ID: 960736279

View in Genome Browser
Species Human (GRCh38)
Location 3:120784621-120784643
Sequence CAGGTGGTGTAGAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960736279 Original CRISPR CAGGTGGTGTAGAGGACAGA TGG (reversed) Intergenic
901083492 1:6596932-6596954 CAGGTGGTGTTCTGGGCAGAGGG + Intronic
901114328 1:6829484-6829506 CAGGTGGTAAAGATGACACAAGG + Intronic
901584045 1:10272085-10272107 CAAGTGGAAAAGAGGACAGATGG + Intronic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
902201924 1:14839958-14839980 AAGGTACTGGAGAGGACAGAAGG - Intronic
904927835 1:34062535-34062557 AAGGTGGTGAAGAGGGCAGAGGG + Intronic
906001465 1:42429899-42429921 CCTGTGATGGAGAGGACAGAGGG - Intergenic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
908870071 1:68600186-68600208 CAGGTGGAGGAAAGAACAGAAGG - Intergenic
908987027 1:70036722-70036744 CAAGTGGCATAGAAGACAGAAGG + Intronic
910108652 1:83658645-83658667 AAGGGAGTCTAGAGGACAGATGG - Intergenic
910272473 1:85411496-85411518 AATTTGGTGTAGAAGACAGAAGG - Intronic
910625894 1:89306002-89306024 TGGGTGGTGTAGAGGAAAGCTGG - Intergenic
912488492 1:110047894-110047916 CAGGTGGGGCAGAAGATAGATGG + Intronic
912801269 1:112720983-112721005 AAGGTGGTGCAGTGGGCAGAGGG + Intronic
912943923 1:114069065-114069087 CAGTTTGTGCAGAAGACAGATGG - Intergenic
913212537 1:116593584-116593606 CAAGGGGTGTTAAGGACAGAGGG - Intronic
915573632 1:156760460-156760482 GTGGTTCTGTAGAGGACAGATGG + Intronic
916025289 1:160828128-160828150 AAGGTGGTGTAAAGGACAGCTGG - Exonic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
916496801 1:165354686-165354708 CAAGAGGTTTAAAGGACAGAAGG + Intronic
917268165 1:173243669-173243691 CAGATAGTGGAGAGGACATATGG - Intergenic
917531486 1:175839934-175839956 CAGGTTGGGTAGAGGAAAAAAGG + Intergenic
918454189 1:184690061-184690083 CTGGGGTTGTAGTGGACAGATGG - Intergenic
920775351 1:208931325-208931347 CAGGTGGTAATGAGCACAGAGGG + Intergenic
921677926 1:217997464-217997486 CAGGTGGCCTAGAAAACAGAAGG + Intergenic
923027685 1:230219049-230219071 CAGATGGTGGAGAGGGGAGATGG - Intronic
923087831 1:230714504-230714526 CCGGAGGTGCAGAGGGCAGAGGG + Intergenic
923187574 1:231588877-231588899 CAGATGTTGTAGGGGACACAGGG - Intronic
923368199 1:233284521-233284543 CAGGTGCTGTACAGTAAAGATGG - Intronic
924056654 1:240130899-240130921 CAGGTGTTGTAAGGGAAAGAGGG - Intronic
924559172 1:245143414-245143436 CAGATGGGGGAGTGGACAGATGG - Intergenic
1065579630 10:27157138-27157160 CAGGTGGAGAAGAGCACAAAAGG - Intronic
1066247397 10:33596600-33596622 CTGGTGGTGGAGACCACAGAGGG - Intergenic
1066518328 10:36188412-36188434 GAGGAGGTGGAGAGGACAGGAGG - Intergenic
1067287018 10:44914215-44914237 GAGGGGTTGTAGAGCACAGACGG + Intronic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1068314113 10:55319804-55319826 CAGATGGTGCAGAGTCCAGAGGG + Intronic
1070483564 10:76909177-76909199 CAGAAGGTGGAGAGGACAGTGGG - Intronic
1074156522 10:110804924-110804946 CAGGTGCTTTTGAGGGCAGAGGG + Intronic
1074826954 10:117221539-117221561 CAGGTGGGGCAGAGAACACAGGG - Intergenic
