ID: 960728478

View in Genome Browser
Species Human (GRCh38)
Location 3:120696868-120696890
Sequence GTGGCAGCTGAGAAAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960728474_960728478 6 Left 960728474 3:120696839-120696861 CCTGGGGTATGCACATCAAATAT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 960728478 3:120696868-120696890 GTGGCAGCTGAGAAAAATGAGGG 0: 1
1: 0
2: 2
3: 38
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960728478 Original CRISPR GTGGCAGCTGAGAAAAATGA GGG Intronic
900613106 1:3552806-3552828 GTGGCTGCAGAGAAAAGTGGGGG - Intronic
901705693 1:11071367-11071389 GTGGCATGTGAGAAAAGGGAAGG - Intronic
902284017 1:15394723-15394745 TTGGCAGATGAGGAAACTGAGGG + Intronic
905472245 1:38202177-38202199 GAAGCAGGAGAGAAAAATGATGG + Intergenic
905766058 1:40602123-40602145 GTGGCAGCAGAGAGCAATGGAGG - Intergenic
905840171 1:41169903-41169925 GTGGAAGCTGTGAAAGCTGAGGG + Intronic
906803765 1:48759988-48760010 GTTACAGGTGAGAAAACTGAGGG + Intronic
907177463 1:52538357-52538379 TTGGCAACTGAGAAAAAAAAAGG + Intronic
907224610 1:52933692-52933714 TTGGCAGCTGTCAAAAATGATGG - Intronic
907718917 1:56953472-56953494 TTTGCAGATGAGAAACATGAGGG + Intronic
907938660 1:59065938-59065960 GTGGCAGATGAGTCAAATGGTGG + Intergenic
907981968 1:59491771-59491793 GTGGCATGTGAGAAAAATACAGG + Intronic
908575726 1:65457723-65457745 GTGGATGCTGAGAAAAAAGGTGG - Intronic
908599826 1:65726610-65726632 GTGACAGATGAGAAAAAGAAAGG + Intergenic
909440746 1:75692932-75692954 CTGCCAGCTGAGAATAGTGAAGG + Intergenic
909997944 1:82304374-82304396 TTGGCAGATAAGAAAAATAATGG - Intergenic
910055448 1:83028332-83028354 GTGGCACCAGGGAAAGATGATGG - Intergenic
910250121 1:85188560-85188582 GAGGGAGCTGAGAAAATTCAGGG + Intronic
910670934 1:89772039-89772061 GTGGCAGCTTTAAAATATGATGG - Intronic
910837902 1:91534152-91534174 TTGGCACCTAAGAAACATGACGG + Intergenic
911130771 1:94385394-94385416 GAGCAAGCTGAGAAAAAAGAGGG + Intergenic
913111907 1:115664521-115664543 TTGGCAGCTCCCAAAAATGATGG + Intronic
913500066 1:119464336-119464358 GTGGCAACTGATAAGCATGAGGG + Intergenic
915153228 1:153852265-153852287 GGGGCAGCTGCAGAAAATGAAGG - Intronic
916413115 1:164567068-164567090 GTGGCAGGCGAGAATAATAAGGG - Intronic
916979157 1:170114976-170114998 ATGGCAGTAGAGAAAAATGCAGG + Intergenic
919515297 1:198514868-198514890 TTGTTTGCTGAGAAAAATGATGG + Intergenic
920718592 1:208365552-208365574 TTAGCAGCTGAGAAAACTGGGGG - Intergenic
921247130 1:213256355-213256377 GTGGCACCTGAGATAACTGCTGG - Intronic
921860463 1:220037546-220037568 GTGACAACTTAGAAAAATAAAGG + Intronic
924910754 1:248510759-248510781 GTGCCATCTGAAAAAGATGATGG - Intergenic
924913347 1:248537281-248537303 GTGCCATCTGAAAAAGATGATGG + Intergenic
1064921565 10:20525081-20525103 GTGGCATTTGAAAGAAATGAGGG + Intergenic
1066591706 10:37001794-37001816 ATGGCAGCTGAGAAAGACCAAGG + Intergenic
1068094804 10:52477960-52477982 CTGGCAACTGAAAAAAATAAAGG - Intergenic
1068283596 10:54908508-54908530 GTTGCAGGTGACAAAAAGGAGGG - Intronic
1068398537 10:56496872-56496894 GTGGCAGATGAGCAGAATGCAGG - Intergenic
1069080900 10:64087175-64087197 GTGGCAGCTAAGGAAGAGGATGG - Intergenic
1069111209 10:64449219-64449241 ATGTCATCTGAGAATAATGATGG - Intergenic
1069284410 10:66694779-66694801 ATGGCAGCTGAGAACAATAGTGG + Intronic
1069599964 10:69697718-69697740 GTAACAGCTGAGGAAACTGAAGG + Intergenic
1069702892 10:70439531-70439553 TTTGCAGATGAGAAAACTGAAGG + Intronic
1070637553 10:78141400-78141422 GTGGCAGGAGACAAAAATGTGGG - Intergenic
1071198288 10:83187270-83187292 GTGTCAGCTGAGAAGTTTGATGG + Intergenic
1071424165 10:85531791-85531813 GAGGGAACTGAGAATAATGAAGG - Intergenic
1072989225 10:100174943-100174965 GTGGCATGTGAGGAAACTGATGG - Intronic
1073028481 10:100506116-100506138 GAGGCAGCAGAGAACACTGAAGG + Exonic
1073295806 10:102437943-102437965 TTTGCAGATGAGAAAACTGAGGG - Intergenic
1073699441 10:105909132-105909154 GTGGCAGATGTGGATAATGAAGG - Intergenic
