ID: 960732699

View in Genome Browser
Species Human (GRCh38)
Location 3:120743822-120743844
Sequence CAGGGTAGACAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 602}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960732699 Original CRISPR CAGGGTAGACAGAGGGCAGA GGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
900590699 1:3458255-3458277 CAGGGCATGCACAGGGCAGAGGG - Intronic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
901069539 1:6510215-6510237 CAGGAGAGCCAGAGGGCAGGGGG - Intronic
901468479 1:9439136-9439158 CTGGGGAGACTCAGGGCAGAAGG + Intergenic
902059588 1:13630932-13630954 AAGTGTATACAGAGGGCAGGTGG - Intergenic
902255097 1:15183653-15183675 GAAGGCAGACACAGGGCAGATGG - Intronic
902353811 1:15880897-15880919 CAGGGAACACTGTGGGCAGAAGG + Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902642154 1:17773990-17774012 GTGGGTAGACTGAGGCCAGATGG + Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
903169216 1:21541710-21541732 TAGGGTAGGGAGAGGGCAGGGGG + Intronic
903671567 1:25038992-25039014 CAGGGAAGAGGCAGGGCAGATGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904263940 1:29306998-29307020 CAGGGCAGGCAGAGCGGAGACGG - Intronic
904457411 1:30655973-30655995 CAGGGGTGACAGAGGAGAGAGGG - Intergenic
904493331 1:30873414-30873436 CAGGGTAGAACCAGGGCAAAGGG + Intronic
904529654 1:31160037-31160059 CATGGTAGAGAGAAGGCAGAAGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904993173 1:34610291-34610313 CAGGGTAGACAGTTGGCCTAGGG + Intergenic
905485677 1:38294340-38294362 AAGGGTAGTGAGAGGACAGATGG - Intergenic
905888467 1:41504605-41504627 CTGAGCAGACAGAGGGCAGCCGG + Intergenic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906645237 1:47470050-47470072 TGGGGTAGACACAGAGCAGAAGG + Intergenic
907276716 1:53320842-53320864 CAGGGTAGACAGCGCTCAGCGGG + Intronic
907501499 1:54884910-54884932 CAGGGCCAACAGATGGCAGAGGG + Intronic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
908680427 1:66654874-66654896 CAACAGAGACAGAGGGCAGATGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912933015 1:113981166-113981188 CTGGGTAGGCACAGGGCAGCTGG + Exonic
913448835 1:118978612-118978634 TATGGTAGAAAGAGGGCTGAAGG - Intronic
913569745 1:120108778-120108800 CAGGTTACACAGAGAGCAGATGG - Intergenic
914290555 1:146269740-146269762 CAGGTTACACAGAGAGCAGATGG - Intergenic
914551599 1:148720523-148720545 CAGGTTACACAGAGAGCAGATGG - Intergenic
914860532 1:151382123-151382145 TAGGGTGGACTGAGGGGAGAGGG - Intergenic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916770796 1:167905554-167905576 CAAGGTAGAGAGAGGGTAAAAGG - Intronic
917628281 1:176867798-176867820 CAGTTTAGTCAGAGGTCAGATGG + Intronic
918485670 1:185026278-185026300 CAGGAGAGACAGAGAGCAGGGGG + Intergenic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919367765 1:196686045-196686067 CAGGAGAGACAGAGAGCAAAGGG + Intronic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
919981837 1:202646740-202646762 TGGGGAAGACAGAGGGCTGAAGG + Intronic
920313647 1:205062743-205062765 CAGGGTTGACAGCTGCCAGAGGG + Intronic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
920900714 1:210107533-210107555 GAAGGCAGACATAGGGCAGATGG + Intronic
921047136 1:211485509-211485531 CAGGCTAGACAGACTCCAGAGGG + Intronic
921382484 1:214538745-214538767 TGGGGGAGACAGAGGGCAGAAGG + Intronic
921415128 1:214877214-214877236 CAGGGGAGAAAGATGGGAGAAGG + Intergenic
921596510 1:217059717-217059739 CAGGAAATACAGGGGGCAGAGGG + Intronic
921950836 1:220928072-220928094 TATGGTAGAAAGAGGCCAGATGG - Intergenic
922027205 1:221761482-221761504 CAGGGCAGACAAATGGCAGGTGG + Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
924306143 1:242691065-242691087 GAGGGGAGAGAGAGAGCAGAGGG - Intergenic
1063911522 10:10835331-10835353 CTGGGAAGACTGAGGCCAGAGGG - Intergenic
1063937134 10:11089648-11089670 CGAGGTAGAGAGAAGGCAGAAGG + Intronic
1063957517 10:11280690-11280712 CAGGATGGACAGAGGACACATGG + Intronic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064306771 10:14174331-14174353 CAGGGTACACAGAGAGCTGTAGG - Intronic
1064545447 10:16445725-16445747 CAGAGAAGACATTGGGCAGAAGG - Intronic
1065030292 10:21579240-21579262 CACATTACACAGAGGGCAGAGGG - Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1066640018 10:37546560-37546582 CAGCTTACACAGAGGGCTGAAGG - Intergenic
1067304708 10:45050943-45050965 GAGGGTAGGCAGAGGGTATATGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1069679909 10:70277147-70277169 CTGGGGAGGCAGAGGCCAGATGG - Intronic
