intronic
962594389 3:136925515-136925537 ACGGGGCAGCAGGAACAGGAGGG - Intronic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
965446077 3:168776256-168776278 AAAAGATACCAGAAATAGGAAGG - Intergenic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967693635 3:192506073-192506095 AAGGTGAAGCAGGGATAGGAAGG + Intronic
968449445 4:668417-668439 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449475 4:668530-668552 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449490 4:668586-668608 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449501 4:668623-668645 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449565 4:668864-668886 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449612 4:669031-669053 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449659 4:669198-669220 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449686 4:669311-669333 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449715 4:669403-669425 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449734 4:669478-669500 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449744 4:669516-669538 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449757 4:669573-669595 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449762 4:669592-669614 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449767 4:669611-669633 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449781 4:669667-669689 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449786 4:669686-669708 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449791 4:669705-669727 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449796 4:669724-669746 ATGGGGTAGCGGGAATAGCATGG - Intronic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
970233514 4:13934518-13934540 AAGGTGTAACAGATATGGGAGGG - Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971144503 4:23962142-23962164 AAGGGAAAGTAGAAATAGCAAGG + Intergenic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
974089091 4:57291930-57291952 AAGAGCTAGCTGAAATAGGAAGG - Intergenic
974925422 4:68292148-68292170 AATTGGTACCAGAAATAGGATGG - Intergenic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
977040989 4:92018117-92018139 AAGGGGTGGCAGAAATAATTAGG + Intergenic
977314995 4:95435169-95435191 AAGGGATATCAGAATTGGGAGGG - Intronic
977370002 4:96123802-96123824 ATGGGGTGGCAGAAATAAGTGGG + Intergenic
977984458 4:103365685-103365707 ATGGTGTAGCACAAATAAGAAGG + Intergenic
978613614 4:110571645-110571667 AAGAGGGAGCAGCAATAGGCAGG - Intergenic
978883033 4:113731227-113731249 AAGGGTTAGGAGAACTAAGAAGG + Intronic
979693602 4:123586913-123586935 AGGGGTTAGCTGCAATAGGATGG + Intergenic
979828995 4:125277114-125277136 ACGGAGTAGCACAAATAGGGTGG + Intergenic
980071957 4:128252956-128252978 AAGGGGAAGGAGATATAGGGTGG + Intergenic
980387736 4:132108192-132108214 AAGAGATAGCAGAAATAAGGTGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982091928 4:151887663-151887685 AATGGGAAGCAGAACTAGGCTGG - Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982469764 4:155774035-155774057 AAGGGGTACAAGACAGAGGAGGG - Intronic
982627885 4:157790794-157790816 AAGGGAAAGGAGAAATAAGAAGG - Intergenic
983350405 4:166579780-166579802 ATGGGTCAGCAGAAATAGAAAGG + Intergenic
983350442 4:166580876-166580898 ATGGGTCAGCAGAAATAGAAAGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
