ID: 960742524

View in Genome Browser
Species Human (GRCh38)
Location 3:120850787-120850809
Sequence GAGGACTGCTTAGGAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960742519_960742524 -2 Left 960742519 3:120850766-120850788 CCTGTGTTTGTATACCATTTAGA No data
Right 960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG No data
960742516_960742524 27 Left 960742516 3:120850737-120850759 CCTGGGTAGAAACTGGTTGAGAT No data
Right 960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG No data
960742518_960742524 -1 Left 960742518 3:120850765-120850787 CCCTGTGTTTGTATACCATTTAG No data
Right 960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960742524 Original CRISPR GAGGACTGCTTAGGAAAAAT GGG Intergenic
No off target data available for this crispr