1069735103 10:70648895-70648917 GAGGGAAGTCAGAGGGCAGGTGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071137617 10:82470077-82470099 CAGGTTATAAAGAGGCCAGAGGG - Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073476475 10:103756983-103757005 CAGGGTTGATAGAGGTGAGAGGG - Intronic
1073494534 10:103879471-103879493 AAGGCTGGAAAGAGGGCAGAGGG + Intergenic
1075004007 10:118817682-118817704 TTGGGAACACAGAGGGCAGAAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075443952 10:122500985-122501007 CAGGGCACACAGAGGTCAGCGGG - Intronic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1075845748 10:125544048-125544070 CAGGGAAGAAACAGGGCAGAGGG - Intergenic
1076031649 10:127164125-127164147 CAGGGAAGACAAAGGGCCAAGGG - Intronic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076687352 10:132204112-132204134 CTGGGCAGACAGCGGGCAGGAGG - Intronic
1077017764 11:404463-404485 CAGGAGGGACAGCGGGCAGAGGG + Intronic
1077338349 11:2015323-2015345 GAGGTTAAACAGAGGGCAGCCGG + Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1079129405 11:17738571-17738593 CAGGGCAGGCAGGGGGCAGTGGG + Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079372177 11:19861014-19861036 GACGGTGGAAAGAGGGCAGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080695745 11:34601593-34601615 CAAGGCACTCAGAGGGCAGAAGG - Intergenic
1081601955 11:44501446-44501468 TGGGGTAGGCAGAGGGCAGAGGG - Intergenic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1081800988 11:45859203-45859225 CAGGGTCCACTGAGGTCAGAGGG - Intronic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1082259594 11:50068209-50068231 CAGGGTAGAAAGATTGCTGAAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083206631 11:61153760-61153782 CAGGGTAGCCAGAGTTCACAGGG + Intronic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1083410450 11:62488905-62488927 CCAGGAAGACAGGGGGCAGAGGG + Intronic
1083623986 11:64062673-64062695 CAGGGAAGCCAGAGTGCTGAAGG + Intronic
1083997802 11:66280694-66280716 CAGGGTCCACAGGGAGCAGAAGG - Intronic
1084285362 11:68127832-68127854 CAGGGCTGACTGAGGGGAGAGGG - Intergenic
1084617673 11:70247244-70247266 CAGGAGAGAGAGAGGGCAAAGGG + Intergenic
1085298336 11:75443434-75443456 CAGGGAAGACAGTGGGCTGGTGG + Intronic
1088074939 11:105836481-105836503 AAGAATATACAGAGGGCAGATGG - Intronic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088737452 11:112739611-112739633 TAGGGCAGACTGTGGGCAGAAGG + Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1089019219 11:115194822-115194844 GAGGGGACACACAGGGCAGAAGG + Intronic
1089104127 11:115987908-115987930 CTGGGTAGACAGAGAGGAGTAGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089364233 11:117911310-117911332 CAGGGTAGACAGGCAGCAGTAGG - Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091214429 11:133891954-133891976 GAGGGTAGACAGAGAAGAGAAGG - Intergenic
1202821333 11_KI270721v1_random:70505-70527 GAGGTTAAACAGAGGGCAGCCGG + Intergenic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1094036832 12:26081123-26081145 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1095125972 12:38477743-38477765 CAGGGCATACAGAGGGCATCAGG - Intergenic
1096076689 12:48810443-48810465 GAGGGTAGTCATAGGACAGAGGG - Intergenic
1096473888 12:51896311-51896333 TAGGGAGGACAGAGGACAGATGG + Intergenic
1096536326 12:52277476-52277498 AAGGGTAGACCAAGGACAGAAGG - Intronic
1096585257 12:52615740-52615762 CAGGGGAGAAAGAAGGCACATGG + Intronic
1096789804 12:54037614-54037636 CAGGGTGGAGAGGGGGGAGAGGG - Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1098882142 12:75927484-75927506 CAGGGCAGACAGAGAGCAAAGGG + Intergenic
1099611498 12:84877736-84877758 GAGGGTTGGCAGGGGGCAGATGG - Intronic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1102889836 12:116549965-116549987 CCGGGAAGACAGAGTGCAGGTGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103409511 12:120700871-120700893 CAGGCTAGACAAAAGGCAGCTGG - Exonic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1103931565 12:124453467-124453489 GAGGGCAGAAAGAGGGCAAAGGG + Intronic
1103987928 12:124779829-124779851 CAGGGCAGAGAGCGGGCACAGGG + Intronic
1104547658 12:129726654-129726676 GACGGTAGACAGAGGGGTGAGGG + Intronic
1104770401 12:131358147-131358169 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105707450 13:22977066-22977088 TGGGGTAGACGGAGGGAAGATGG + Intergenic
1106118460 13:26837675-26837697 CAGGAGAGAAAGAGAGCAGAAGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106309038 13:28536861-28536883 CTGGGTTGACAGAGGTCAGAAGG + Intergenic