1074041614 10:109795311-109795333 ATGGTGGCTGAGAAAAAGGAAGG - Intergenic
1074429055 10:113377806-113377828 GTGACAGCTGACCAAAATGGAGG + Intergenic
1074679723 10:115892754-115892776 CAGGCAGCTGGGAAAAAAGAAGG + Intronic
1074836409 10:117300182-117300204 GTGGCAGCTTTTTAAAATGAGGG - Intronic
1075166707 10:120074567-120074589 GTGGTGGCTGAGAAGGATGAGGG - Intergenic
1078668699 11:13346533-13346555 TTGGCAGCTGAGAAAGGTGAGGG - Intronic
1079119186 11:17668412-17668434 GTGGCAGTGGAGAAAAGAGAGGG + Intergenic
1079157422 11:17961127-17961149 TTGGCAGGTGAAAAAAATTAAGG + Intronic
1080153509 11:29079648-29079670 GTGGCAGAAAGGAAAAATGAGGG - Intergenic
1081996969 11:47371990-47372012 GTGGCAGCTGAGCTAAGAGAAGG - Intronic
1083887773 11:65581195-65581217 CTGGCAACTGAGAAGAAAGAGGG - Exonic
1085351353 11:75799987-75800009 GTGACAGATGAGGAAACTGAGGG + Intronic
1085896588 11:80647444-80647466 ATGGCAGCTGAGAAAGACCAAGG - Intergenic
1087030635 11:93700882-93700904 GTGTCACTTGAGAAAAAAGATGG - Intronic
1088080122 11:105902052-105902074 GGGGTAGCTGAGAAAAATTAAGG - Intronic
1088521421 11:110705266-110705288 GGGAGAGCTGAGAAAACTGATGG - Intronic
1088725219 11:112628595-112628617 GTGGAAGATGAGACCAATGAAGG - Intergenic
1088951852 11:114579681-114579703 TTGACAGATGAGAAAACTGAGGG + Intronic
1089587404 11:119519290-119519312 GTGGCAGCTGAGATGAAGGCGGG + Intergenic
1089678444 11:120106110-120106132 TTGGCAGATGAGAAAACTGAGGG + Intergenic
1090516274 11:127431054-127431076 GAGGCTGCAGAGAAAAAGGAAGG - Intergenic
1090539448 11:127684605-127684627 GTGGCTGCGGTGAAAAATGAAGG + Intergenic
1090600996 11:128371210-128371232 TCAGCAGCTGAGAAAAATTAAGG - Intergenic
1091099939 11:132862629-132862651 CAGGCAGCTGAGAAAGATGGTGG + Intronic
1091107967 11:132940850-132940872 GGAGCATCTGATAAAAATGAAGG + Intronic
1091203360 11:133800036-133800058 GTGGCAGGTGAGAAAAGGCAAGG + Intergenic
1091417770 12:304571-304593 TTGACAGCTGAGAAGAATGGTGG - Intronic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1093897508 12:24591301-24591323 GTGGCTGCTGAGAAAGCTAATGG - Intergenic
1097285858 12:57876722-57876744 GTGGCTGCAGAGACAAACGAGGG - Intergenic
1097340541 12:58432575-58432597 TTGTCAGCTCAGAAAAATGATGG + Intergenic
1097625714 12:61997698-61997720 ATGACAGCAGAGAAAGATGAAGG + Intronic
1097918879 12:65050019-65050041 GTGTCTGCTGAGAAAAAGGAAGG + Intergenic
1099103407 12:78471424-78471446 GTGACTGGTGAGAGAAATGAGGG - Intergenic
1099871123 12:88350573-88350595 GTGGCAGCTGAAAAATATTGTGG - Intergenic
1101095468 12:101334638-101334660 GAGGCAGCTGAGTAAAAGCAAGG + Intronic
1102168651 12:110825429-110825451 ATGGAAGTTTAGAAAAATGAAGG - Intergenic
1103085849 12:118061271-118061293 GGGGCAGCTGAGGGAAAAGATGG + Intronic
1103243204 12:119432261-119432283 CAGGCAGCTGAGAAAGAAGATGG + Intronic
1104748416 12:131223867-131223889 GTGCAAACTGAGAATAATGAAGG - Intergenic
1105398806 13:20069275-20069297 GTGGCAGGAGAGAAAAATGGGGG - Intronic
1106489612 13:30207555-30207577 GCTGGAGCTGAGAAAAATAATGG + Exonic
1106504072 13:30356080-30356102 GTGGCAGCTGAGAGGCAGGAAGG - Intergenic
1106819893 13:33452962-33452984 GTGGCAGCTGTGATTACTGAAGG - Intergenic
1107026571 13:35807987-35808009 ATGGCACCTGAGAGAGATGAAGG + Intronic
1107107949 13:36667130-36667152 GTTGCAGGAGATAAAAATGAAGG + Intergenic
1107237260 13:38186826-38186848 GTGACAGCTGAGAAAACAAAGGG - Intergenic
1109345608 13:61112071-61112093 GTGGAAAAAGAGAAAAATGAAGG - Intergenic
1109688794 13:65858355-65858377 GTGGCAACTGAGAAGAATGCAGG - Intergenic
1109981298 13:69912095-69912117 ATGGAACCTCAGAAAAATGAGGG + Intronic
1110542480 13:76721483-76721505 GTGGCAGAAGAGAAACAAGAAGG - Intergenic
1111107016 13:83659429-83659451 GTTGCTTCTGAGAAATATGATGG + Intergenic
1111500151 13:89108176-89108198 GTGGGAGCCAAGAAAAATGATGG - Intergenic
1111948390 13:94689738-94689760 CTGGCAGCTGAGAAATTTTAAGG + Intergenic
1112134126 13:96556914-96556936 GCTGCTGCTGACAAAAATGAGGG - Intronic
1112207552 13:97339619-97339641 CTGGCGGCTGAGAAAAGAGAAGG - Intronic
