ID: 960734913

View in Genome Browser
Species Human (GRCh38)
Location 3:120768361-120768383
Sequence GTGCCTGATGGGAGACATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960734913 Original CRISPR GTGCCTGATGGGAGACATTG AGG Intronic
901161813 1:7183311-7183333 GGGCCTGATGGGAGTTATTGGGG - Intronic
901276677 1:7996944-7996966 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
902675681 1:18006905-18006927 GTGTCTCATGGGAGACTTTCAGG + Intergenic
904993879 1:34615952-34615974 GTGCCAGATGGGAGATAGAGAGG - Intergenic
905426854 1:37892692-37892714 GTGATTGATTGGAGGCATTGAGG - Intronic
905793280 1:40801627-40801649 GTGCCAGATGGTAGACACCGGGG - Intronic
906746477 1:48225432-48225454 TGGCTTGATGGGAGAAATTGTGG - Intronic
907034727 1:51206280-51206302 GTGTCTAATGGGAGGCATTTAGG - Intergenic
908127325 1:61044061-61044083 GGGCCTGGTGGGTGACAGTGAGG + Intronic
908583249 1:65540353-65540375 GGGCCTGGTGGGAGATATTTGGG + Intronic
918779440 1:188678898-188678920 GTTCCAGATGGGAGAGAGTGGGG - Intergenic
919025923 1:192170274-192170296 GAGCCTAGTGGGAGACATTTGGG + Intronic
921279052 1:213547592-213547614 GGGCCTGATGGGAGGTATTTGGG + Intergenic
922209436 1:223476261-223476283 GTGCTTGATGAGAGACAGGGAGG - Intergenic
922712125 1:227842109-227842131 GGGCCTAATGGGAGGCATTTGGG - Intronic
922998434 1:229985329-229985351 CTGCCTGAAGGGACACATGGAGG - Intergenic
923087066 1:230710034-230710056 CTCCCTGATGGGAGCCAGTGTGG - Exonic
923117270 1:230953970-230953992 GTATCTCATGGGAGATATTGTGG + Intronic
923379705 1:233403954-233403976 GTGCCTGATGGGAGCTGTTTAGG + Intergenic
924111375 1:240703049-240703071 GTGACTGATGGGTCAGATTGGGG + Intergenic
1062788695 10:286932-286954 GTGCCAGAAGGGAAAGATTGTGG + Intronic
1062809894 10:455313-455335 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809902 10:455368-455390 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809910 10:455425-455447 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809918 10:455482-455504 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809944 10:455653-455675 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809952 10:455710-455732 CTGCCTGAGGGGAGACCGTGAGG + Intronic
1062809996 10:455995-456017 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062810003 10:456052-456074 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062810019 10:456166-456188 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062810061 10:456451-456473 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1063699245 10:8368911-8368933 GTGCTTTATGGCAGACCTTGGGG - Intergenic
1064089004 10:12367596-12367618 GGGGGTGATGGGAGACAGTGAGG + Intronic
1064653173 10:17530010-17530032 GGGCCTGATGGGAGGTATTTAGG + Intergenic
1065181348 10:23129362-23129384 GTGTCTCATGGGACACCTTGTGG - Intergenic
1065447518 10:25818785-25818807 GTACGAGATGGGAGACATTGGGG - Intergenic