1106525472 13:30536987-30537009 CAGGGAAGACAGAGGACCCATGG - Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1108472156 13:50778200-50778222 CAGGGGAGAGAGAGAGCAAAGGG + Intronic
1109275434 13:60298784-60298806 CAGGGTAGAGATAGGGCAACAGG + Intergenic
1109917512 13:69010989-69011011 AAGGATAGAAAGAAGGCAGAGGG - Intergenic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1111218637 13:85177379-85177401 CACGGGAGACAGAGGGGAGGAGG - Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112498307 13:99922917-99922939 GAGGGTGGAAAGTGGGCAGATGG + Intergenic
1113060309 13:106315204-106315226 CAGGAGAGAAAGGGGGCAGAGGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113307722 13:109096313-109096335 CACGGGAGACACAGAGCAGAGGG - Intronic
1113755592 13:112808706-112808728 CAGCGGAGACAGCGGGGAGATGG - Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114493719 14:23118818-23118840 GAGGGTAGGCAAAGGGCCGAGGG + Exonic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1116021853 14:39470861-39470883 AGGACTAGACAGAGGGCAGAAGG + Intergenic
1116412982 14:44647599-44647621 CAGGGTAGTCATAGGGGAGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1117109056 14:52429745-52429767 CAGGGTAGAGAGAGGGCTTTTGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117904382 14:60569102-60569124 CAGGGATGGCAGAGAGCAGAAGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118383935 14:65239683-65239705 CAGGGCAGACAGAGGCCAGGAGG + Intergenic
1118477094 14:66127765-66127787 CAGGGCAGACAGATCGCATATGG - Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119669194 14:76505933-76505955 CAGAGTAGAGTGAGGCCAGATGG - Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120180120 14:81334710-81334732 CAAGGCAGAAATAGGGCAGAAGG + Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1122036249 14:98951227-98951249 CAGGCTTGACAGATGACAGATGG - Intergenic
1122416764 14:101553514-101553536 CAGGGTAGTCTGGGGGCAGAAGG - Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123106650 14:105844947-105844969 CAGGTGAGGCTGAGGGCAGAGGG + Intergenic
1123662218 15:22574412-22574434 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1123813709 15:23955173-23955195 GAGAGAAGGCAGAGGGCAGAGGG + Intergenic
1124262000 15:28201095-28201117 CGGTGTAGCCAGAGGACAGAGGG - Intronic
1124316020 15:28668694-28668716 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124805896 15:32882495-32882517 CAGTGTAGACAGTGGACAAAGGG - Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125714331 15:41810763-41810785 CTGGGTAGAAAGAGCTCAGAAGG - Intronic
1126382818 15:48066373-48066395 CAGGGCAGAAAGAGGGCAGGGGG - Intergenic
1126702060 15:51377405-51377427 CAGAGCAGACAGTGGGCAGCAGG - Intronic
1127497147 15:59524092-59524114 GAGGGTAGTCAGATGGCAGGAGG - Intergenic
1127857208 15:62962566-62962588 CTGGCCAGGCAGAGGGCAGAGGG - Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128773637 15:70302259-70302281 AAGGATGGACAGAGGGTAGATGG + Intergenic
1128920482 15:71605820-71605842 AAGTGTAGACAGAGGAGAGATGG + Intronic
1129452395 15:75658378-75658400 CGAGGCAGACAGAGGGCAGGTGG - Exonic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1130044754 15:80435172-80435194 GAGGGCAGGCAGAGGGCAGGAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130220176 15:82012873-82012895 TAGGGCTGACAGAGGGCACAGGG - Intergenic
1130800333 15:87255932-87255954 CAGGGTAGAAAGAGGGGAAAAGG + Intergenic
1130815443 15:87427221-87427243 CAGGAAAGAGAGAGGGCAAAGGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131333709 15:91526615-91526637 GAGAGGAGACAGAGGGCTGAGGG - Intergenic
1131352602 15:91715168-91715190 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1131768879 15:95712843-95712865 AAGGGGAGAGAGAGGGCACAGGG - Intergenic
1132049332 15:98593922-98593944 CTTGGGAGGCAGAGGGCAGAAGG - Intergenic
1132149893 15:99451903-99451925 AAGGATGGACAGAGGGGAGATGG - Intergenic
1132353674 15:101156131-101156153 CAGGTGAGACAAAGGGGAGAAGG + Intergenic
1132387116 15:101408474-101408496 CCAGGGAGACACAGGGCAGAAGG + Intronic
1132574555 16:658521-658543 CAGGGTGGACACCGGGCAGCTGG - Exonic
1132665594 16:1080099-1080121 TGGGGTAGACACAGGGCAGTAGG + Exonic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1132784886 16:1651237-1651259 CAGGTTACACAGAGGTCACACGG + Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133452924 16:5918625-5918647 CAGGGTAGACAGTGAGCTGTAGG + Intergenic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135160998 16:20096324-20096346 CCTGGTTGACAGAGGGCAGGTGG + Intergenic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1136155661 16:28380380-28380402 CTGGGAAGAAAGAAGGCAGAGGG + Intronic
