ID: 960726305

View in Genome Browser
Species Human (GRCh38)
Location 3:120673850-120673872
Sequence CCTATTTCATAGCTGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960726305_960726310 27 Left 960726305 3:120673850-120673872 CCTCACCACAGCTATGAAATAGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 960726310 3:120673900-120673922 GAAGAACTAGAGGATCCAAGAGG 0: 1
1: 0
2: 3
3: 27
4: 235
960726305_960726309 17 Left 960726305 3:120673850-120673872 CCTCACCACAGCTATGAAATAGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 960726309 3:120673890-120673912 TTTTACGAATGAAGAACTAGAGG 0: 1
1: 0
2: 5
3: 85
4: 815
960726305_960726311 28 Left 960726305 3:120673850-120673872 CCTCACCACAGCTATGAAATAGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 960726311 3:120673901-120673923 AAGAACTAGAGGATCCAAGAGGG 0: 1
1: 0
2: 2
3: 24
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960726305 Original CRISPR CCTATTTCATAGCTGTGGTG AGG (reversed) Intronic
903311430 1:22460528-22460550 CCTATTGCTTAGTTGTTGTGAGG - Intronic
904017478 1:27433660-27433682 CATATTTGCTAGCTGTGGTAGGG - Intronic
906069368 1:43006291-43006313 CCCATTTGTTAGCTTTGGTGGGG + Intergenic
906466154 1:46081601-46081623 CCAGTTTCATTGCTGGGGTGGGG - Intronic
912649430 1:111424810-111424832 CCTATTTCATGGCTGAGGCCTGG - Intronic
914935747 1:151978279-151978301 CCTACTTCATAGTTGTTGGGAGG + Intergenic
915602095 1:156928929-156928951 CCTATTTCATGACTGTCGAGAGG + Intronic
920659636 1:207904555-207904577 CCTATGTCTTAGCTGTTTTGAGG + Intronic
921339028 1:214115870-214115892 CATTTTTCAAAGCTTTGGTGAGG + Intergenic
921901972 1:220460956-220460978 CCTCTTTCATAGTTATGGAGAGG + Intergenic
1063312862 10:4971919-4971941 CCAATTTCAGAGCTGGGATGAGG - Intronic
1063315128 10:4996125-4996147 CCAATTTCAGAGCTGGGATGAGG + Intronic
1063402497 10:5759968-5759990 CTTATTTTATAGGTGTGCTGTGG - Intronic
1063762228 10:9092964-9092986 CCAATGTCATAGCATTGGTGTGG + Intergenic
1064854246 10:19747581-19747603 CATATTTCATATGTTTGGTGTGG - Intronic
1067211134 10:44261121-44261143 CCTGTTCCATAGCAGTGATGAGG + Intergenic
1068359646 10:55960417-55960439 CCTATTTCTTAGTTGTGGCATGG + Intergenic
1068818810 10:61349258-61349280 CCTATCACATAGATGTAGTGAGG + Intergenic
1069189903 10:65474168-65474190 CCAAGTTCATAGCTGTGGAAAGG - Intergenic
1069397640 10:68007462-68007484 CTTATTTCATTGGTTTGGTGAGG + Intronic
1070236320 10:74631123-74631145 CCTATTTCATGGCTGGGGCAAGG - Intronic
1071898863 10:90096197-90096219 CCTATTTAATAGTTTTGCTGAGG + Intergenic
1075395272 10:122122389-122122411 CCTTCTTCATAGCAGTGATGAGG + Intronic