1114574891 14:23703381-23703403 GTCCCAGCTAAGAAATATGAAGG - Intergenic
1114960805 14:27886489-27886511 GTGGCAGCTAAGGAACTTGAGGG - Intergenic
1115157670 14:30359027-30359049 GTGGTAGCTGAGGAAATTAATGG - Intergenic
1115863207 14:37712641-37712663 GTGGCAGCAAGGAGAAATGATGG + Intronic
1116955887 14:50922778-50922800 GTGCCACCTGTGAAAAGTGAAGG - Intronic
1117164453 14:53019700-53019722 GTGGTTGGTAAGAAAAATGAGGG - Intergenic
1117201730 14:53396694-53396716 GTGGTGGCTGAGAGAGATGAAGG + Intergenic
1117760797 14:59026227-59026249 TTGGCAGCTGTGCAGAATGAAGG + Intergenic
1117861287 14:60095022-60095044 GTGTCAGTCGAGAAAAATGATGG + Intronic
1117965836 14:61205975-61205997 GTGGATGCTGAGAAAAGTGCTGG - Intronic
1118634928 14:67739587-67739609 TTGGCAGATGAGGAAATTGAGGG - Intronic
1119286848 14:73462152-73462174 GTGGAGGCTGACAAAGATGAAGG + Intronic
1119768705 14:77206664-77206686 GTGGGAGCTGATCAGAATGAGGG + Intronic
1120226826 14:81800045-81800067 CTGGCAGATGAGAAAACTGAAGG + Intergenic
1120829416 14:88984836-88984858 GTGGCAGCTGGGAAGGCTGATGG + Intergenic
1121345483 14:93132661-93132683 TTCCCAGCTGAGAAAACTGAAGG + Intergenic
1121661515 14:95638726-95638748 GTGGCACCTGAGGGAAATGAGGG + Intergenic
1121878576 14:97478338-97478360 TTGACAGATGAGAAAATTGAAGG + Intergenic
1121967901 14:98327277-98327299 GGGGCAGCTCAGAAAACAGAAGG + Intergenic
1125119006 15:36130483-36130505 GTTAGAGATGAGAAAAATGAAGG + Intergenic
1125379076 15:39068023-39068045 GTGGCAGGTAAGGGAAATGAAGG + Intergenic
1125517441 15:40330297-40330319 GTGGCAACTGTCAAAAATAATGG - Intergenic
1125919287 15:43515970-43515992 GTGGCAGCTGAGAATATGGGTGG + Intronic
1126205628 15:46041872-46041894 GTGGCAGCTGAGAGATAAAAGGG - Intergenic
1126953318 15:53906865-53906887 GTGGCAGGAGAGAAGAGTGAAGG + Intergenic
1128780370 15:70355137-70355159 GTGGCAGCTGATGAGAAGGAGGG + Intergenic
1129776188 15:78237897-78237919 GTGGTAGGTGAAGAAAATGAAGG - Intronic
1131035229 15:89217766-89217788 GAGGCAGCAGAGTGAAATGATGG - Intronic
1131679970 15:94710911-94710933 TTCCCAGCTGAGAAAACTGAAGG - Intergenic
1132000486 15:98174475-98174497 GTGGCACCTGGGAGACATGAAGG - Intergenic
1133532222 16:6665840-6665862 GTTACAGATGAGAAAAATGAGGG + Intronic
1133617849 16:7495448-7495470 GAGGCTGCAGAGAAAAAGGATGG - Intronic
1134248160 16:12555328-12555350 TTGGCACCTGAGAAACATGTTGG + Intronic
1135226908 16:20668651-20668673 GTGCTTGCTGAGAAAAATGGAGG + Intronic
1135374975 16:21938184-21938206 GAGGAAAATGAGAAAAATGAAGG + Intergenic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1138359563 16:56416192-56416214 GTGGGAAATCAGAAAAATGAGGG + Intronic
1138733149 16:59218538-59218560 CTGTCACCTAAGAAAAATGATGG + Intergenic
1139614811 16:68082559-68082581 GTGGCAGCTGATGATAATGATGG + Intergenic
1140224932 16:73069390-73069412 GTTGCACCTGGGAAAAAGGAGGG - Intergenic
1140336007 16:74105778-74105800 GTGGAAAATGAGAAAAATGAAGG + Intergenic
1141087731 16:81108862-81108884 GTGGCAGCCGTGGAAAGTGAGGG - Intergenic
1141380703 16:83574062-83574084 TTCGCAGCTGGGAAAATTGAGGG - Intronic
1142675364 17:1509961-1509983 TTGGCAGCTGAGAAGAAGAATGG - Intronic
1142900466 17:3008333-3008355 GAGGCTGCTGAGAAAACTGCTGG - Intronic
1143901273 17:10176528-10176550 TTGACAGCTGAAAAAACTGAAGG + Intronic
1144281183 17:13728342-13728364 ATGGCTGCTGTGAAAAATGCTGG + Intergenic
1144832407 17:18139149-18139171 GGGGCAGGTGTGAAAAATGTAGG + Intronic
1145298870 17:21615573-21615595 GTGGCAGAAAAAAAAAATGAAGG - Intergenic
1145403561 17:22567525-22567547 GTGGCAGAGAAAAAAAATGAAGG + Intergenic
1145723357 17:27092310-27092332 GTGGCAGAGAAAAAAAATGAAGG - Intergenic
1145799454 17:27673707-27673729 TGGGCAGCTGTGGAAAATGAAGG - Intergenic
1146159561 17:30552608-30552630 TGGGCAGCTGTGGAAAATGAAGG + Intergenic
1146844825 17:36175922-36175944 TGGGCAGCTGTGGAAAATGAAGG - Intronic
1146857130 17:36263857-36263879 TGGGCAGCTGTGGAAAATGAAGG - Intronic
1146863485 17:36324518-36324540 TGGGCAGCTGTGGAAAATGAAGG + Intronic