1136207423 16:28734909-28734931 CTGGGAAGAAAGAAGGCAGAGGG - Intronic
1137289589 16:47042893-47042915 AGGGGGAGGCAGAGGGCAGAGGG + Intergenic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137554379 16:49461447-49461469 CAGGGTAGGAGAAGGGCAGATGG + Intergenic
1137571188 16:49567459-49567481 CAGGCTAGACAGACCCCAGAAGG + Intronic
1137825765 16:51493631-51493653 TAGGGTAGACTTATGGCAGAGGG - Intergenic
1137831952 16:51552520-51552542 GAGGGTAGACAAATGTCAGAGGG - Intergenic
1137928498 16:52564356-52564378 CATGACAGACATAGGGCAGAGGG + Intergenic
1138344341 16:56311133-56311155 CAGGGTAGATAGAAGCCAGCCGG - Intronic
1138380018 16:56593627-56593649 CAGGAGAGAGAGAGGACAGAGGG - Intergenic
1138490299 16:57372609-57372631 CAGGACAGTCAGATGGCAGAAGG - Exonic
1140149805 16:72351310-72351332 CAGGGAAGACAGAGGTGATAAGG - Intergenic
1140196389 16:72859045-72859067 CACAGAAGCCAGAGGGCAGAGGG - Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140728012 16:77831320-77831342 CAGAGAAGAAAGAGAGCAGAAGG + Intronic
1141010134 16:80389267-80389289 CAGGGGAGAGAGTGAGCAGAGGG + Intergenic
1141466371 16:84208435-84208457 GAGGGGAGGAAGAGGGCAGAGGG + Intergenic
1141549163 16:84793534-84793556 CAGGGTAGAACAAGAGCAGAAGG - Intergenic
1141838975 16:86562151-86562173 GAGGGGAGAAGGAGGGCAGAAGG - Intergenic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142192615 16:88724936-88724958 CAGGCCAGGCAGAGGACAGATGG + Intronic
1142297321 16:89234015-89234037 CAGGGGAGGCAGAGGCCACAGGG - Exonic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143099159 17:4495731-4495753 GAGGATGGGCAGAGGGCAGATGG + Intergenic
1143161964 17:4877775-4877797 CATGGAAGTCAGAGCGCAGATGG - Intronic
1143500129 17:7334033-7334055 CAGGGAAGAAAGAGGGCAGCTGG + Intergenic
1143534218 17:7526325-7526347 GAGGGGAGAAAGAGGGGAGATGG - Intergenic
1144342496 17:14321490-14321512 AAGGGAAGAAGGAGGGCAGAGGG + Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145303565 17:21656964-21656986 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1147120408 17:38332135-38332157 CAGGGCAGGCAGAGCTCAGAGGG + Intronic
1147158544 17:38557895-38557917 GAAAGTAGGCAGAGGGCAGAGGG + Intronic
1147324635 17:39664417-39664439 CAGGGGAGACAGATGGCTGTGGG - Exonic
1147599979 17:41739461-41739483 CATGGAAGACAGCAGGCAGAGGG - Intergenic
1147652198 17:42069091-42069113 CAGGGAAGACAGGGAACAGAGGG - Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148128892 17:45250864-45250886 CAGGAAGGAGAGAGGGCAGAGGG + Intergenic
1148355332 17:46971986-46972008 TGGGGTAGGCAGAGGGCACAGGG + Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1151163026 17:72181813-72181835 CAGGAAAGGCAAAGGGCAGAAGG - Intergenic
1151218995 17:72597854-72597876 CAGGGTAGGGAGGGGGCAGAAGG - Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152639798 17:81444729-81444751 GGGGGAAGACAGAGGGCACAGGG - Exonic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1156175929 18:34546250-34546272 TTGGTTAGACAGAGGCCAGAAGG - Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157701735 18:49765121-49765143 CAGTGTAGACAGGGAGCAGATGG + Intergenic
1157714192 18:49871867-49871889 ATGGGTAGACATAGGGCAGAGGG - Intronic
1157828346 18:50833005-50833027 CTTGGAAGACAGAGGGCAGGTGG - Intergenic
1157863593 18:51162377-51162399 CATGGTAGACACTGGGCATAAGG - Intergenic
1157972992 18:52292640-52292662 CAGGGAAGAATGAGGGGAGAAGG - Intergenic
1158618906 18:59013215-59013237 TAGGGAAGAAAGAGGGCAGAAGG - Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1159864874 18:73691823-73691845 GAGGGAAGACTGAGGGGAGAAGG + Intergenic
1159976804 18:74723539-74723561 CAAGGAAGAGAGAAGGCAGATGG - Intronic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161495440 19:4583770-4583792 CAGGCTAGACAAAAGGCACAGGG - Intergenic
1162791800 19:13066864-13066886 CAGGGCAGCCAGAGGGCCGGGGG - Intronic
1163779934 19:19240735-19240757 AAGGGTAAACTGAGGCCAGATGG - Intronic
1163820219 19:19492191-19492213 CAGGGCAGACAGGGAACAGACGG + Intronic
1163843584 19:19626691-19626713 CAGGCTCGACAGAGCCCAGACGG + Exonic
1164715259 19:30386127-30386149 CAGCGTAGGCAAAGGGCTGAGGG - Intronic
1164896465 19:31881607-31881629 CACGGTGGAAAGAAGGCAGAGGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165686745 19:37828558-37828580 CAGGCTAGTCAGTGGTCAGAAGG + Intergenic
1166255829 19:41603839-41603861 CAGGGTACACAGACTACAGATGG + Intronic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167119054 19:47505917-47505939 GAGGGAAGACAGAGTGCAGCAGG - Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
924989071 2:295666-295688 CATGGAAGAAAGAGGGAAGAAGG + Intergenic