986402641 5:7395602-7395624 AAGGGGTGGAGGAAACAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988521041 5:31945833-31945855 TAGGAATAGCAGAAATAGTAAGG - Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
993028573 5:82675304-82675326 AAGGGTTATCTGAAATAGGATGG + Intergenic
993572645 5:89561012-89561034 AAGGGATAGAACTAATAGGATGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994916843 5:105991778-105991800 AAGAGGTAACAGAAATGGGTAGG - Intergenic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
995744068 5:115385252-115385274 AAGGGGTAGCAGGGTTAGAAAGG + Intergenic
996582259 5:125044560-125044582 AAAGGTTAGCAGAAATATGTAGG + Intergenic
996804900 5:127443582-127443604 AAGGGGTGGTAGAAGTAGGGAGG - Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997866919 5:137471987-137472009 AAGGGTGAGCAGAAATAAAAGGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1002555086 5:180030963-180030985 AGGGGGTAGGAGGAAGAGGACGG - Intronic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1005111391 6:22285706-22285728 AGGGGGTAGAACAAAGAGGAAGG - Intergenic
1006874679 6:37285096-37285118 CAGGGGTTGCAGAAAGTGGAAGG + Intronic
1007036263 6:38677144-38677166 AAGGAACAGCTGAAATAGGAAGG + Exonic
1010687651 6:78871184-78871206 AAGGGGAAGCAGAGATATCAGGG - Intronic
1010780834 6:79944833-79944855 AAGGGGAAACAGAAATGGGCGGG - Intronic
1011658805 6:89576507-89576529 AAGGAGTAGCAGAAAAGTGAAGG - Intronic
1012569315 6:100702195-100702217 TAGTGGTGGCAGAAAGAGGAGGG + Intronic
1013470129 6:110456752-110456774 AAGGTGTAGCAGGAATAAGAGGG - Exonic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015736284 6:136403172-136403194 AAGGCGTAGCAGAGAGAGGTGGG - Intronic
1018310739 6:162505700-162505722 AAGGGGTAATAGAAATAGAAGGG + Intronic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1022989424 7:35693958-35693980 AAGAGGAAGCAGAAATATCAAGG - Intronic
1023681442 7:42691566-42691588 AAGGAGTAAGAGCAATAGGAAGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1027298194 7:76800169-76800191 AAGCTGTAGCAGAACTAGAATGG + Intergenic
1027723615 7:81774749-81774771 AAGTGGTAGCAGAAACAGAATGG - Intergenic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028433737 7:90777852-90777874 AAAGGGAAGAAGAAATATGAGGG - Intronic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029872042 7:103704730-103704752 AAAAGGGAGCAAAAATAGGAAGG - Intronic
1030864527 7:114683362-114683384 ATGGGGTAGCAGAAATAACAAGG + Intronic
1030991795 7:116309860-116309882 AAGAGGTTGAAGAAATAGGCAGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033804387 7:144937580-144937602 AAGGGGAAGCGGAAAGAGAAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034175235 7:149094428-149094450 TAGGGGTTACAGATATAGGAAGG - Intergenic
1034220841 7:149444955-149444977 AAAGAGTAGCAGAAACAGGTGGG - Intronic
1034402734 7:150876330-150876352 AAGAGGTAGCAAAAAGAGTACGG - Intergenic
1034880568 7:154759441-154759463 AAGGGGCAGCGGCAATAGGACGG + Intronic
1036782091 8:11656794-11656816 CAGGGGTACCAGAAACAGAAAGG + Intergenic
1040052038 8:43024876-43024898 AAGGGGCAGCACAAATGGGGTGG + Exonic
1041139255 8:54797636-54797658 AAGGGTTATCTGAAATTGGAAGG - Intergenic
1041147310 8:54890801-54890823 CATGGGCAGGAGAAATAGGAAGG - Intergenic
1041328029 8:56689831-56689853 AAGAGGTAGCAGAAGTTGTATGG - Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1042429922 8:68693924-68693946 AAGGGGTACCACAAAAAGGGTGG + Intronic
1042631826 8:70825844-70825866 CAGGGGTAGAGGAAAAAGGAAGG - Intergenic
1043095310 8:75961971-75961993 AAAGGGGAGAAGCAATAGGAAGG + Intergenic
1043769805 8:84184097-84184119 AATGGGTATCAAAAACAGGAGGG - Intronic