1065706881 10:28478590-28478612 CTTCCTAATGGGAGACAATGAGG + Intergenic
1066043784 10:31579075-31579097 GTGCCTGATGGCAGAGATACCGG - Intergenic
1067026992 10:42851507-42851529 GTGAATGATTGGATACATTGTGG - Intergenic
1069489348 10:68848143-68848165 GTGCCAGGTGGGAGATAGTGAGG + Intronic
1069778057 10:70938221-70938243 GTGGCTGATGGGAGAGTTTCCGG + Intergenic
1072465414 10:95657790-95657812 GGGCCTAATGGGAGGCATTTGGG + Intergenic
1072550774 10:96475677-96475699 GTCCCTGGAGGGAGACATGGGGG - Intronic
1075417730 10:122277767-122277789 GGGCCTAATGGGAGGCATTTTGG - Intronic
1076340294 10:129740794-129740816 GTGGATGATGGGGGACCTTGAGG + Intronic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077378912 11:2218936-2218958 GGGCCTGATGTGAGCCGTTGGGG - Intergenic
1080869821 11:36227435-36227457 GTGCTGGATGGAAGAGATTGAGG + Intronic
1083148364 11:60774808-60774830 GTGCACGATGGGATGCATTGAGG + Intronic
1083762593 11:64826791-64826813 GAGCCTGTTGGGTGACAGTGCGG + Exonic
1085016306 11:73176311-73176333 GTGCCTCAAGGGAGACTATGGGG + Intergenic
1085460011 11:76687916-76687938 GTGCCTGAAGGGACAGACTGGGG + Intergenic
1086399659 11:86450101-86450123 GGGCCTCCTGGGAGTCATTGAGG - Intronic
1086596176 11:88573994-88574016 GTGTGTGCTGTGAGACATTGAGG + Intronic
1087069320 11:94061308-94061330 GTGGCTGATGGGTGGCACTGTGG + Intronic
1087699330 11:101417869-101417891 GGGCCTAATGGGAGGCATTTGGG - Intergenic
1088711756 11:112514590-112514612 TTGGCTGCTAGGAGACATTGTGG + Intergenic
1089680613 11:120117054-120117076 GTGCCTGCTGGGAGAGAGAGAGG + Intronic
1089821231 11:121228080-121228102 GGGCCTGGTGGGAGGCATTTGGG - Intergenic
1090395141 11:126413969-126413991 GGGCCTCTTGGGAGACATTATGG - Exonic
1091230437 11:133984567-133984589 GGGCTTGATGGGAGCCCTTGTGG - Intergenic
1091588045 12:1827257-1827279 GTCCCAGTTGGGAGACACTGGGG + Intronic
1092144910 12:6207886-6207908 GTGCCTGAGGGAAGAAATAGTGG + Intronic
1094783678 12:33821369-33821391 GGGCCTAATGGGAAACATTTAGG - Intergenic
1097224882 12:57471309-57471331 GGGCCTGACTGGAGATATTGGGG - Exonic
1098218524 12:68244399-68244421 GTGCCTGGTTGCAGCCATTGAGG + Intergenic
1098287243 12:68919953-68919975 GAGCCTGGTGGGAGACGTTTGGG + Intronic
1099609552 12:84850397-84850419 GGGCCTGATGGGAGACGTTTGGG - Intergenic
1099998492 12:89806064-89806086 GGGCCTAATGGGAGATATTTGGG + Intergenic
1103265586 12:119627657-119627679 GGGCCTGGTGGGAGATGTTGTGG - Intronic
1105682117 13:22739042-22739064 AGGCCAGATGGGAGAAATTGAGG - Intergenic
1106492098 13:30235463-30235485 GTGCCTGATGGGAGGAGTTTGGG - Intronic
1107782969 13:43924792-43924814 GTGCCTGGTAGGAGGCATTTGGG - Intergenic
1109246890 13:59965837-59965859 GTGCCTCATGCTTGACATTGGGG - Intronic
1110472704 13:75877858-75877880 GTGCCTCCTGGGGGATATTGTGG + Intronic
1110913849 13:80997690-80997712 CTGCCTAATGGGAGGCATTTGGG + Intergenic
1112162788 13:96886586-96886608 AGGCCTAATGGGAGACATTCAGG + Intergenic