925059902 2:883014-883036 CAGGGAAGGCTGAAGGCAGAAGG + Intergenic
925134061 2:1514438-1514460 CTGGGCAGACAGAGGGCACTGGG - Intronic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929168463 2:38907072-38907094 CTTGGTTGACAGAGAGCAGAGGG + Intronic
929279016 2:40057822-40057844 CAGAGGAGACAGAGGGCTCATGG + Intergenic
929306497 2:40368896-40368918 CAGGTTTGTCAAAGGGCAGATGG - Intronic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
931912949 2:66922090-66922112 CAGGGTAGACTTATGGGAGAGGG + Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932820055 2:74891869-74891891 CAGTGTAGTTAAAGGGCAGAAGG + Exonic
933273619 2:80260290-80260312 CAGTGAAGAAAGATGGCAGAGGG + Intronic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933323432 2:80806131-80806153 CAGGTTATAAAGAGAGCAGATGG + Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935211251 2:100940923-100940945 CAGGGTAGTCAGGGGGCAGGAGG + Intronic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
935424711 2:102907843-102907865 CAGGGTCTACAGAGGCCAGCAGG + Intergenic
936153968 2:110036362-110036384 CTGGGAAGACTCAGGGCAGAAGG + Intergenic
936190717 2:110335053-110335075 CTGGGAAGACTCAGGGCAGAAGG - Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
937233063 2:120411993-120412015 CAGGTTTGTCAGAGGTCAGATGG + Intergenic
937307477 2:120881368-120881390 CAGGGAGGACAGTGGGGAGAGGG + Intronic
937890661 2:126936165-126936187 AAGGGAAGACAGACGGCAGGAGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938905205 2:135830302-135830324 CAGGCCAGAGACAGGGCAGAGGG - Intronic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
940485862 2:154294914-154294936 CAGGGTAGAAAGGTGGGAGAAGG + Intronic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
941099271 2:161278965-161278987 CATGAAAGAGAGAGGGCAGAAGG - Intergenic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
942966000 2:181892375-181892397 CACGGTAGGCCGAGGGGAGAGGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943482493 2:188437920-188437942 GAGGGTAGAGAGTGGGAAGAGGG + Intronic
943501332 2:188693245-188693267 CAGTGTAGACAGGGAGCAGGTGG + Intergenic
943649563 2:190442354-190442376 CAGGAGAGACTGAGGCCAGATGG + Intronic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
944408526 2:199413471-199413493 CAGAGAAGGCAGAGAGCAGAGGG - Intronic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
944540696 2:200750696-200750718 CAGGGTAGACAGCTGCCAGAAGG - Intergenic
944634048 2:201657183-201657205 CAGGGTAGAAAGAGTGGAGCAGG + Intronic
944825032 2:203474157-203474179 CAGGGTAGAAAGAGGGCAAAGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946373476 2:219294655-219294677 GAGGGGAGACAGAAAGCAGAGGG + Intronic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947391842 2:229647197-229647219 CAGGGTAAGAAGAGGTCAGAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948305416 2:236943799-236943821 CAGGGTAGACTGAGGATGGATGG + Intergenic
948458403 2:238117888-238117910 GAGGGTGGACAGAGGAGAGATGG + Intronic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
948599484 2:239100201-239100223 CAGGGAAGGCAGAGGCCAGGAGG - Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
949042994 2:241857991-241858013 CAGTGTACACAGAGGGCCCAGGG + Intronic
1169059341 20:2650040-2650062 CAGGGTAGACAAGATGCAGATGG + Intergenic
1169110712 20:3031581-3031603 CAGTGCAGATACAGGGCAGATGG - Intronic
1170833442 20:19863006-19863028 AAGGGTAGGCACAGAGCAGAGGG - Intergenic
1171117356 20:22536470-22536492 AAGGGTAGACAGTGGACACAAGG - Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173495661 20:43515412-43515434 CATGGTAGGAAGAGGGCAGTGGG + Exonic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173911566 20:46674561-46674583 CAGGGGAGACAGTGGGTAGGTGG + Intronic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175708238 20:61197285-61197307 CTGGGGAGAGAGAGTGCAGAGGG - Intergenic
1175794390 20:61762573-61762595 CAGGCTGGACAGAGTGCAGTGGG - Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176654936 21:9579766-9579788 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1180538211 22:16415688-16415710 CAGGAGAGACAGAGAGCAAAGGG + Intergenic
1180898845 22:19356707-19356729 CTGGGTAGGCTGAGGGCTGAGGG - Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181753391 22:25005771-25005793 CAGAGAAGACACAGGGCTGATGG - Intronic
1182353678 22:29712631-29712653 GAGGACAGACAGATGGCAGAGGG - Intergenic