1146873042 17:36387767-36387789 TGGGCAGCTGTGGAAAATGAAGG - Intronic
1146880400 17:36438853-36438875 TGGGCAGCTGTGGAAAATGAAGG - Intronic
1146928609 17:36762186-36762208 GGGGCAGATGAGAAGAAGGAGGG + Intergenic
1147066345 17:37925106-37925128 TGGGCAGCTGTGGAAAATGAAGG + Intronic
1147075925 17:37988392-37988414 TGGGCAGCTGTGGAAAATGAAGG - Intronic
1147077878 17:38004667-38004689 TGGGCAGCTGTGGAAAATGAAGG + Intronic
1147087450 17:38067938-38067960 TGGGCAGCTGTGGAAAATGAAGG - Intronic
1147093814 17:38128602-38128624 TGGGCAGCTGTGGAAAATGAAGG + Intergenic
1147103394 17:38191901-38191923 TGGGCAGCTGTGGAAAATGAAGG - Intergenic
1147538972 17:41340714-41340736 CTGGCTGCTGTGAAACATGAGGG - Intergenic
1147958920 17:44154353-44154375 GAGGCAGGGGAGAGAAATGAAGG + Intronic
1148330382 17:46810574-46810596 TTTGCAGATGAGAAAACTGAGGG + Intronic
1148546573 17:48523851-48523873 TTAGCAGCTGAGAACACTGAAGG - Intergenic
1149353066 17:55811516-55811538 TTGGCAGCCGAGCAAAGTGAAGG - Intronic
1149534547 17:57422522-57422544 GTCACAGGTGAGGAAAATGAGGG + Intronic
1149847968 17:60018370-60018392 TGGGCAGCTGTGGAAAATGAAGG - Intergenic
1150264193 17:63821324-63821346 GTTGCAGCTGAGAGAAGGGATGG - Intronic
1151280270 17:73068800-73068822 CTGGCAGTTGAGAAACAGGATGG - Intronic
1151775486 17:76198357-76198379 TTGGGAGCTTGGAAAAATGATGG + Intronic
1153303060 18:3608598-3608620 TTGGCAATTGAGAAAACTGAAGG + Intronic
1153435186 18:5061453-5061475 CTAGCAGCTGGGAAAGATGAGGG - Intergenic
1153976103 18:10269732-10269754 CTGGCAGGGGAGAAAAATGTGGG - Intergenic
1154140947 18:11823698-11823720 GTGGCAGCTGATAAGCATGAAGG + Intronic
1155620064 18:27768187-27768209 GTGCCAGCTGAGAAAGGTGTTGG + Intergenic
1155694944 18:28674279-28674301 CTGGCAGCTAAGAAAAAAAAGGG - Intergenic
1156448958 18:37255784-37255806 GTGGATGATGAGAAGAATGAGGG - Intronic
1157165568 18:45355601-45355623 CTGGCAGCTAAAAAAAATCAGGG - Intronic
1157441730 18:47716892-47716914 GTGTCAGCTGGGAAAAAAGGAGG - Intergenic
1157461624 18:47902127-47902149 GTGGCAGATTGGAAATATGAGGG - Intronic
1157619686 18:49009090-49009112 GAGGCAGCTGAAAAAGATGAAGG + Intergenic
1158169461 18:54580448-54580470 GTGGTAGCTGTAAAAATTGAAGG - Intergenic
1162024864 19:7888259-7888281 CTGGCAGCTGGGGAAACTGAGGG - Intergenic
1163239410 19:16050973-16050995 GTGTTTGCTGATAAAAATGAAGG + Intergenic
1164699196 19:30270728-30270750 ATGGTAGCTGGGAAAAATGCAGG + Intronic
1167141254 19:47652098-47652120 GTGGCATGTGAGAAAAATAGGGG + Intronic
925295276 2:2772319-2772341 GTGGAAGCAGAGACTAATGATGG - Intergenic
926494647 2:13570421-13570443 TTTGCTGCTGAGAAAAACGAAGG + Intergenic
926823135 2:16875564-16875586 GTTGGAGCTTGGAAAAATGAGGG + Intergenic
926838625 2:17052722-17052744 GTAGCAACTGACAAAAAAGAAGG + Intergenic
926886097 2:17600240-17600262 TTGACAGGTGAGAAAACTGAGGG - Intronic
928247688 2:29645435-29645457 TTGGAATCTGAGAAAAATGTGGG - Intronic
929080720 2:38119537-38119559 GTGACAGCTGGGATAAATGTGGG - Intergenic
929668088 2:43849368-43849390 GTGGCAGGAGAGAAGAATGAGGG + Intronic
930509001 2:52321202-52321224 ATGGCATCTAAGAAAAAGGAAGG - Intergenic
930866892 2:56130805-56130827 ATGTCAGCTGTGAGAAATGAGGG + Intergenic
931614976 2:64146208-64146230 GTGGCAGAAGAGAAAACTGAGGG + Intergenic
931848596 2:66230484-66230506 GTGGCAGGAGAGAAAAAGTAGGG + Intergenic
931874305 2:66495653-66495675 ATGGCAGATGAGGAAAATGCAGG + Intronic
931985096 2:67733768-67733790 GTGGCAGCTGAAACAAATCAGGG + Intergenic
932902494 2:75715498-75715520 CTGGAATCTGAGAGAAATGAGGG + Intergenic
933558240 2:83858584-83858606 GTGGCAGATGAGCAAAGAGAGGG - Intergenic
936657127 2:114501205-114501227 GTGCCAGCTGAGACAAATGGAGG - Intronic
936922394 2:117702259-117702281 GTGGGAGGTAAGATAAATGATGG - Intergenic
937360205 2:121224372-121224394 CTTGCAGCTGAGAGCAATGATGG - Exonic
937408618 2:121653104-121653126 TTGGCAGATGAGGAAATTGAGGG + Intergenic
937825908 2:126368374-126368396 GAGGAAGTTGAGAAAAAGGAAGG + Intergenic
938124182 2:128659935-128659957 GTGGCAGCTGTGGATAAGGAAGG - Intergenic