1113957048 13:114104591-114104613 GTGGCTGATGAGAGGCTTTGTGG - Intronic
1115494081 14:33985238-33985260 TTGCCTTCTGGGAGACCTTGAGG - Intronic
1117387595 14:55231732-55231754 GTGAGTGATGGCAGTCATTGTGG + Intergenic
1118660319 14:68002239-68002261 CTGACTGATGTGAGCCATTGTGG + Intronic
1119348146 14:73943173-73943195 GTGACTGATGAGAGACACGGAGG - Intronic
1119633695 14:76256834-76256856 GAGGCTGATGGGAGGCTTTGAGG - Intergenic
1119884962 14:78132482-78132504 GTGCCTGATGGAACCTATTGAGG + Intergenic
1119905011 14:78293721-78293743 GTCATTGATGGGAGACATTGAGG - Intronic
1120615535 14:86699380-86699402 GATCCAGATGGGAGATATTGGGG - Intergenic
1121888539 14:97567217-97567239 GTGCCAGATGTGAGATATGGAGG - Intergenic
1125349556 15:38752977-38752999 GGGTCTGATGGGAGGCATTTGGG + Intergenic
1125800770 15:42444674-42444696 GTGCCTAATGGGGGACAGTTAGG - Intronic
1127053230 15:55106304-55106326 GGGCCTGATGGGAGGCGTTTGGG + Intergenic
1127507168 15:59608717-59608739 GGGCCTGATGGGAGATGTTTGGG - Intronic
1128385585 15:67145936-67145958 CTGCCTGCTGGGTGACCTTGTGG + Intronic
1129638919 15:77353793-77353815 TTCTCTGCTGGGAGACATTGTGG - Intronic
1131835739 15:96388887-96388909 GTGCTTCATGGTAGACAATGAGG - Intergenic
1138658314 16:58503218-58503240 CTGCCTGAAGGGAGCCCTTGAGG + Intronic
1141987459 16:87589184-87589206 GTGGCTGATGGCAGAGATTCAGG + Intergenic
1143179932 17:4978340-4978362 CTGCCTGCTGGGAGAGCTTGGGG + Intronic
1143274020 17:5696612-5696634 AGGCCAGAAGGGAGACATTGGGG - Intergenic
1143502727 17:7348425-7348447 GGGCCTGATGGAAGGCTTTGGGG - Exonic
1144082956 17:11781280-11781302 GTGCCAGATGGGAATCTTTGTGG + Intronic
1144218983 17:13083043-13083065 GGGCCTGATGGGAGATGTTTGGG - Intergenic
1144322225 17:14138620-14138642 GTGCCTGGTGGGCCACATTTTGG + Intronic
1148665848 17:49374257-49374279 GAGCCTGATGGGAGGTATTGGGG + Intronic
1150354501 17:64471448-64471470 GTGCCTGGGGTGAGACACTGAGG - Intergenic
1153433275 18:5041658-5041680 GAGCCTGATGGGAGATGTTTAGG + Intergenic
1154324329 18:13379281-13379303 GTGCCCCATGGGGGACATCGTGG - Intronic
1155248504 18:23933992-23934014 CTGCCTTGTGGGAGATATTGGGG + Intronic
1155353507 18:24929142-24929164 GTCCCTGCTAGGAGACAGTGAGG + Intergenic
1158266897 18:55669238-55669260 GAGGCTGATGGGAGAGAATGGGG + Intergenic
1160015667 18:75138495-75138517 GGGCCTCATGGGAGGCATTTAGG - Intergenic
1160403964 18:78631665-78631687 GCCCCTGAAGGGAGAGATTGTGG + Intergenic
1164858573 19:31544503-31544525 GGGCCTGATGGGAGATATTTGGG - Intergenic
1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG + Exonic
1165930899 19:39357774-39357796 GTGACAGATGGGAGAGATGGAGG + Intronic
1167018047 19:46854527-46854549 GTGCCTGTTATGAGCCATTGTGG - Intergenic
925356884 2:3248037-3248059 GGGCCTGGTGGGAGGTATTGGGG + Intronic
927343537 2:22010017-22010039 GGGCCTGGTGGGAGGCATTTAGG + Intergenic