1182983937 22:34698819-34698841 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1184281742 22:43441345-43441367 CAGGTGACACAGTGGGCAGAGGG - Intronic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1184744483 22:46448264-46448286 CAGGGAAGACAGAGGGCATGGGG + Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184815975 22:46870267-46870289 GAGAGCAGACAGAGAGCAGAGGG - Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
950788766 3:15456001-15456023 CAGGGTAGAAAGGGGTCAGCTGG + Exonic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
952105091 3:30060013-30060035 AAGGGAAGTCAGTGGGCAGAAGG - Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953242873 3:41165393-41165415 CAGGGCAGCAATAGGGCAGAGGG + Intergenic
953291135 3:41664390-41664412 CATGGAAGACAGAGGACATAAGG - Intronic
953551373 3:43906401-43906423 CAGGGTAGGCAGTGGCCAGGTGG - Intergenic
953623363 3:44551282-44551304 CAGGGGAGAGAGAGAGCAAAGGG + Intergenic
954689805 3:52389652-52389674 CAGGGTAGGAAGGAGGCAGAAGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955084347 3:55688253-55688275 CAGGTTAGAAAGAGTGCTGACGG + Intronic
956127673 3:66026663-66026685 GAGGATAGAGAGAGGGCACACGG + Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
956859291 3:73306612-73306634 CAGAGAAGACAGAGGACAGTGGG + Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959370394 3:105517372-105517394 CACACTAGACAGAGGGCAGTAGG - Intronic
959596754 3:108137081-108137103 CAGTGCAGACATAGAGCAGAAGG + Intergenic
960263183 3:115591182-115591204 CGGGATAGCCAGAGGGCAGATGG + Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
963206548 3:142642123-142642145 CAGGTTAGACAGAGGTGACAAGG - Intronic
964116283 3:153139526-153139548 CAGGGTGGACTGAGGACTGAAGG - Intergenic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
968570301 4:1336839-1336861 CCTGGAAGACAGAGAGCAGAGGG - Exonic
968741100 4:2332194-2332216 CAGGGAACACTGAGAGCAGAGGG - Intronic
968813341 4:2809784-2809806 CAGGGCAGGCAGAGGGCCAAGGG - Intronic
968908113 4:3463751-3463773 CAGGGCAGACTGAGGCCCGAGGG + Intronic
968925967 4:3548705-3548727 GAGGGCAGACACAGGGCAGTGGG - Intergenic
969163378 4:5281093-5281115 CAGGAGAGAGAGAGGGCAAAGGG + Intronic
969227620 4:5809254-5809276 CAGAGTACACTGAGGTCAGAGGG - Intronic
969246185 4:5934492-5934514 AAAGGTAGACAGGGGCCAGACGG - Intronic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
969394538 4:6911504-6911526 GAGGGTAGGCTGGGGGCAGACGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970087096 4:12362034-12362056 CAGGAGAGACAGAGAGCACAGGG + Intergenic
970457183 4:16236491-16236513 CAAGCTAGGCACAGGGCAGAGGG + Intergenic
970943130 4:21658820-21658842 CAAGGGAGACAGAGGTCACAGGG - Intronic
971156460 4:24088327-24088349 CCTGGGAGACAGAGGACAGAGGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971733299 4:30414133-30414155 AATGGAAGACAGAGGGCAGTGGG + Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972694667 4:41433901-41433923 GAGGGAGGACTGAGGGCAGAGGG + Intronic
974362606 4:60901674-60901696 TAGGGTAGACACAGTCCAGAGGG - Intergenic
974439372 4:61897527-61897549 AAGAGTAGGCAGAGTGCAGAGGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976114486 4:81712380-81712402 CAGGGTAGACATAGTTCATATGG + Intronic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
978754754 4:112290221-112290243 CATGGCTGACAGAGGACAGAAGG + Intronic
980420023 4:132547014-132547036 AAGGGAAGACACAGGACAGAAGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
983475207 4:168204508-168204530 CAGGAGAGAGAGAGGGCAAAGGG - Intergenic
983890021 4:173021120-173021142 GAGGAAAGACAGAGGGGAGAGGG - Intronic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986325451 5:6669978-6670000 CTGGGCTGACAGAAGGCAGAGGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
987838819 5:23196738-23196760 CAGGGTTGAAAGAGGGCAAGAGG - Intergenic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
988368819 5:30339993-30340015 CATGGTAGACATCAGGCAGATGG - Intergenic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989362790 5:40622860-40622882 CAGGGTTGTGAGAGAGCAGAGGG - Intergenic
989758186 5:44981686-44981708 GAGGGTAGACAGAGGAGAGCTGG + Intergenic
990323504 5:54651951-54651973 CAAGGTAGACAAAGTGTAGAAGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
991505671 5:67321506-67321528 CAGGAGAGACAGAGAGCAAAGGG - Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
992559945 5:77941427-77941449 CAGAATAGACAAAGGGCAGTGGG + Intergenic
993110536 5:83651777-83651799 GAGGGTGGACATTGGGCAGAGGG + Intronic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
994632837 5:102307439-102307461 CATGGTAGAGAGAGACCAGATGG + Intergenic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996423882 5:123291776-123291798 CTAGGAAGACAGAGGGCTGAAGG + Intergenic