1075767431 10:124904754-124904776 CTTATTTCAAAAGTGTGGTGAGG + Intergenic
1077814555 11:5674321-5674343 CCTATTTCTTAGTTCTGGTGAGG - Intronic
1078423568 11:11231626-11231648 CCTATCTCATAGATCTGGTCAGG - Intergenic
1081778561 11:45694140-45694162 CTTATTTCATAGGTGTGGGGTGG - Intergenic
1083104845 11:60347740-60347762 CCAGTTTCATGGCTGGGGTGGGG - Intronic
1083966323 11:66046077-66046099 CCTAGGTCAGGGCTGTGGTGAGG - Intronic
1084730647 11:71071400-71071422 CATCTTTCATAGCTGCGGTTGGG - Intronic
1085300006 11:75452315-75452337 CCTATTTCACAGCTCTGGAAAGG - Intronic
1085563693 11:77493728-77493750 CCTATTTTATAGGGGTGTTGTGG - Intergenic
1088349963 11:108874986-108875008 CCTATTTCATAGCACTGTTTGGG + Intronic
1088788404 11:113202987-113203009 CATATCTCAGAGCTCTGGTGGGG - Intronic
1090102031 11:123808140-123808162 TCTATATCATAGCTGGGCTGGGG + Intergenic
1091153229 11:133348914-133348936 CCTGTGTCTCAGCTGTGGTGAGG - Intronic
1091794379 12:3289222-3289244 CCTATTTTATAGATTTGTTGTGG + Intergenic
1093993886 12:25620883-25620905 CCTATTGCATAGTGTTGGTGGGG - Intronic
1096863087 12:54543986-54544008 CCTATTTGATAGCTGTTTTGGGG + Exonic
1098260836 12:68668923-68668945 CCTATTTCATAGCATTGCTGAGG - Exonic
1098448697 12:70594584-70594606 CCTAGTTCATGGCGGTGTTGTGG - Exonic
1100779229 12:98006803-98006825 CCTATTTCATAGACTTGTTGGGG - Intergenic
1105844144 13:24280431-24280453 CATTTTTCAGAGCTGTGCTGTGG + Intronic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1105944805 13:25180125-25180147 CCTACTCAGTAGCTGTGGTGGGG + Intergenic
1108558862 13:51623443-51623465 CCTAATTCATAGCAGTTGTGAGG + Intronic
1109423361 13:62142692-62142714 CCTATATCATTGCTGTAGTGTGG + Intergenic
1109662287 13:65478383-65478405 CTTATTTCATAGTTTTGTTGTGG - Intergenic
1110352768 13:74528944-74528966 ACTATTGCATTGCTGTGGTTGGG + Intergenic
1113034147 13:106030151-106030173 ACTATTTCAAAGCTGTGGCAGGG + Intergenic
1113215642 13:108037782-108037804 CCTTATCCATAGGTGTGGTGTGG + Intergenic
1113738419 13:112694226-112694248 CTCATTTCATAGCTATTGTGAGG + Intronic
1115116873 14:29891136-29891158 CCTATTACATAGCTGTCCTTTGG - Intronic
1115272070 14:31563915-31563937 CCTACTTCATAACTGTGATCAGG - Intronic
1117496743 14:56312903-56312925 CCATTTCCATAGCTGTGGTGTGG - Intergenic
1122211298 14:100175733-100175755 AGTATTTCAGAGCTGTGGTTTGG - Intergenic
1122402316 14:101474787-101474809 CCTACTTCCTGGCTGTTGTGAGG + Intergenic
1131344016 15:91629406-91629428 ACTATTACATAGCTGTGGAAAGG + Intergenic
1135099419 16:19593261-19593283 CCTATTTCCTGGTTCTGGTGGGG - Intronic
1136359850 16:29771982-29772004 GCAATTTCAGACCTGTGGTGGGG - Intergenic
1137227483 16:46528559-46528581 ACTATTCCATAGCTTTGGAGAGG - Intergenic