928945214 2:36765951-36765973 GTGCCTGCTGGGCCCCATTGGGG - Intronic
929326237 2:40614741-40614763 GGGCCTGATGGGAGATGTTTGGG - Intergenic
930118465 2:47740196-47740218 GGGCCTGGTGGGAGGCATTTGGG - Intronic
931837631 2:66115795-66115817 GTTCTAGATGGGAGACATAGGGG + Intergenic
933370854 2:81413550-81413572 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
933834292 2:86232773-86232795 GTGCCTTATCGGAGAGACTGCGG - Exonic
937927564 2:127178723-127178745 GTGTCTCGTGTGAGACATTGGGG + Intergenic
941843176 2:170109350-170109372 GTGACTGCTGGGAGACCTTGGGG - Intergenic
942364718 2:175212770-175212792 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
943150036 2:184100040-184100062 GTGCCTGGTGGGAGATGTTTGGG + Intergenic
943232969 2:185279552-185279574 ATGCATGGAGGGAGACATTGTGG + Intergenic
944581663 2:201137456-201137478 GTGCCTGAAGGTGGACACTGGGG + Intronic
945212938 2:207402367-207402389 GGGCCTGATGGGAGGTATTTGGG + Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947444722 2:230155179-230155201 GTGCCTGAAGGGATCCATTAAGG - Intergenic
1169981929 20:11394358-11394380 GTGTCTGATGGAAGACATCAGGG - Intergenic
1170026464 20:11893699-11893721 TTTCCTGTTGGGAGACATTTTGG + Intronic
1171278424 20:23877725-23877747 GTGCCTTTTGGGTGACAGTGTGG - Intronic
1173905329 20:46624107-46624129 ATGCCTTGTGGGAGACAGTGAGG - Intronic
1173941156 20:46912640-46912662 GAGGTTGATGGGAAACATTGAGG + Intronic
1174135824 20:48378464-48378486 GGGCCTGATAGGAGACGTTTGGG + Intergenic
1174546876 20:51332283-51332305 GGGCCTGATGGGGGATAGTGGGG - Intergenic
1174571614 20:51506153-51506175 GTGCCTGCTTGGAGAGATAGTGG - Intronic
1177153058 21:17473846-17473868 GGGCCTGGTGGCAGACATTTTGG + Intergenic
1177288485 21:19080319-19080341 GGGCCTGATGGGAGATGTTTGGG + Intergenic
1178432092 21:32525910-32525932 GTCCCTGAGGGCAGACCTTGGGG + Intergenic
1179495759 21:41770335-41770357 GTGATTTAGGGGAGACATTGAGG + Intergenic
1181410306 22:22713684-22713706 GTGCCAGGTGGGTCACATTGAGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1181915141 22:26273792-26273814 GTGCAGGATGGGATAGATTGGGG + Intronic
1182593439 22:31399639-31399661 GTGTGTGAAGGGAGACAGTGTGG + Exonic
1184010636 22:41745428-41745450 ATGCCTGATGCTAGACAGTGAGG + Intronic
1184969158 22:48002928-48002950 GAGCTTGGTGGGAGACAATGGGG + Intergenic
1185138133 22:49085291-49085313 GTGGCAGTTGGGGGACATTGTGG - Intergenic
950561920 3:13735839-13735861 GTCCCTGCTGGGAGACATGGGGG + Intergenic
950661765 3:14471284-14471306 GTCTCTGATGGGAGACATTCCGG - Intronic
952122898 3:30265840-30265862 GGGCCTAATGGGAGGCATTTGGG + Intergenic
957147511 3:76443247-76443269 GGGCCTGATGGGAGGTATTTGGG - Intronic
957273313 3:78058927-78058949 ATGCCTCATGGGAGACACGGGGG + Intergenic
958038750 3:88200872-88200894 GGGCCTGGTGGGAGATATTTGGG - Intergenic
958145673 3:89621556-89621578 GTGACTGATGGGCAACATGGAGG - Intergenic
960734913 3:120768361-120768383 GTGCCTGATGGGAGACATTGAGG + Intronic