1074958184 10:118413183-118413205 AAGGGCGTGTAGAGGACAAATGG - Intergenic
1075192127 10:120319274-120319296 CAGGTGCTGAGGAGGACAGGAGG + Intergenic
1076574281 10:131453601-131453623 CAGCTGGTTCAGAGGCCAGAGGG - Intergenic
1077076518 11:704842-704864 CAGGCGCTGGAGAGGACAGCTGG - Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1079502331 11:21115478-21115500 TGGGTGCTGTGGAGGACAGAGGG + Intronic
1079966760 11:26989629-26989651 CAGAAGGTGAAAAGGACAGAGGG - Intergenic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1080474680 11:32579055-32579077 CATGTGGTGGAGAGGAAAGACGG - Intergenic
1081425837 11:42925755-42925777 CATGTGCTGTAGGGGACAGCGGG - Intergenic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1083139415 11:60709745-60709767 CTGATGATGTAGAGGAGAGACGG - Intronic
1083292454 11:61697442-61697464 CAGGTGGTGCCAAGGACAGGAGG + Intronic
1084209516 11:67614576-67614598 GAGGTGGAAGAGAGGACAGATGG - Intergenic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085336688 11:75702045-75702067 CAGGCAGAGAAGAGGACAGATGG - Intergenic
1085376203 11:76063404-76063426 CAGGTGGTGAAGAGGTTAGTGGG - Intronic
1086642588 11:89178127-89178149 CAAGTGGTGCATTGGACAGAAGG - Exonic
1088587879 11:111376103-111376125 CAGGTGGTTTCCAGGACGGAAGG + Intronic
1088840633 11:113624687-113624709 CAGGTGGTGGCGAGGAGAGAGGG + Intergenic
1089175399 11:116545283-116545305 CAGGTAGGGGAGAGGAAAGATGG + Intergenic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1090775117 11:129957816-129957838 CAGGTGGTGTACACGGCAGATGG - Exonic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091553482 12:1554366-1554388 CAGGTGGGGCAGAGGAGCGAAGG + Intronic
1092992330 12:13914911-13914933 CAGGAAGGGTAGAGGAAAGAGGG + Intronic
1094623855 12:32105162-32105184 CAGGAGGTGGAGGGTACAGATGG - Intergenic
1096106869 12:49001148-49001170 CACATGGTGGAAAGGACAGATGG - Intergenic
1096995337 12:55834756-55834778 CAGATGGAGCAGAGGACATATGG + Intergenic
1097067756 12:56333408-56333430 GGGGTGGTGGAGAGTACAGAGGG - Intronic
1098022558 12:66170810-66170832 CAGCTGGTGTAGGGGACAGGTGG + Intergenic
1098917872 12:76275923-76275945 AAGGTGGAGTTGAGGTCAGAGGG + Intergenic
1099604818 12:84790254-84790276 CAGGTGGTGTACAGAGCAGGTGG - Intergenic
1100362842 12:93894157-93894179 CCACTGGTGTAGAGGAAAGAGGG - Intronic
1102416629 12:112768354-112768376 CAGGTGGTGTAGAGTGCAATAGG - Intronic
1104222197 12:126795903-126795925 CAGGTAGTTTACAGTACAGAGGG - Intergenic
1104642398 12:130475843-130475865 CAGGTGTTGGTGAGGACAGAGGG + Intronic
1105215781 13:18284207-18284229 CAAGGGGTGTTAAGGACAGAGGG - Intergenic
1106533013 13:30612290-30612312 GAGTAGGGGTAGAGGACAGAGGG + Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1107343223 13:39432078-39432100 CACGTGGTGCAAGGGACAGAAGG - Intronic
1109325283 13:60859809-60859831 CAGGTGCTGCAAAAGACAGAAGG - Intergenic
1109661684 13:65467734-65467756 CAGTGGGTGTAGACCACAGAGGG - Intergenic
1110598018 13:77340316-77340338 CAGTTGGTATAGAGAAAAGAGGG + Intergenic
1112422754 13:99268022-99268044 CAGCTGGTGTGGAAGAAAGAAGG + Intronic