939183301 2:138828987-138829009 GTGGCACCTTAGACAAGTGAAGG - Intergenic
939936508 2:148299544-148299566 GTTTCACCGGAGAAAAATGAAGG + Intronic
941125331 2:161577627-161577649 CTGGAAGGAGAGAAAAATGAGGG - Intronic
942489430 2:176474952-176474974 GGGACAGCTAAGAAATATGAAGG - Intergenic
942884099 2:180901374-180901396 GTAAAAGCTGAGAAAAAGGAAGG + Intergenic
944008799 2:194945545-194945567 GTGGAGGCTGAGAGAAATGAGGG - Intergenic
945814513 2:214587702-214587724 ATGGGAGCTGAGAAAAGAGATGG - Intergenic
945995998 2:216436449-216436471 GTGGGAGCTTAGAGAAAGGAAGG + Intronic
946762159 2:223005320-223005342 TTTGCAGATGAGAAAACTGAGGG + Intergenic
946933911 2:224699857-224699879 GCGGCAGGAGAGAAAAGTGAAGG - Intergenic
1170390386 20:15866701-15866723 ATGGCATCTCTGAAAAATGATGG - Intronic
1170493689 20:16903678-16903700 GGGGCAAGTGACAAAAATGAAGG + Intergenic
1170510885 20:17075632-17075654 GGGGCAGCAGAGAAAAAGAATGG - Intergenic
1170511006 20:17076663-17076685 GGGGCAGCAGAGAAAAAGAATGG - Intergenic
1171334052 20:24367380-24367402 TTGACACCTGATAAAAATGAAGG - Intergenic
1171492848 20:25533252-25533274 GTGGGAGAGGAGAATAATGAAGG + Intronic
1171993065 20:31711415-31711437 CTGGCAGCTGAGGAGAAGGATGG + Intronic
1172159090 20:32852919-32852941 GTGCCAGACCAGAAAAATGACGG - Intergenic
1174960197 20:55147735-55147757 GAGGCAGAAGAGAAAGATGAAGG - Intergenic
1177429003 21:20965124-20965146 CTGGCAAGTGGGAAAAATGAGGG - Intergenic
1177572612 21:22906485-22906507 GAGGCAGCTGAGAGACAAGAGGG - Intergenic
1179039386 21:37788616-37788638 GTGGCAGAAGTGAAAAAGGAAGG + Intronic
1179249720 21:39662643-39662665 GAGGCAGCGGAGCAAACTGAAGG - Exonic
1179558339 21:42194842-42194864 GTGGCAGCTGAGTGTGATGATGG - Intergenic
1181846265 22:25711807-25711829 GGGGCAGCTGAGAAGAAACAGGG - Intronic
1181850720 22:25748131-25748153 GTGACAGATGAGAAAACTGGGGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1181880740 22:25977859-25977881 TTTGCAGATGAGAAAACTGAGGG + Intronic
1182049358 22:27301078-27301100 TTTGCAGATGAGAAAACTGAGGG - Intergenic
1182121488 22:27790114-27790136 GAGGCTGCTGATTAAAATGAAGG + Intronic
1183562211 22:38584106-38584128 GTGGAATCTGAGAAAAACCAAGG - Intronic
1183739922 22:39663777-39663799 GATGCAGTTGAGAAAGATGAAGG - Exonic
1183965938 22:41442606-41442628 GTGGAACCTTACAAAAATGATGG + Intronic
1184435972 22:44476849-44476871 GATGAAGGTGAGAAAAATGAAGG - Intergenic
1185220080 22:49624822-49624844 GAGGCAGCTGTGATAAATGGAGG - Intronic
949555229 3:5146898-5146920 GTGGGACCTGAGGAAAAAGAAGG - Intronic
949902528 3:8829318-8829340 ATGGCTGCAGAGAATAATGAGGG + Intronic
950010375 3:9718616-9718638 GTGGAAGCTGGGGGAAATGAGGG + Intronic
950081820 3:10228029-10228051 TTTACAGCTGAGAAAACTGAGGG + Intronic
950151992 3:10694886-10694908 TTGGCAGCTGTGCAAACTGAAGG + Intronic
950595642 3:13978890-13978912 GTAGCAGCAGGGAAAAATAATGG - Intronic
952124933 3:30289612-30289634 TTGGTAGCTGAGGAAACTGAAGG - Intergenic
952341035 3:32447567-32447589 GTGAAAAATGAGAAAAATGAAGG - Intronic
953082272 3:39631912-39631934 GTGGCAACTGAGAAAAGTCCTGG + Intergenic
953531974 3:43747319-43747341 TGGGGAGCTGAGAGAAATGAGGG + Intergenic
954666593 3:52256977-52256999 TTGGCACCTAAGAAACATGATGG + Exonic
955105296 3:55892037-55892059 ATGGAAGCTGAGAAAGATGAAGG - Intronic
955519881 3:59764997-59765019 TAGGCAGCTGAGAAAGGTGAGGG - Intronic
955633969 3:61005468-61005490 ATGGCAGCGGTGACAAATGATGG + Intronic
956433407 3:69209525-69209547 TTGATAGCTGAAAAAAATGAAGG + Intronic
956679870 3:71768576-71768598 GTGCCAGCTGGGCAAAACGATGG - Intergenic
957374443 3:79337452-79337474 GTGGCAGGAGAGAGAAGTGAGGG - Intronic
957513652 3:81223172-81223194 CTGGTAGCTGAGAAAACTGGAGG + Intergenic
958648683 3:96906950-96906972 GTGGGAGTGGAGAATAATGAAGG + Intronic
960259784 3:115553840-115553862 GTGGTAGTTGGGAAAAATGGAGG + Intergenic
960470346 3:118056710-118056732 GTGGTGGCTAAAAAAAATGAGGG - Intergenic
960728478 3:120696868-120696890 GTGGCAGCTGAGAAAAATGAGGG + Intronic