964458327 3:156893489-156893511 GGGCCTGGTGGGAGATATTTAGG + Intronic
966550391 3:181198745-181198767 TGGCCTGATGGGAGGCATTTTGG - Intergenic
967208150 3:187142668-187142690 GGGCCTGATGGGAAATATTTGGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969391063 4:6891642-6891664 GGGCCTGATGGGAGGCGTTTGGG - Intergenic
970538561 4:17054986-17055008 GGGCATGATGGGAGAGGTTGAGG - Intergenic
970603183 4:17656165-17656187 CTGCCTCATGTGAGAAATTGGGG + Intronic
971228224 4:24775094-24775116 GTCCCTGATGGCAGACACTTAGG - Intergenic
972338520 4:38129925-38129947 GTGGCTGTTGGGAGACAATTTGG + Intronic
973083216 4:46021801-46021823 GTGACTGGTGTCAGACATTGGGG - Intergenic
973582848 4:52361377-52361399 GGGCCTGATGAGAGACGTTTAGG + Intergenic
975246714 4:72128765-72128787 GTGCATGATGGGAAATACTGTGG + Exonic
975745246 4:77468910-77468932 GTGGCTGAGGGGATACAATGTGG - Intergenic
976222518 4:82769116-82769138 GTGCTTGAGGGGAGACCATGGGG - Intronic
977871510 4:102096000-102096022 GGGCCTAATGGGAGATATTTGGG + Intergenic
978141077 4:105318058-105318080 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
981887707 4:149697225-149697247 GGTCCTGAAGGGAAACATTGTGG - Intergenic
982660414 4:158200120-158200142 GGGCCTAATGGGAGACGTTTGGG + Intergenic
983468247 4:168122812-168122834 GGGCCTAATGGGAGGCGTTGGGG - Intronic
984116163 4:175683573-175683595 GGGCCTGATGGGAGGCATTTGGG + Intronic
984726555 4:183027595-183027617 GTGCCTCATGCCAGACATGGTGG + Intergenic
988465425 5:31486591-31486613 GAGCCTGCAGGGAGACGTTGGGG - Intronic
992675669 5:79103641-79103663 TTTCCTGATGAGAGAAATTGAGG + Intronic
994246247 5:97480863-97480885 GTGTGTGATGTGAGACATTTGGG - Intergenic
995010802 5:107255372-107255394 GTGCTTGATGGGTACCATTGTGG + Intergenic
995911489 5:117193081-117193103 GGGCCTGGTGGGAGATATTTGGG + Intergenic
996930012 5:128874974-128874996 GGGCCTGGTGGGAGCCATTTTGG + Intronic
999566425 5:152867653-152867675 GTGCCTAATGGGAGGTATTTGGG + Intergenic
1000902234 5:166925274-166925296 GGGCCTTATGGGAGGCGTTGGGG - Intergenic
1008074115 6:47128002-47128024 GTGCCACATGGGTGACTTTGGGG - Intergenic
1008271518 6:49495520-49495542 GGGCCAGATGGGAGAAATTTGGG + Intergenic
1008678454 6:53845913-53845935 GTGCCTGAGGGGAGTGAATGTGG - Intronic
1011212896 6:84973062-84973084 CTGCATGATGTGAGACAATGTGG + Intergenic
1012305194 6:97647198-97647220 GTGCCTAATGAGAGATATTTGGG - Intergenic
1013287710 6:108695145-108695167 ATCCCAGATGGGAGACATTCAGG - Intergenic
1016685423 6:146876575-146876597 ATGCCCTATGGGAGACCTTGTGG - Intergenic
1020106046 7:5422774-5422796 GAGCCTGATGGGAGAGAGGGAGG - Intronic
1020204145 7:6102627-6102649 GTGCCTGTGGGGACACACTGTGG + Intergenic
1020380472 7:7539466-7539488 GGGCCTGATGGGAAACGTTTGGG - Intergenic
1022415286 7:30172038-30172060 GTGCCTGATGGCAGATGATGAGG - Intergenic
1023990012 7:45123286-45123308 GTGCCTGATGGCCAACACTGTGG + Intergenic