1137504117 16:49036197-49036219 CCTCTCTCCTGGCTGTGGTGTGG - Intergenic
1137781898 16:51104256-51104278 CCTGTTTCCTTCCTGTGGTGGGG + Intergenic
1138455667 16:57119329-57119351 CCTTTTTCAGAGCTGTGGAGGGG - Intronic
1139276215 16:65729855-65729877 CCTGTTTCATAGCATTGCTGGGG + Intergenic
1140270768 16:73464729-73464751 CCAATGTCACAGCTGTGCTGGGG + Intergenic
1142918711 17:3165235-3165257 GCTATTTCAAAGCTGAGGTCTGG - Intergenic
1143449275 17:7026219-7026241 CCTCTTCAATAGCAGTGGTGGGG - Intronic
1144194597 17:12878032-12878054 GCTAATTCATAACTGAGGTGTGG - Intronic
1146495472 17:33318375-33318397 CCTACTGCAGAGCTGTGATGAGG + Intronic
1146709110 17:35025483-35025505 CCTATATCATAGCTATTGTGAGG + Intronic
1147259585 17:39201105-39201127 CTTATTTCGCGGCTGTGGTGTGG + Intronic
1147807512 17:43142260-43142282 CCTATTACAGAGCTGGTGTGGGG + Intergenic
1148083493 17:44980306-44980328 CCTGTTTCCTATCTGAGGTGGGG + Intergenic
1149037574 17:52152816-52152838 CCTATTTCAAAGCATTGCTGAGG - Intronic
1149543463 17:57485939-57485961 TCTATTGCATTGGTGTGGTGTGG - Intronic
1149735606 17:58990862-58990884 TCTTTTTCTTAGGTGTGGTGTGG - Intronic
1149944999 17:60915419-60915441 CCTGTATCTTAACTGTGGTGGGG - Intronic
1152486579 17:80598335-80598357 CTTATTTAATAGAAGTGGTGGGG + Intronic
1157302612 18:46490010-46490032 CATATTTGATAGCTGTGCTATGG - Intronic
1157501588 18:48194433-48194455 CCACTTTCATAGCTGGGGGGAGG + Intronic
1157927405 18:51781244-51781266 CCTGTTTTCTAGATGTGGTGGGG + Intergenic
1160279128 18:77470785-77470807 CCCATCTCAAGGCTGTGGTGAGG + Intergenic
1160372637 18:78387514-78387536 ACTTTTGCATTGCTGTGGTGAGG - Intergenic
1160848428 19:1177537-1177559 CATATTTCATAGCTTGGGTTAGG + Intronic
1162442651 19:10702318-10702340 CCTGTTTTTTAGCTGTTGTGTGG + Intronic
1162796480 19:13089994-13090016 CCTTTTTCACAGCTGGGATGAGG - Intronic
1166779993 19:45336952-45336974 CCTACTTTAAGGCTGTGGTGAGG - Intronic
1167912986 19:52719353-52719375 CCCTTTTCATGGCTGGGGTGGGG - Intronic
1168569503 19:57453842-57453864 CCATTTTCATAGATGTGTTGTGG + Intronic
928153797 2:28857594-28857616 CCTATTTCATAGAGTTGTTGAGG - Intronic
928482111 2:31693375-31693397 CCTGTTTTTTAGCTGTGGTTAGG + Intergenic
929690942 2:44072624-44072646 CCCATATCATAGCTATTGTGAGG - Intergenic
931104188 2:59036317-59036339 CCTACTTCATAGGTTTGCTGTGG - Intergenic
932881089 2:75502935-75502957 CCTATGTAATAGGTGGGGTGAGG - Intronic
933012239 2:77080977-77080999 CCTAGTACATAGCTGGGTTGTGG - Intronic
934279124 2:91595904-91595926 CCTATCTCATAGGGGTGCTGAGG - Intergenic
938384301 2:130853503-130853525 CCTGTTTCACAGGTGTTGTGAGG + Intronic