960933598 3:122880610-122880632 GAGGAAGCTGAGAATAATAAAGG - Exonic
961031041 3:123604284-123604306 GAGGCAACTGAGAAAACTCAGGG - Intergenic
961808268 3:129504769-129504791 TTTGCAGATGAGAAAACTGAAGG + Intronic
962158293 3:132972489-132972511 GTAGTAGCTGAGGAAAAAGAAGG + Intergenic
963001340 3:140684612-140684634 GTGGCCATTGAGAAAAATTAAGG - Intronic
964074738 3:152680015-152680037 GTGTAAAGTGAGAAAAATGATGG - Intergenic
965507840 3:169535610-169535632 AGTGCTGCTGAGAAAAATGAAGG - Intronic
967016402 3:185486103-185486125 GTGGCAACAGAGAAACATGAGGG + Exonic
967167027 3:186790381-186790403 ATACCAGCTGAGAAAATTGATGG - Exonic
968372597 4:10194-10216 TTTGCAGCCGAGAATAATGAGGG - Intergenic
969415194 4:7053358-7053380 GTGGAAGGTGCTAAAAATGAAGG + Intronic
969609497 4:8219116-8219138 GTTGAAGATGAGAAAAATGGAGG - Intronic
970121857 4:12763201-12763223 GTTCTAGGTGAGAAAAATGAAGG - Intergenic
970198574 4:13577862-13577884 TTTGCAGCTGAAAAAACTGAGGG - Intronic
971242796 4:24903713-24903735 TTGGCTGCAGAGAAACATGAGGG - Intronic
973822867 4:54678229-54678251 ATGGCAGCTGATGAAGATGAAGG - Intronic
975242089 4:72071865-72071887 GTGGAAAAAGAGAAAAATGAAGG - Intronic
976883429 4:89958388-89958410 GTGGCAGCAAACATAAATGAGGG - Intergenic
978298965 4:107243396-107243418 GTGCCAGCAGAGATAAATCAGGG + Intronic
978317249 4:107452331-107452353 GTGGCAACTGAGAGTAAAGAAGG + Intergenic
978844257 4:113253226-113253248 GTGGCAGCTAGGAAAACAGAAGG - Intronic
982956739 4:161778965-161778987 CTGGCAGTTGATAGAAATGAAGG - Intronic
983281044 4:165681080-165681102 GGGGCAGCTGAGAAAGAAAAGGG + Intergenic
983343912 4:166502402-166502424 GGGGCAGCTACGAAAAGTGAAGG + Intergenic
983892683 4:173046854-173046876 GTGTCATCTGAGAGGAATGATGG - Intergenic
983893686 4:173058556-173058578 GTAGCAGCTGAGAAAATGGGTGG + Intergenic
984325050 4:178241433-178241455 GTGGGAGCTGAGAACAAGCAAGG + Intergenic
985462813 4:190122430-190122452 TTTGCAGCCGAGAATAATGAGGG + Intergenic
986945720 5:13016772-13016794 GTCACAGGTGAGAACAATGATGG + Intergenic
988838376 5:35057173-35057195 TGGGAGGCTGAGAAAAATGAGGG - Exonic
990883476 5:60565905-60565927 GTGGCAGGAGAGAAAAGAGAAGG + Intergenic
991400118 5:66243146-66243168 GTGGTAACTGAGAAAATAGATGG + Intergenic
992057518 5:73005915-73005937 ATGGAAGCTGAGAAACATCAAGG + Intronic
992894444 5:81234293-81234315 GTGTCAGCTGAGTCAAGTGAGGG + Intronic
993660735 5:90631169-90631191 GTTGCAGATGAGAAATTTGAAGG + Intronic
993736694 5:91485686-91485708 GAGGCAGCTGCAAAAAATGCTGG + Intergenic
994118002 5:96082379-96082401 TTTGCAGCTGAGAAAAAGCAGGG + Intergenic
995565627 5:113431013-113431035 GTGGCAACAGAGAAGTATGAGGG + Intronic
995618630 5:113997438-113997460 CTGGCTGCTTAGAAAAAAGAAGG + Intergenic
995835672 5:116397216-116397238 GTGGGAGCTGAGCAAAGTGGGGG - Intronic
996647551 5:125834759-125834781 GTGGAAGCTGAGAGAAGAGACGG - Intergenic
996785456 5:127232022-127232044 GTGGCAGCAGAAAACAATGAAGG + Intergenic
996850232 5:127943362-127943384 GGGGGAGGTGAGAAAAAGGAGGG - Intergenic
996889059 5:128395670-128395692 AAGGCAGCTGACTAAAATGAGGG + Intronic
998324289 5:141265611-141265633 GTGGAAACTGAGAAAAAGAAGGG + Intergenic
998820085 5:146050081-146050103 GTGGCAGCTCACCTAAATGAAGG - Intronic
998919809 5:147055672-147055694 GTGGCAGCTGGAAGAAAGGATGG + Exonic
999479670 5:151935980-151936002 TTTACAGATGAGAAAAATGAGGG + Intergenic
999912096 5:156213323-156213345 GTGACTGCTGTGAAAAATTATGG + Intronic
1000413348 5:160957350-160957372 TTTGCAGATGAGAAAACTGAAGG - Intergenic
1000659032 5:163916346-163916368 GTGGCAGCTCAGAGCACTGAAGG + Intergenic
1000692438 5:164340191-164340213 GTGGGAGCTGAGATGCATGAGGG - Intergenic
1001003746 5:168031569-168031591 TTTGCAGATGAGGAAAATGAGGG + Intronic
1001243147 5:170085515-170085537 GTGGCACCTGGGAAAAATGAAGG + Intergenic
1002650120 5:180685031-180685053 GTGACAGCTGAGACAAATGTTGG + Intergenic
1002720710 5:181259985-181260007 GTACCAGGTGAGAGAAATGAGGG - Exonic