1026288686 7:68986473-68986495 GGGCCTGATGGGAGATGTTTTGG + Intergenic
1026308940 7:69167183-69167205 GTGCCTGATGGGAAGTATTTGGG - Intergenic
1026601615 7:71782184-71782206 GGGCCTGCTGGGAGATATTTGGG + Exonic
1027349315 7:77294247-77294269 GTGCTTGATGACAGATATTGAGG + Intronic
1030147644 7:106372626-106372648 GGGCCTGATGGGAGATGTTTGGG + Intergenic
1030699125 7:112619554-112619576 GTGGCTGATGATAAACATTGTGG + Intergenic
1031226055 7:119039238-119039260 GTGCCTCAGAGGAGACTTTGAGG + Intergenic
1032988025 7:137360663-137360685 GTGTCTAATGGGAGTCATGGGGG + Intergenic
1035006291 7:155663569-155663591 GGGCCTGGTGGGAGGCGTTGGGG - Intronic
1037304465 8:17490981-17491003 GTGCCTGATGGGAGATGTTTGGG - Intergenic
1037732735 8:21541881-21541903 GTGCCTAATGGGAGGCGTTTGGG - Intergenic
1038278502 8:26141753-26141775 GGGCCTGGTGGGAGATATTTGGG + Intergenic
1040029741 8:42813642-42813664 GGGCCTGGTGGGAGATATTTCGG + Intergenic
1040493481 8:47946337-47946359 GTGGCTGATGGGAGATGTGGGGG - Intronic
1041733637 8:61087574-61087596 GTGCCTGGTGGGAGGAAGTGAGG + Intronic
1041767841 8:61438179-61438201 GTGCCTGTTGGGGGAGGTTGGGG - Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1043744196 8:83853058-83853080 GTGGATGATGGAAGACAGTGAGG - Intergenic
1043979136 8:86618019-86618041 GGGGGTGATGGGAGACAGTGAGG + Intronic
1045049743 8:98311917-98311939 GTGGCTTAGGGGAGACATAGGGG + Intergenic
1045347264 8:101304477-101304499 GGGCATGATGGGAGCCAGTGTGG - Intergenic
1048094777 8:131279751-131279773 ATGCAGGATGGGAGATATTGTGG + Intergenic
1048311079 8:133323020-133323042 AAGCCTCATGGGGGACATTGGGG + Intergenic
1056134317 9:83616571-83616593 GTGGCTGTTGGGAGAAAATGGGG - Intergenic
1056844456 9:90025284-90025306 GGTCCTGATGGGAGATATTTTGG + Intergenic
1057008041 9:91577993-91578015 GTGCCTAATGAGAGACAATAGGG + Intronic
1057061940 9:92011596-92011618 GAGCCTAATGGGAGGCATTTGGG - Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060671315 9:125472125-125472147 GTGGCTGAGGGGACACATTCTGG - Intronic
1061328282 9:129877175-129877197 GGGCCTGGTGAGAGACACTGAGG + Intronic
1185913961 X:4014191-4014213 GGGCCTGGTGGGAGACGTTTGGG + Intergenic
1187633527 X:21201743-21201765 GGGCCTGGTGGGAGATATTTGGG - Intergenic
1188295321 X:28440560-28440582 GGGCCTAATGGGAGGCTTTGGGG + Intergenic
1188512967 X:30956854-30956876 GTGACAGAGGGGAGACAATGTGG - Intronic
1188893624 X:35640019-35640041 CTGCCTGTTGACAGACATTGGGG - Intergenic
1193046230 X:77057792-77057814 GTGCCTAATGGGAGATGTTTGGG + Intergenic
1194451138 X:94045965-94045987 GTGCCTGCTGGGCTTCATTGGGG + Intergenic
1195386558 X:104318987-104319009 GTTCCTTTTGGGAGACAGTGGGG + Intergenic
1199296350 X:146163145-146163167 GGGCCTGATGGGAGGTATTTGGG + Intergenic
1199499451 X:148493955-148493977 GAGCCTGAGGGGGGCCATTGGGG + Intergenic
1200354249 X:155531523-155531545 GGGCCTGATGGGAGGTATTTGGG - Intronic