1113481512 13:110625394-110625416 CAGGTGCTGTAGAGGAAGTAGGG + Intronic
1114059059 14:19002290-19002312 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1114103484 14:19399464-19399486 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1114744052 14:25127677-25127699 CAGATGGTGTAGATTTCAGATGG + Intergenic
1116228037 14:42178305-42178327 CAGGGTGTGTTTAGGACAGAAGG + Intergenic
1118974538 14:70665404-70665426 CAGGTGAGGAAGGGGACAGAAGG + Intronic
1119205053 14:72787976-72787998 CAGGTGCTGGAGAGAAGAGAGGG + Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1120744211 14:88139382-88139404 CACATGGTGCAGAAGACAGATGG + Intergenic
1124857740 15:33407088-33407110 CACGTGGTGGAAGGGACAGAAGG + Intronic
1126666926 15:51083778-51083800 CAGGGGGTGAACAGGGCAGAAGG + Intronic
1130178183 15:81596814-81596836 CAGGTGGGGAAGATGCCAGAAGG + Intergenic
1132202120 15:99962239-99962261 CCGGTGGGGAAGAGGGCAGAAGG + Intergenic
1132786089 16:1657699-1657721 CAGTTGGTGGAGCCGACAGATGG + Intronic
1132977867 16:2719598-2719620 CAGGGGGTGTAGGTGGCAGAGGG - Intronic
1134042117 16:11076729-11076751 GAGGTGATGTATAGGAGAGATGG - Intronic
1134523987 16:14930618-14930640 GACGTGGTGTGGCGGACAGAGGG + Intronic
1134548916 16:15130317-15130339 GACGTGGTGTGGCGGACAGAGGG - Intronic
1134711580 16:16329103-16329125 GACGTGGTGTGGCGGACAGAGGG + Intergenic
1134719431 16:16372402-16372424 GATGTGGTGTGGCGGACAGAGGG + Intergenic
1134947995 16:18339483-18339505 GATGTGGTGTGGCGGACAGAGGG - Intergenic
1134955249 16:18379590-18379612 GACGTGGTGTGGCGGACAGAGGG - Intergenic
1136110543 16:28061946-28061968 TAAGTGGTTTAGAGGGCAGAGGG - Intronic
1136184103 16:28575159-28575181 CAGGTGGTGGTGAAGCCAGATGG - Intronic
1137024944 16:35464409-35464431 CAGGTGGGGTGGTGGAGAGAAGG + Intergenic
1137332611 16:47514191-47514213 TAGGTGGAGGAGAGGAGAGAGGG + Intronic
1137498996 16:48996159-48996181 CAGATGGGGCAGGGGACAGATGG + Intergenic
1138087246 16:54144137-54144159 CAGGTGTTCTAGAGACCAGAGGG + Intergenic
1138242243 16:55436409-55436431 CAAGTGGTGGAGAGGACAAGGGG - Intronic
1138770452 16:59656452-59656474 CAGATGGTGAACAGGACAGCAGG + Intergenic
1139266355 16:65642879-65642901 CAGATGGTTTAGGGGGCAGATGG - Intergenic
1139654754 16:68380590-68380612 GAGGTGGTGCTGAGGGCAGAGGG - Intronic
1141325181 16:83050367-83050389 CAGCTGCTGTAGAAGACAGTTGG - Intronic
1141672380 16:85499047-85499069 CAGGAGGAGTTGAGGCCAGATGG + Intergenic
1141928323 16:87183833-87183855 CAGGTGGTGCAGCTGGCAGAGGG - Intronic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1143445326 17:7005928-7005950 CAGGTCGTCAGGAGGACAGAGGG - Exonic
1145940142 17:28739015-28739037 CAGGGGGTGTTGAAGCCAGATGG + Intronic
1146280276 17:31540165-31540187 CAGGTGGTGTAGAGTCTAGGGGG + Intergenic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1146314936 17:31799487-31799509 GAAGTGGTGATGAGGACAGAAGG - Intergenic
1147505124 17:41008720-41008742 CAGATGGTGCAGAGGACATTGGG + Exonic
1147650732 17:42060432-42060454 CAGGGTGTGGAGAGGACAGCGGG - Intronic
1147865622 17:43550130-43550152 CAGGTGGTGGGGATGAAAGATGG + Intronic