1044885908 8:96777262-96777284 AAGGTACAGCAGCAATAGGAAGG + Intronic
1045637298 8:104207198-104207220 TGGGCGTAGCAGAAATAGGTAGG - Intronic
1046452457 8:114411928-114411950 AAGGGGTAGGAGCAATGTGAAGG + Intergenic
1047065897 8:121282913-121282935 AAGGGTTGGAAGAAAAAGGAAGG - Intergenic
1047195184 8:122714557-122714579 AAGTGGAAGCACAGATAGGAAGG + Intergenic
1047871288 8:129085447-129085469 AAGGGGTAATAGAAACAGGAAGG + Intergenic
1048085388 8:131172377-131172399 GAGGGTTAGGAGAAATAGAAAGG + Intergenic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049231508 8:141487206-141487228 AATGGGTACAAAAAATAGGAAGG - Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053535036 9:38916942-38916964 AAGGGGTAACAGATATTGTATGG + Intergenic
1054207255 9:62141364-62141386 AAGGGGTAACAGATATTGTATGG + Intergenic
1054631096 9:67446990-67447012 AAGGGGTAACAGATATTGTATGG - Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055129360 9:72756677-72756699 AAGGCATAGCAGAGAAAGGAAGG + Intronic
1055657171 9:78462523-78462545 AAGGGATTGCAGAAAGAAGAAGG + Intergenic
1056456268 9:86763956-86763978 AAGGGGAAGTAGAAAAGGGAAGG + Intergenic
1056586218 9:87929085-87929107 AGGGGGTAGCAGACAGAGGTTGG - Intergenic
1056610664 9:88123858-88123880 AGGGGGTAGCAGACAGAGGTTGG + Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062182239 9:135196696-135196718 AACGGGAAGGAGAAATGGGAAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1187688990 X:21844814-21844836 AAGAGGTAGATGAAAAAGGATGG + Intronic
1188268572 X:28110190-28110212 AAAGGGTAGAAGAAAAAAGAAGG - Intergenic
1188876855 X:35441060-35441082 AAGGGGAAGGAGAAATAGGGTGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189523595 X:41796773-41796795 CAGGTGTTGCAGAAATAGAATGG - Intronic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190303299 X:49068515-49068537 AAGGGGTAGCAGGAATCCGGAGG - Intronic
1190310037 X:49110732-49110754 AAGGGGCAGTATTAATAGGATGG - Intergenic
1191885766 X:65886358-65886380 AAGGGGCAGCAGAAAAAGACTGG + Intergenic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1193585609 X:83318212-83318234 AATGGGTATCAGAAAGAGGTTGG + Intergenic
1194374357 X:93113339-93113361 ATTGGTTAGCAGATATAGGATGG - Intergenic
1194928873 X:99862454-99862476 AAGGGGAAAGAAAAATAGGAAGG + Intergenic
1195495294 X:105524462-105524484 CAGGTTTAGCAGATATAGGAAGG + Intronic
1195816107 X:108890203-108890225 AATGGGTAACAGAAAGATGACGG + Intergenic
1196939947 X:120765672-120765694 TAGGGATAGCAGAAAGAGGTTGG + Intergenic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197861711 X:130978107-130978129 AAGGGGAAGCAGACATGAGAGGG - Intergenic
1198623296 X:138538163-138538185 AAGTGGTATCAGAAAGGGGAGGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199326919 X:146510191-146510213 AGGTGGGAGCAGAAATAGGTGGG - Intergenic
1199669137 X:150127531-150127553 AGGGGGTAGCAGGAATGGGGAGG - Intergenic
1200682387 Y:6227407-6227429 ATTGGTTAGCAGATATAGGATGG - Intergenic
1200691845 Y:6313421-6313443 CTTGGTTAGCAGAAATAGGAGGG - Intergenic
1201043427 Y:9861302-9861324 CTTGGTTAGCAGAAATAGGAGGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic
1201668707 Y:16490812-16490834 AAGGGGTTATAGAAATAGTATGG - Intergenic
1202162212 Y:21946644-21946666 CCTGGTTAGCAGAAATAGGAGGG - Intergenic
1202229144 Y:22639729-22639751 CCTGGTTAGCAGAAATAGGAGGG + Intergenic
1202314010 Y:23556437-23556459 CCTGGTTAGCAGAAATAGGAGGG - Intergenic
1202556792 Y:26114158-26114180 CCTGGTTAGCAGAAATAGGAGGG + Intergenic