940769157 2:157821951-157821973 CCTGTTGCTTAGCTGTTGTGTGG - Intronic
941663908 2:168224536-168224558 TCTATTTGATTGCTTTGGTGAGG - Intronic
945858714 2:215096240-215096262 CCTACTTCATAGCATTGTTGGGG - Intronic
1169218995 20:3810330-3810352 TCTATATCACAACTGTGGTGGGG - Intergenic
1169521853 20:6382469-6382491 ACCATTTCACAGATGTGGTGAGG + Intergenic
1174310257 20:49647576-49647598 CACATATCATAGCTGTGGTTAGG + Intronic
1183216530 22:36483807-36483829 CCTTTCTCATAGCTGGGCTGAGG + Intergenic
950539392 3:13601062-13601084 CCTATTTCACAGATGAGCTGGGG - Intronic
954461281 3:50628349-50628371 CATATTTCATTGCTGCTGTGGGG + Intronic
955156443 3:56421397-56421419 CCTTTTCCATAGCTCTGCTGAGG + Intronic
955824193 3:62927799-62927821 CCTATGTCATAGTTGTTGTGAGG + Intergenic
956803275 3:72783177-72783199 CCCATTTTATAGCTGTGGCTGGG - Intronic
959111795 3:102131658-102131680 CCTAATTTAGAGCTGTTGTGAGG - Intronic
960726305 3:120673850-120673872 CCTATTTCATAGCTGTGGTGAGG - Intronic
960984334 3:123263992-123264014 CCCAGTTCAAAGCTGCGGTGAGG - Intronic
961937559 3:130601633-130601655 CATATTTCATGGGAGTGGTGTGG - Intronic
965148170 3:164933377-164933399 ACTATTTCATAGCTCTGTTTGGG + Intergenic
966959929 3:184925504-184925526 CCTATTTTAGAGCTGTTGAGAGG - Intronic
969031665 4:4220570-4220592 CCTATCTCATAGGGGTGCTGAGG + Intronic
969973225 4:11069948-11069970 CCTGTTTCATAGCTGCAATGTGG - Intergenic
975715263 4:77199441-77199463 CCTGTGTCAGAGCTGTGGGGAGG + Intronic
975760711 4:77617280-77617302 ACTATTTCAAAGCTGTGGGCAGG + Intergenic
977080327 4:92519053-92519075 AGTATGTCATAGCTGGGGTGAGG + Intronic
977696125 4:99968604-99968626 ACTCTTTCTTAGCTGTAGTGGGG - Intergenic
979076326 4:116275290-116275312 CACATTTGTTAGCTGTGGTGGGG - Intergenic
979126655 4:116981141-116981163 CCTGTTTGATAGCTGTGGGTGGG - Intergenic
986823729 5:11497828-11497850 CCTATTCCATGGCAGTGGGGTGG - Intronic
988085164 5:26466764-26466786 GCTACTTCATTGCTGAGGTGAGG - Intergenic
988151485 5:27387653-27387675 AATTTTTAATAGCTGTGGTGGGG + Intergenic
988470478 5:31532593-31532615 CCTATTCCGTTGCTGTGGAGAGG + Intronic
990170807 5:53047659-53047681 CCTATTTCATACCCGTGGGCAGG + Intronic
990479203 5:56191800-56191822 CCTATTTCCTTGTTGTGCTGTGG - Intronic
996241973 5:121215264-121215286 CCTGTTTCATAGTTGAGGTGGGG - Intergenic
999690213 5:154139955-154139977 CCTATTTCATAGGTGAGGACTGG - Intronic
1004545983 6:16598760-16598782 CCTGTTTCACAAATGTGGTGAGG + Intronic
1005296853 6:24435309-24435331 CCAATTTCATAGCTTTTATGGGG + Intronic
1005507671 6:26483964-26483986 GCTACTGCAGAGCTGTGGTGGGG - Intergenic
1007132541 6:39489449-39489471 CTTATTTCTTACTTGTGGTGAGG + Intronic