1002808694 6:604313-604335 GTGGCAGGTGAGAAAGGTGAAGG - Intronic
1004184898 6:13413341-13413363 GTGGCAGGAGAGAAAACTGGAGG - Intronic
1004950665 6:20667622-20667644 GTGGCAGAAGAGAAAAAATAAGG - Intronic
1006242621 6:32698487-32698509 CTGGCAAGGGAGAAAAATGAAGG - Intergenic
1006873707 6:37277003-37277025 CTGACTTCTGAGAAAAATGAAGG - Intronic
1006965204 6:37976740-37976762 GTGGCAGGTGAGAAAGAGGAAGG + Intronic
1008321195 6:50116247-50116269 TTTGCAGATGAGAAAACTGAGGG + Intergenic
1008856703 6:56096777-56096799 GTGGCAGCCAAGAAAATTAATGG - Intronic
1008905380 6:56672131-56672153 GTGGCAGCTGGGAGGAATAAAGG - Intronic
1011426534 6:87238020-87238042 GTGGCAAATAAGAGAAATGAAGG + Intronic
1011775248 6:90722610-90722632 TTTGCAGCTGAGAAAAAGTATGG - Intergenic
1011836840 6:91441739-91441761 GTGTCAGCTGGGACAACTGAGGG - Intergenic
1013866587 6:114705514-114705536 ATGGCTGCTGATAAAAAAGAAGG + Intergenic
1015054614 6:128884817-128884839 TAGGCAGCTGGGAGAAATGAGGG + Intronic
1015860398 6:137672701-137672723 GTAGCAGCTGAGAAACATTTTGG - Intergenic
1016271317 6:142293657-142293679 GTGGCAGGAGAGAAAAAGTATGG + Intergenic
1016602542 6:145878814-145878836 CTGGCTGCCAAGAAAAATGATGG - Intronic
1016969720 6:149750372-149750394 GAGGAAGGTGAGAAAAATGCAGG - Intronic
1017376721 6:153778600-153778622 GTGGCAGCTGATAAAAAGGCTGG + Intergenic
1017607467 6:156149200-156149222 TTGACAGGTGAGAAAACTGAGGG - Intergenic
1018653334 6:166009085-166009107 GAGACAGCCGAGAAAAATGACGG - Intergenic
1018689382 6:166332699-166332721 GTAGCAGATAAGTAAAATGATGG - Intronic
1019002632 6:168768104-168768126 GTTACACCTGTGAAAAATGACGG - Intergenic
1020424428 7:8048049-8048071 GTTGGAGCTTGGAAAAATGAGGG + Intronic
1022024288 7:26431325-26431347 GTGCCACCTGAGAGAAATGGGGG + Intergenic
1022402400 7:30052093-30052115 GTGGCACCGGAGAAAACTGATGG + Intronic
1022921331 7:35017917-35017939 TTGAGAGGTGAGAAAAATGACGG + Exonic
1023229590 7:38012572-38012594 ATGGCAACTGAGAAGAATGCAGG - Intronic
1023355008 7:39357631-39357653 GTGGCAGTTTGGAAAAATGTTGG - Intronic
1023625088 7:42107598-42107620 CTGGCAGATGAGAAAAGTGGAGG + Intronic
1024123764 7:46270958-46270980 GTGGGAGCAGAGCAGAATGAAGG + Intergenic
1025247707 7:57329480-57329502 TTGGCAGATGAGGAAACTGAGGG - Intergenic
1025249275 7:57341231-57341253 GTGGAAGGTGAGAAAGATCAAGG - Intergenic
1025728958 7:64093162-64093184 GTGGAAACTGAGACACATGAAGG - Intronic
1025859452 7:65312834-65312856 GTGGCAGCTGGGAGAAAAGAGGG - Intergenic
1025929981 7:65985737-65985759 GTGGAAACTGAGACACATGAAGG + Intergenic
1026408589 7:70094845-70094867 GTGGTAGCTTAGAGAAATTATGG + Intronic
1026697833 7:72611507-72611529 GTGGCAGACGAGAGAAAAGAGGG - Intronic
1026897173 7:74016400-74016422 GAGGCAGCTGAGAGAAATCCAGG + Intergenic
1027507846 7:79040407-79040429 GTGGAAGCTAAGAAAAAAGTTGG + Intronic
1028325510 7:89519472-89519494 GTGCCAACTGAGAAAATTGCAGG + Intergenic
1030282151 7:107787955-107787977 GAGTCAGCTAAGAAATATGAGGG - Intronic
1031039851 7:116827804-116827826 GTGGCAGCACAGAAAAATCAGGG - Intronic
1031414939 7:121484511-121484533 GTGGAAGCTGAGCAAAAGAAAGG + Intergenic
1031521149 7:122767590-122767612 GTGCCAGCTGAGCAGAATTAGGG - Intronic
1032255797 7:130296130-130296152 CTGACAGATGAGAAAAAGGATGG + Intronic
1032621138 7:133533898-133533920 GTAGCTGGTGAGAAAAAGGAAGG + Intronic
1033134444 7:138773251-138773273 GTGGGAGCTGGGAGAAATGCAGG - Intronic
1033958535 7:146882519-146882541 GTGGCAGGAGAGAGAAATGCAGG - Intronic
1034135698 7:148766702-148766724 TTGGATGCTGACAAAAATGAAGG + Exonic
1034492511 7:151401372-151401394 GTGGAAGCTGAGGAAACAGAGGG - Intronic
1034565003 7:151906425-151906447 TTGGCAGATGAGAAAGAGGAGGG + Intergenic
1034576781 7:152006613-152006635 GGGGCTGCAGAGAAAAATAATGG - Intronic
1034929923 7:155153529-155153551 GTGGCAGCTGTGACAGATGCAGG - Intergenic
1035028291 7:155841378-155841400 GTAGCGGCTGAGAAACAGGAGGG + Intergenic
1036279422 8:7386994-7387016 GAGGGAGCTGAGAAACAAGAGGG - Intergenic
1036342093 8:7924881-7924903 GAGGGAGCTGAGAAACAAGAGGG + Intergenic