1148105980 17:45119106-45119128 CAGATGTGGTAGATGACAGATGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149457690 17:56801635-56801657 CAGCTGGGGTAGAGGGCAGATGG + Intronic
1149578806 17:57733076-57733098 CAGGTGCTGGAGAGGACAGAGGG - Intergenic
1151361586 17:73592527-73592549 CAGGAGGTGGTGGGGACAGATGG - Intronic
1151542800 17:74773380-74773402 TGGGTGGGGAAGAGGACAGAAGG + Intronic
1152009260 17:77700874-77700896 CACGTGAGGCAGAGGACAGATGG - Intergenic
1152144350 17:78559343-78559365 CAGGTGGGGCAGAGGCCACAGGG - Intronic
1153595510 18:6721189-6721211 CAGGTGGTGCAGAGCCCAGGAGG + Intergenic
1153625646 18:7020198-7020220 CAGGTAGAGTAGAGCACTGAGGG - Intronic
1153816590 18:8795731-8795753 CAGCTGGTGGAGAGCACAGCAGG - Intronic
1156285670 18:35693067-35693089 CAGGTGGTGGTAAGGGCAGAAGG + Intronic
1158127731 18:54120605-54120627 CAGATGGTGCACAGGACTGATGG - Intergenic
1159643788 18:70893714-70893736 TGGGTAGTGTAGAGAACAGAAGG + Intergenic
1159977068 18:74727246-74727268 ACGGTGGTGAAGAGGACAGTAGG + Intronic
1164566437 19:29329221-29329243 TAGGTGGTGGAGAGGAAGGAAGG + Intergenic
1165445530 19:35855166-35855188 CAGGGGGTGTAGAGAGCAGTTGG - Intronic
1166160827 19:40951567-40951589 CAGGTGCTGCAGAGGCCAAAAGG - Intergenic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1167103701 19:47418957-47418979 GAGGTGGTGTAGAGGACGGATGG + Intronic
1167634115 19:50643952-50643974 CAGGTGGTGAAGATGAGGGAGGG + Intronic
1168106970 19:54171772-54171794 CAGGAGCGGCAGAGGACAGAGGG + Intronic
1202636317 1_KI270706v1_random:47535-47557 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
925070916 2:965725-965747 CAGATGGAGTAAAAGACAGAAGG - Intronic
925221303 2:2143640-2143662 CAGGTGTTAGAGGGGACAGAAGG + Intronic
925958556 2:8993767-8993789 CAGGTGGTGAACAAGACACAGGG - Intronic
926323376 2:11764535-11764557 CAGGCCCTGTAGAGGAGAGATGG + Intronic
926332662 2:11838134-11838156 CAGGTGGTGGTGGTGACAGATGG + Intergenic
927021373 2:19020614-19020636 CTGGTGGTGTAGACACCAGAGGG + Intergenic
927286333 2:21360701-21360723 TGGCTGGTGTAGAAGACAGATGG + Intergenic
927649468 2:24903258-24903280 TAGATGGTGGAGAGCACAGACGG - Intronic
929772011 2:44900351-44900373 CAGCTGGGGTAGAGGACTCAGGG + Intergenic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930743466 2:54857344-54857366 CCTGTGGTGCAGAGGACAAAGGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934055272 2:88246305-88246327 AAGGTGGGGTAGGGGAGAGAAGG + Intergenic
934298550 2:91762518-91762540 CAAGGGGTGTTAAGGACAGAGGG + Intergenic
936344515 2:111665149-111665171 CAGGTGGTGGTGGGCACAGAGGG - Intergenic
936578528 2:113675332-113675354 GAGGCGCTGGAGAGGACAGAGGG + Intergenic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
937269509 2:120639540-120639562 CGGCAGGTGCAGAGGACAGAGGG + Intergenic
937856164 2:126673358-126673380 CAGGCTGTGGTGAGGACAGAGGG - Intronic
937926889 2:127174514-127174536 CAGGTGGTGTAGAAGGCACGAGG + Intergenic
938477530 2:131629549-131629571 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