1008012832 6:46487400-46487422 CCTACTTCATAGCTTTGATAGGG - Intronic
1010772031 6:79842952-79842974 CCTATTTCATAGGTTTGTTGAGG + Intergenic
1011421526 6:87178626-87178648 CCTATTTCAGAGAGGTGCTGAGG - Intronic
1011774636 6:90716144-90716166 CCTGTTTGATAGGAGTGGTGAGG - Intergenic
1013286411 6:108686044-108686066 CCTATATCCCAGCTGTGGTATGG - Intergenic
1013549880 6:111196967-111196989 CTTATTTCAGAGTTCTGGTGTGG - Intronic
1013746449 6:113352241-113352263 CATATTTCTTGGCTGTGGTCAGG - Intergenic
1014647563 6:123993048-123993070 CCTATGTCATGGGTGTTGTGAGG + Intronic
1016901939 6:149111667-149111689 CCTACCTCATGGCTTTGGTGTGG + Intergenic
1017358244 6:153535579-153535601 CCTATCTCAGAGATGTTGTGAGG - Intergenic
1017667328 6:156733142-156733164 CCTATTTCATAGAGTTGGGGTGG + Intergenic
1027423865 7:78042628-78042650 CCTACCTCATAGTTGTTGTGAGG + Intronic
1034222530 7:149457817-149457839 CCTGTTTCATAGATTTTGTGAGG - Intronic
1039723428 8:40189500-40189522 CTTATTTCATGGCTTTGGTATGG - Intergenic
1039917960 8:41873710-41873732 CATATTGCACAGCTGTGGAGTGG + Intronic
1040526202 8:48227237-48227259 CCTGCTTCTTAGCTGTGGTCAGG - Intergenic
1041878196 8:62714702-62714724 CCTATTTCATACTTGTAGTGAGG - Intronic
1043199754 8:77351860-77351882 CATATTACATATGTGTGGTGGGG - Intergenic
1047156400 8:122324065-122324087 CCTAATGCATAGTTGTGGGGAGG - Intergenic
1047726237 8:127686371-127686393 CCTCTTTCAGAGTTGTTGTGAGG - Intergenic
1057849597 9:98555049-98555071 CCCATTTCAGGGCTGTCGTGAGG + Intronic
1058815421 9:108678483-108678505 CACATTTCCTTGCTGTGGTGAGG - Intergenic
1062095787 9:134702440-134702462 CCCGTTTCATGGCTGAGGTGGGG + Intronic
1188143469 X:26581346-26581368 CCTATTTAATAGTTGTGGTTTGG - Intergenic
1188249560 X:27876184-27876206 ACCATTTCATTGCTGTGGGGTGG + Intergenic
1188800098 X:34518768-34518790 CCTATTTCATAAATATGGGGGGG + Intergenic
1189685312 X:43557628-43557650 CCTTTTTGATAGATGAGGTGAGG + Intergenic
1190465665 X:50723291-50723313 TCTATTTCAGAAATGTGGTGGGG + Intronic
1192269252 X:69563445-69563467 CCTATCATATGGCTGTGGTGAGG + Intergenic
1192343751 X:70284334-70284356 CCTTTTTCCTAGCTTTGCTGGGG + Intronic
1195239829 X:102939951-102939973 CCTGTTTCATATTGGTGGTGGGG - Intergenic
1195297884 X:103498096-103498118 CCTGTTTCATATTGGTGGTGGGG + Intergenic
1195376587 X:104233968-104233990 CAAATTTCATAAATGTGGTGGGG + Intergenic
1195431964 X:104798851-104798873 CCTTTTTCATTGCTCTGGAGGGG + Intronic
1195520021 X:105820192-105820214 CCTATTTCAAGGCTGTGCTCGGG + Intergenic
1196581102 X:117379974-117379996 CCTTTTTCAAAGCAGTGCTGTGG - Intergenic
1201938374 Y:19432171-19432193 CCTCTTTTTTAGCTGTGGTTAGG + Intergenic