997469106 5:134106940-134106962 CAGGGAGGACAGAGACCAGAGGG - Intergenic
997589024 5:135061724-135061746 GAAGGTACACAGAGGTCAGAGGG - Intronic
997645602 5:135479524-135479546 CAGGGGAGACACAGTGCAAATGG - Intergenic
998285000 5:140850603-140850625 CAGGCTAGACACCGCGCAGATGG - Exonic
998382020 5:141732379-141732401 CAGAGAAGAGAGAGGGGAGAAGG - Intergenic
998789315 5:145748832-145748854 CAGGTTTGTCAAAGGGCAGATGG - Intronic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
998976004 5:147648731-147648753 CAGGGCAGGGAGAGTGCAGAGGG + Intronic
999518882 5:152330082-152330104 CAAGGCTGACAGATGGCAGAGGG - Intergenic
999611900 5:153378742-153378764 CAGGGTAGGCCAAGGGCATATGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000897182 5:166869191-166869213 CTGGGTAGACAGAGAAGAGAAGG - Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1004527623 6:16424135-16424157 TAAGGTAGACAGAGGGCAGGTGG + Intronic
1005992195 6:30910264-30910286 AAGGGTGGAAAGATGGCAGAGGG + Intronic
1006358516 6:33574449-33574471 CGGGGCACAGAGAGGGCAGAGGG + Intronic
1006435109 6:34021990-34022012 CGGGCAAGACAGACGGCAGACGG + Exonic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1006651020 6:35551643-35551665 TATGGCAGCCAGAGGGCAGAGGG + Intergenic
1006793224 6:36716969-36716991 GAGAGAAGAGAGAGGGCAGATGG + Intronic
1007071771 6:39043247-39043269 CAGGGAAGATAGAGGGCTGTGGG + Intergenic
1007262778 6:40575416-40575438 CAGGAAAGAAGGAGGGCAGATGG + Intronic
1007518390 6:42431513-42431535 CAGGGCAGCCACAGGGCAGTAGG - Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1009044120 6:58216929-58216951 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009219944 6:60971197-60971219 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1011628156 6:89299990-89300012 CAGGGGAGAAGGAGGGCTGAAGG + Intronic
1011798473 6:90983067-90983089 AAGGGTAGAAAGAGGGCATGGGG - Intergenic
1012103299 6:95119981-95120003 CAGAGGAGACAGAAGGCATATGG - Intergenic
1012535857 6:100296005-100296027 TAGGGGAGAGAGAGGGTAGAAGG + Intergenic
1013327064 6:109056924-109056946 CAGGGGAGGGAGAGGACAGATGG - Intronic
1013762161 6:113531359-113531381 AAGGGGTGACAGAGGGCACATGG + Intergenic
1013795924 6:113888717-113888739 CAGGGTAGACTGAGCCCATAGGG + Intergenic
1013941266 6:115666182-115666204 CTGGGTAGAAAGGAGGCAGAGGG - Intergenic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1015547143 6:134372799-134372821 CAGGGTAAAAAGTGGGCTGATGG + Intergenic
1015918335 6:138241290-138241312 CTGGGTAGACAGAGGAGTGATGG - Intronic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018235960 6:161723884-161723906 CAGGGAAGACAGAGAACAGTAGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020512048 7:9069021-9069043 CAGGGTAGTGAAAGGGTAGATGG - Intergenic
1022695841 7:32704715-32704737 GGGGGTTGGCAGAGGGCAGAGGG + Intergenic
1022974746 7:35546842-35546864 CAGGGCAGGGAGAGTGCAGAGGG - Intergenic
1023758556 7:43442846-43442868 CAGAGTAGACAGTGGACTGAAGG + Intronic
1024192931 7:47031085-47031107 CAGGGTCGCCAGGAGGCAGAGGG + Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024961086 7:54977503-54977525 CAGGGTAGACAGTGGAGACACGG + Intergenic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1026287662 7:68977442-68977464 AAGGCTGGACAGAGTGCAGAGGG + Intergenic
1026672841 7:72404654-72404676 GAGAGTAGAAAGAGGGCAGAGGG - Intronic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032425633 7:131820200-131820222 AGGGGCAGGCAGAGGGCAGATGG - Intergenic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036229727 8:6989666-6989688 CAAGGTAGGCAGAGTGAAGAGGG + Intergenic
1036232178 8:7008769-7008791 CAAGGTAGGCAGAGTGAAGAGGG + Intronic
1036778497 8:11629752-11629774 CAGAGAAGACAGAGGCGAGAAGG + Intergenic
1037590552 8:20308391-20308413 CAGAGAAGACAGAGGAGAGATGG - Intergenic
1037750494 8:21679059-21679081 GAAGGCAGACAGAGGGCAGAGGG - Intergenic
1037820213 8:22131545-22131567 CAGGGCAGACACAGGCCAGTGGG - Exonic
1037876830 8:22552539-22552561 CAGGGTTGAGAAGGGGCAGATGG + Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038113635 8:24528233-24528255 CATGGTAGAAAGAGGGGAGGGGG + Intergenic
1038164382 8:25071154-25071176 CTGGGTAGAAAGAGACCAGAAGG + Intergenic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1040341576 8:46443749-46443771 TGAGGTAGACAGAGGGGAGAAGG - Intergenic
1040836537 8:51737532-51737554 CAGGGTAGAAAGAGGAGAAAGGG - Intronic
1040941043 8:52833995-52834017 CAGGGAAGACTGAGGGCTGCAGG - Intergenic