939522531 2:143248309-143248331 CAGGTGGTGTAAAGGACCTACGG + Intronic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
945301579 2:208220330-208220352 GAGGAGGCGGAGAGGACAGATGG + Intergenic
946481952 2:220065873-220065895 CAGGTGGGGAAGAGGAGGGATGG + Intergenic
946543031 2:220706840-220706862 CAGGGCTGGTAGAGGACAGAGGG - Intergenic
947317791 2:228880469-228880491 CATGTGGAGAAAAGGACAGATGG + Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948381645 2:237554370-237554392 CCAGTGGGGCAGAGGACAGAGGG + Exonic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1170367501 20:15613967-15613989 CAGGTGGTGTGAATGAGAGATGG + Intronic
1173427808 20:42958181-42958203 GAGGTGGGGTGGGGGACAGAAGG + Intronic
1173534000 20:43794962-43794984 GAAGTGGGGAAGAGGACAGAGGG - Intergenic
1173650307 20:44659554-44659576 CAGGTAGGGCAGAAGACAGAAGG - Intergenic
1174056045 20:47799248-47799270 CAGCTGGTGCAGAGGACAGCTGG + Intergenic
1175582414 20:60110931-60110953 GAGGAGGGGTAGAGGCCAGAGGG + Intergenic
1175690557 20:61062878-61062900 CAGGTGGCGTTGAGAAGAGATGG + Intergenic
1178064685 21:28891340-28891362 CAGGGGGTGCAGAGTATAGATGG + Intergenic
1178064759 21:28891889-28891911 CAGGGGGTGCAGAGTATAGATGG + Intergenic
1178795234 21:35737970-35737992 CATGGGGTCAAGAGGACAGATGG + Intronic
1178817364 21:35944046-35944068 CAGGTGGTGATGAGGTCAGGTGG + Intronic
1179821758 21:43941083-43941105 CAGGTGGTGCAGGGGGCAGCTGG + Intronic
1179841096 21:44074375-44074397 GAGGTGTTGCAGAGGATAGAAGG + Exonic
1179913637 21:44462863-44462885 CAGGTGGTCAGGAGGACAGCAGG - Intergenic
1180364549 22:11926781-11926803 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180477543 22:15724906-15724928 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180788589 22:18560831-18560853 CAGGCGGTGTTGCGTACAGACGG - Intergenic
1180799175 22:18623855-18623877 CAGGTGGGGTTGAGGAGGGAAGG - Intergenic
1181222543 22:21371411-21371433 CAGGTGGGGTTGAGGAGGGAAGG + Intergenic
1181245502 22:21500356-21500378 CAGGCGGTGTTGCGTACAGACGG - Intergenic
1181638305 22:24184400-24184422 CAGGTGGGGTTGAGGAGGGAAGG + Intronic
1181742110 22:24929465-24929487 CAGGCCTTGGAGAGGACAGAGGG - Intergenic
1182347357 22:29675661-29675683 CAGGTGGAGAAGAGAACATAGGG + Intronic
1182624797 22:31638047-31638069 CCAGTGGTTTGGAGGACAGAGGG - Intronic
1183761774 22:39826761-39826783 TAGGAGGGGTAGAGGACATAAGG + Intronic
1184655924 22:45942038-45942060 CAGGTGGGGTAGGGGGCAGATGG - Intronic
1184791672 22:46703916-46703938 CAGCTGGTGCAGAGGGCAGCAGG - Intronic
949733696 3:7145704-7145726 CATGTGGGGTAGAGGTCAGAGGG + Intronic
950082826 3:10235537-10235559 CAAGTGGTGTTGGGCACAGAGGG + Intronic
950287460 3:11755987-11756009 CAGGGAGTGTAGAGGAAAGCTGG - Intergenic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
951231512 3:20185415-20185437 CAGGGGGTGTGGTAGACAGAAGG + Intronic
953095509 3:39770631-39770653 AAGTTGGTGTAGGGGAAAGATGG - Intergenic
953876968 3:46671983-46672005 GAGGTGCTGGAGAGGACATACGG - Exonic
954351367 3:50046840-50046862 CAGGTGGTGAAGGGCACAGCTGG - Intronic
954675337 3:52312287-52312309 CAGGTTGGGAAGAGAACAGACGG + Intergenic