1036469659 8:9041155-9041177 GTGTCTGGTGAGAAAAATGTGGG + Intronic
1036833725 8:12041200-12041222 GTTGCAGCTGAGAAACAGGTCGG + Intergenic
1036855569 8:12287765-12287787 GTTGCAGCTGAGAAACAGGTCGG + Intergenic
1037517641 8:19649166-19649188 TTTGCAGATGAGAAAAATGGAGG + Intronic
1037972135 8:23179918-23179940 GTTCCAGATGAGAGAAATGAAGG - Intergenic
1038584694 8:28778161-28778183 GAGGCAGATGAGGTAAATGAGGG + Intronic
1041118865 8:54566457-54566479 GTGTCATCTGAGAAGAGTGAAGG + Intergenic
1046313516 8:112469955-112469977 GTGGCAACAGAAAAAAATTATGG + Intronic
1046478112 8:114776383-114776405 GTGGCTGCAGTGAAATATGAGGG + Intergenic
1047180571 8:122584029-122584051 GTGGTAGCTGCAAAAAGTGAAGG + Intergenic
1047796962 8:128267532-128267554 GTGGCAGGTGAGCAAAAGGAGGG + Intergenic
1048339450 8:133527439-133527461 ATGTCAGCTTAGAATAATGACGG + Intronic
1048717639 8:137286181-137286203 GTGGCCGCTGCAATAAATGATGG - Intergenic
1049270226 8:141691601-141691623 GTCGCAGCAGAGAGAAGTGAAGG - Intergenic
1050417405 9:5432176-5432198 GTGTTAGGTGAGTAAAATGATGG - Intronic
1050710721 9:8459666-8459688 GTGGCATATCAGAAAAATGTGGG + Intronic
1051627985 9:19116415-19116437 GGGGCAGCTGCAGAAAATGAAGG - Exonic
1051684597 9:19644459-19644481 GTTACAGATGGGAAAAATGAGGG + Intronic
1051760012 9:20452368-20452390 GTGGCAGGAGAGAAAAATGCAGG - Intronic
1052103014 9:24474023-24474045 GAGGCACTTGAAAAAAATGATGG - Intergenic
1052200758 9:25776689-25776711 TTAGCAACTGAGAAAAATGTGGG + Intergenic
1052480867 9:29024045-29024067 GTGGCAGCAGGGCAAAGTGAAGG - Intergenic
1052652167 9:31319636-31319658 ATCGCAGTTCAGAAAAATGAAGG + Intergenic
1052730355 9:32278057-32278079 GGTGCAGCTGGGAAAAATGGAGG - Intergenic
1053450969 9:38193705-38193727 GGGGCATCTGAGGAAAATCAAGG - Intergenic
1055305098 9:74921101-74921123 GTGGAAGCTGATAAACCTGATGG - Intergenic
1055734166 9:79310007-79310029 GTGTCAGTGGAGAAGAATGAAGG + Intergenic
1055838024 9:80467943-80467965 GTTGCAGATGAGAAAAATGAGGG - Intergenic
1057588849 9:96354058-96354080 GTTGCAGCTTTGAAAAATGTAGG - Intronic
1057713080 9:97464746-97464768 ATGGCAGCAGGGAAAAAAGAAGG + Intronic
1058645256 9:107126172-107126194 TTTGCAGATGAGGAAAATGAAGG - Intergenic
1058743103 9:107964047-107964069 GTGGCAGTGGGGAAAGATGATGG + Intergenic
1059280715 9:113131334-113131356 GTGGCATCTGACACACATGAGGG - Intergenic
1059929978 9:119250846-119250868 AGGTCAGCTGAGATAAATGATGG + Intronic
1060009710 9:120032816-120032838 GTGGCTGCTCTGAAAAATGCAGG + Intergenic
1060461605 9:123860632-123860654 TGGGAAGCTGTGAAAAATGAGGG - Intronic
1061985896 9:134130008-134130030 CTGGTAGATGAGGAAAATGAGGG - Intergenic
1062324641 9:136006146-136006168 GTGGCAGGTGAGGCAGATGAAGG + Intergenic
1186318973 X:8403484-8403506 ATGGTAGCTGAGAAAAATAAAGG + Intergenic
1186693702 X:12006656-12006678 GTGGCAGCTGTGGAGAAGGAGGG - Intergenic
1187324592 X:18274651-18274673 ATGACAGCTGGGAAAAAAGATGG - Intronic
1189083641 X:37998154-37998176 GTGGAGGGTGAGAAAGATGAAGG - Intronic
1189794795 X:44635420-44635442 GTGGCAGGTGAGAATAATCCTGG + Intergenic
1190409920 X:50126285-50126307 GGGCCAGCATAGAAAAATGAGGG - Intergenic
1192390440 X:70721053-70721075 TTTGCAGGTGAGAAAAATGAGGG - Intronic
1193910971 X:87306159-87306181 GTGGCAGTAGAGAGAAATAAAGG - Intergenic
1194972732 X:100362144-100362166 GAGGAAGCTGAGAACAATGTGGG - Intronic
1197146849 X:123181496-123181518 GTGGCAGCAGATAAAAGAGAGGG + Intergenic
1197665565 X:129219748-129219770 GATGCAGCTGACAAAAATAATGG - Intergenic
1197783372 X:130177931-130177953 GAGGCAGCTGCGAAAGAGGAAGG + Intronic
1198714750 X:139545113-139545135 GGTGAAGCTGAGAAGAATGAAGG + Intronic
1199881584 X:151977555-151977577 GTGGCAGAACAGAATAATGAAGG + Intergenic
1200968142 Y:9120241-9120263 GTGGCATCTGAGGAGAAGGAAGG - Intergenic
1201509444 Y:14742384-14742406 TTTACAGATGAGAAAAATGAGGG - Intronic
1202142603 Y:21743833-21743855 GTGGCATCTGAGTAGAAGGAAGG + Intergenic
1202144255 Y:21761785-21761807 GTGGCATCTGAGTAGAAGGAAGG - Intergenic