1041945836 8:63441787-63441809 CATGGTAGACAGAGGGTAAGTGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044406622 8:91834155-91834177 CAGGCTAGACACATGGCAGCAGG + Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1045954150 8:107887554-107887576 CAGGGTATACAGGGGACACAGGG - Intergenic
1046532199 8:115461212-115461234 AAGGGTAGATAGATGACAGATGG + Intronic
1046768414 8:118095217-118095239 CAGGGATAACAGAGGGCAAAAGG - Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047501539 8:125445631-125445653 CAGGGGAGACAAAGGAGAGAGGG - Intergenic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048409444 8:134156750-134156772 TAGGGAAGACAGAGCACAGATGG - Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1048881673 8:138877091-138877113 GAGGGGAGGCAGAGGGCTGATGG - Intronic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049726190 8:144147590-144147612 CGGGGCAGACAGAGGGCGGGCGG + Intergenic
1051586512 9:18732469-18732491 CAGGGGAGACAGAGTCCAAAGGG + Intronic
1052175866 9:25462684-25462706 CAGGAAAGAAAGAGGGCACAGGG + Intergenic
1053800851 9:41763883-41763905 GAGGGCAGACACAGGGCAGTGGG - Intergenic
1054144345 9:61550956-61550978 GAGGGCAGACACAGGGCAGTGGG + Intergenic
1054189282 9:61976033-61976055 GAGGGCAGACACAGGGCAGTGGG - Intergenic
1054464033 9:65481915-65481937 GAGGGCAGACACAGGGCAGTGGG + Intergenic
1054649235 9:67612578-67612600 GAGGGCAGACACAGGGCAGTGGG + Intergenic
1054844832 9:69783305-69783327 CATGGAAGTCAGAGGGCAGTGGG - Intergenic
1054931301 9:70638130-70638152 CAGAAGAGACAGAGGGCAAAAGG - Intronic
1055115130 9:72597774-72597796 CAGGGAAGACAGAGAACAGAGGG - Intronic
1055340763 9:75280439-75280461 CAAAGCAGACAGAGTGCAGAAGG - Intergenic
1055372321 9:75613372-75613394 CAGGGAAGCCAGGGGACAGATGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057439187 9:95070177-95070199 CAGAGTAGCCACAGGGCAAACGG - Intronic
1057560882 9:96127024-96127046 CAGGGAAGATAGTGGGCAAAGGG + Intergenic
1057968478 9:99529542-99529564 CAGGGTAGAAATAGGGCTGGTGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058318124 9:103594384-103594406 TAGGGAATACAGAGGGCAAATGG - Intergenic
1059312291 9:113396831-113396853 CAGGGCAGGAAGAGGGCAGTGGG + Intronic
1060374413 9:123105803-123105825 CAGATTAGACAGAGAGCAGGTGG + Intergenic
1061231972 9:129320501-129320523 CAAGCTAGACTGAGGGCGGAGGG - Intergenic
1061595200 9:131624473-131624495 CAGGGTCTATAGAGGGGAGAAGG - Intronic
1061613445 9:131763624-131763646 ATGGGCAGACAGAGGGCAGAGGG + Intergenic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1061927633 9:133813749-133813771 CAAAGTTGGCAGAGGGCAGATGG + Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1061973420 9:134056594-134056616 GAGGGCAGCCAGAGGGCAAAGGG + Intronic
1062582232 9:137233806-137233828 GTGGGCAGACAGAGGTCAGAGGG - Intronic
1203699260 Un_GL000214v1:122508-122530 TAGGAAAGAGAGAGGGCAGAAGG + Intergenic
1203700209 Un_GL000214v1:128818-128840 TAGGAAAGAGAGAGGGCAGAAGG + Intergenic
1203701125 Un_GL000214v1:134802-134824 TAGGAAAGAGAGAGGGCAGAAGG + Intergenic
1203569556 Un_KI270744v1:118756-118778 TAGGAAAGAGAGAGGGCAGAAGG + Intergenic
1203570506 Un_KI270744v1:125037-125059 TAGGAAAGAGAGAGGGCAGAAGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1203632661 Un_KI270750v1:83219-83241 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1185433956 X:26580-26602 GAGGGCAGATAGAGAGCAGACGG + Intergenic
1185434768 X:34445-34467 GAGGGCAGATAGAGAGCAGACGG + Intergenic
1185435449 X:41029-41051 GAGGGCAGATAGAGAGCAGACGG + Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1189231259 X:39454167-39454189 CCGGTCAGGCAGAGGGCAGACGG + Intergenic
1191656433 X:63603887-63603909 CAGGAGAGAGAGAGGGCACAGGG - Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192805059 X:74501406-74501428 TAGGGTAGGAGGAGGGCAGAGGG + Intronic
1192902638 X:75516443-75516465 CAGGTTTGACAAAGAGCAGATGG - Intronic
1196002067 X:110796327-110796349 CAGGGGAGTCAGAGGGTAGTCGG - Intergenic
1196009327 X:110870332-110870354 CAGGATTGACAGATGGCATAGGG + Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196579205 X:117359865-117359887 CAGGGTTGCCAAAGGTCAGATGG - Intergenic
1199062712 X:143377484-143377506 CAGGAGAGAGAGAGAGCAGAAGG + Intergenic
1199692791 X:150321329-150321351 CAGGATAGACAGCAGGCATAGGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1201441421 Y:14012769-14012791 AAGGGGTGACAGAGGGCACATGG + Intergenic
1201443149 Y:14029938-14029960 AAGGGGTGACAGAGGGCACATGG - Intergenic
1201470163 Y:14324481-14324503 AATGGAAGACAGAAGGCAGAAGG - Intergenic
1202369245 Y:24186093-24186115 CAGGGTACACAGGGGTCTGAGGG + Intergenic
1202501540 Y:25484024-25484046 CAGGGTACACAGGGGTCTGAGGG - Intergenic