955059027 3:55481311-55481333 CAGGTTGGGGAGAGGACGGAGGG - Intronic
956886392 3:73564440-73564462 CAGGTGCTGGAGAGGGCTGATGG - Intronic
957011425 3:75010033-75010055 CAGATGGGCTAGAGTACAGAAGG - Intergenic
960084259 3:113573703-113573725 CATGTGGTGTAAAGGACAGAGGG - Intronic
960452935 3:117832435-117832457 CAGCTGGTGGAGAGGAAGGATGG - Intergenic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
961091695 3:124118241-124118263 CAGCTGGGGGACAGGACAGAGGG + Intronic
961640408 3:128361256-128361278 CAGGTGTTGAAGAGGCCAGGTGG + Intronic
961718966 3:128879539-128879561 CAGGGGATGGAGAGGCCAGAAGG - Intronic
961915433 3:130369148-130369170 GAAATAGTGTAGAGGACAGAGGG + Intronic
961987746 3:131155746-131155768 CAGGAGGTGTGCAGGACAGTGGG + Intronic
964846593 3:161051094-161051116 CGGGTGGTGGAGAGGATAGCTGG - Intronic
966649091 3:182279136-182279158 CAGCTGGTGAAGAGAGCAGAAGG - Intergenic
967148484 3:186626762-186626784 CATGTGGTCTGGAGGACAGAAGG - Intergenic
968578570 4:1379213-1379235 CAGGAGCTGGGGAGGACAGATGG - Intronic
969346504 4:6573851-6573873 CAGGGGGTGGACAGGACAGAAGG + Intergenic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
971971662 4:33628866-33628888 CAGGTGGAGTTGTGGATAGATGG - Intergenic
972289529 4:37678528-37678550 CTGGTTGTGTAAAGGGCAGAGGG - Intronic
972644463 4:40954373-40954395 CACGGGGTGGAGAGGAAAGAGGG + Intronic
973366116 4:49210906-49210928 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
973394481 4:49581530-49581552 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
975532522 4:75415561-75415583 AAAGTGCTGTAGAGCACAGAAGG + Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
982326885 4:154137335-154137357 CAGGTGGTGGAGAGGGTTGAAGG - Intergenic
982742290 4:159070090-159070112 CAGATGGGGAAAAGGACAGATGG + Intergenic
983506917 4:168563162-168563184 CAGGTGGTTGAGAAGACAGTTGG + Intronic
1202763633 4_GL000008v2_random:133402-133424 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
987456211 5:18150278-18150300 CAAGTGGTGAAGATGACAAATGG + Intergenic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
989077376 5:37577915-37577937 TAGGTGGTGTTGAAGTCAGAGGG + Intronic
989635354 5:43525911-43525933 GAGGAGGTGTAGAGAAGAGATGG - Intergenic
990019594 5:51108536-51108558 CAGGTTGTGTAGATGAGAAATGG + Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
991162034 5:63514593-63514615 CAGGAGATGGGGAGGACAGAGGG - Intergenic
992911497 5:81399993-81400015 CATGTGGTGCAGAGGACACATGG + Intergenic
993086361 5:83368293-83368315 CAGGTGGTGCTGAGGACTAAAGG + Intergenic
993311371 5:86337587-86337609 CAGGTGATGTAGAGCCCACAGGG + Intergenic
994970410 5:106730382-106730404 CAGCTAGTGTGGAGGCCAGAGGG + Intergenic
995861127 5:116641818-116641840 TTGTTGGTGTAGAGGACACAGGG + Intergenic
996482977 5:123996815-123996837 CAGGTGGTAGAGAGCACAGCAGG + Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
998166440 5:139847159-139847181 AAGGTGCTGCAGAGGACGGAGGG + Intronic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
998756025 5:145380072-145380094 CAGCTGATGTAGAGCCCAGAGGG - Intergenic
999019931 5:148154162-148154184 CATTTGGTGTAGAGCCCAGAGGG + Intergenic
999174451 5:149622027-149622049 CAAGTGCTGCAGAGGGCAGAGGG + Exonic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1001400847 5:171445693-171445715 GCTGTGGTGTAGAGGAGAGATGG + Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1002074190 5:176698353-176698375 CAGGTGGTGGAGGGAGCAGAGGG + Intergenic
1003202801 6:3977787-3977809 AAGGCAGTGTGGAGGACAGAAGG - Intergenic
1003893213 6:10581800-10581822 CAGGTCTTGTGGAGAACAGAAGG - Intronic
1005143909 6:22665480-22665502 TAGGTAGGGTATAGGACAGAGGG - Intergenic
1006110514 6:31741881-31741903 CAGGGTGTGTAGAGGTCACATGG + Intronic
1006163503 6:32051093-32051115 CAGGTGGTGCAAAGGCCAGGAGG - Intronic
1006303021 6:33204107-33204129 CAGGTGGGGTAGGGGACACCAGG - Exonic
1006936900 6:37724920-37724942 CAGGTGGAGTAGGGAAAAGACGG + Intergenic
1007314939 6:40979594-40979616 CAGGTAGTGTGGAGCCCAGAGGG - Intergenic
1007709304 6:43811661-43811683 CAGGTAGTGGTGAGGAGAGAGGG + Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1008964449 6:57300254-57300276 CAGGTGCTTGTGAGGACAGAGGG - Intergenic
1009593814 6:65708969-65708991 GAGGGGGGGGAGAGGACAGAAGG - Intergenic
1013180039 6:107709483-107709505 CAGGTGGTGCACAGGAGAGCAGG - Intronic
1013327064 6:109056924-109056946 CAGGGGAGGGAGAGGACAGATGG - Intronic
1014964263 6:127727450-127727472 CAGTTGCTGCAGATGACAGATGG + Intronic
1016866306 6:148770795-148770817 CAGCTGGTGCAGCGGGCAGAGGG + Intronic
1017733573 6:157339713-157339735 CAGGTGGTTTGGGGGACAGGCGG + Intergenic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1020256362 7:6504751-6504773 CAGGGGGTGTAGGGGGCAGGCGG - Intronic
1021439168 7:20658836-20658858 GAAGTGGTTTAGAGGACAGAAGG + Intronic
1022172831 7:27845888-27845910 AGGGTGGGGTAGAGGAGAGAGGG - Intronic
1023863084 7:44227043-44227065 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863110 7:44227117-44227139 GAGGGAGTGTGGAGGACAGAGGG + Intronic
1023863153 7:44227248-44227270 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863180 7:44227323-44227345 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863191 7:44227358-44227380 CAGGAGGTGTGGGGGACAGACGG + Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1024537936 7:50453679-50453701 CAGGTGGTGTTGAGGAGATAGGG + Intronic
1025094656 7:56087777-56087799 CTGGGAGTGCAGAGGACAGATGG + Intronic
1025236950 7:57240906-57240928 CAGGTGGTGCAGAGGACAGCTGG - Intergenic
1026760957 7:73125292-73125314 CTTGTGGAGTAGAGGACAGGAGG - Intergenic
1026828302 7:73597116-73597138 CAGGGGGTGGGGAGGACAGGGGG - Intronic
1027086264 7:75267367-75267389 CTTGTGGAGTAGAGGACAGGAGG + Intergenic
1028476420 7:91258190-91258212 CAGGGGGTGCAGACCACAGAGGG - Intergenic
1031329988 7:120452728-120452750 CAGCTAGTGAAGAGCACAGAGGG + Intronic
1032488474 7:132306089-132306111 CAGCTGGTGGTCAGGACAGAAGG + Intronic
1034277326 7:149829583-149829605 CAGGAGGTGGAGGGGACTGAGGG - Intergenic
1034337949 7:150335456-150335478 GATGGGGTGTAGAGGACATAAGG + Intronic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1035969279 8:4229026-4229048 CAGGTGGTTGAGAAGACAGTCGG - Intronic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1037058631 8:14478518-14478540 CAGGTGTTATGGGGGACAGAGGG + Intronic
1037317942 8:17616768-17616790 GAGGTGCTGGAGAGGACAGGAGG - Intronic
1037766545 8:21775749-21775771 CAGGTGGTGGGGAGAACAGGAGG - Intronic
1037897503 8:22667814-22667836 CAGGTGGGGGAGGGGACAGATGG + Intronic
1039082744 8:33749150-33749172 CAGGTGGTGTAAATGGCAGCTGG - Intergenic
1039828998 8:41198023-41198045 CAGTTGGTGGAGTGGAGAGAAGG + Intergenic
1041914391 8:63125445-63125467 CAGTAGGGGTAGAGCACAGAGGG - Intergenic
1042540555 8:69903558-69903580 CTGGTGGGGAAGAGGACGGATGG + Intergenic
1042699648 8:71598243-71598265 CAGGTGGGGTTGAGGGTAGAGGG + Intergenic
1042741374 8:72050912-72050934 CAGCTGTTGTACAGAACAGAAGG - Intronic
1044598323 8:93979819-93979841 CAGGTGGTGGACAGCACAGTGGG - Intergenic
1047775927 8:128070471-128070493 CAGGTGCTGGCGAGGACAGAGGG - Intergenic
1048121697 8:131588631-131588653 CAGGTGCTGTAGACCAAAGATGG - Intergenic
1048460788 8:134620062-134620084 AAGGTGCTGGAGAGAACAGAGGG + Intronic
1048676618 8:136790896-136790918 GAGGTGGGGTAGAGGAGGGATGG - Intergenic
1049047758 8:140166079-140166101 CAGGTGGTGTGGAGTCCAGCTGG + Intronic
1050028136 9:1356914-1356936 CAGGTGGGGAGCAGGACAGATGG - Intergenic
1050308156 9:4327148-4327170 CAGTTGGTGTAGAGGTGAGAAGG + Intronic
1051284615 9:15483418-15483440 TAAGTGGTGTAGACGAGAGATGG - Intronic
1052273897 9:26656736-26656758 CAGCTGGTGGAGGGGACAAAAGG - Intergenic
1052375443 9:27713428-27713450 CAGGTGGTGAAGGGGAAAGGAGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1058453078 9:105114915-105114937 CAAGTGCTGTGGAGCACAGAGGG + Intergenic
1058812004 9:108649331-108649353 CAGTTGGTGTTCAGGACACAAGG - Intergenic
1059519036 9:114922557-114922579 CAGGTGGCGAATAGCACAGAAGG + Intronic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1060894892 9:127211267-127211289 CAGGTGGAGGAGAGGAGAGGGGG + Intronic
1061763953 9:132869728-132869750 CAGGTGGCATTGAGGACACATGG + Intronic
1062098239 9:134713740-134713762 CAGGTGGCGTTAGGGACAGAGGG + Intronic
1062281981 9:135756280-135756302 CAGGTGGTGAAGCAGACAGAGGG - Intronic
1062390338 9:136331304-136331326 CAGGTGAGGGAGAGCACAGAGGG + Intronic
1203544387 Un_KI270743v1:118275-118297 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1186453892 X:9695709-9695731 CAGCTGGTGCAGAGTACAGAGGG + Intronic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1190476643 X:50834603-50834625 CATGGGGTGTGGAGTACAGAGGG - Intergenic
1191800494 X:65073646-65073668 CAGTTGGCGTAGAGCCCAGAGGG - Intergenic
1193118148 X:77795454-77795476 TAGGTGGGGAAGAGGACAGGAGG + Intergenic
1194208589 X:91040488-91040510 CAGTGGGTGTAGTGGACAGAGGG - Intergenic
1195750463 X:108158549-108158571 AGGGTGGTGGACAGGACAGAAGG + Intronic
1195822792 X:108965150-108965172 AAGTTGGAGGAGAGGACAGAAGG + Intergenic
1200073829 X:153541650-153541672 CAGGCTGTGCGGAGGACAGAAGG - Exonic
1200121840 X:153794802-153794824 CAGGTGGTGTTGGGGGCAGGAGG + Intronic