ID: 960743550

View in Genome Browser
Species Human (GRCh38)
Location 3:120861475-120861497
Sequence GTACAACTCTACTATAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960743550_960743562 27 Left 960743550 3:120861475-120861497 CCCTTCCTATAGTAGAGTTGTAC No data
Right 960743562 3:120861525-120861547 CCAAAGGAAACCAAGGAAAGGGG No data
960743550_960743559 25 Left 960743550 3:120861475-120861497 CCCTTCCTATAGTAGAGTTGTAC No data
Right 960743559 3:120861523-120861545 TGCCAAAGGAAACCAAGGAAAGG No data
960743550_960743560 26 Left 960743550 3:120861475-120861497 CCCTTCCTATAGTAGAGTTGTAC No data
Right 960743560 3:120861524-120861546 GCCAAAGGAAACCAAGGAAAGGG No data
960743550_960743554 11 Left 960743550 3:120861475-120861497 CCCTTCCTATAGTAGAGTTGTAC No data
Right 960743554 3:120861509-120861531 TCCTGCCTAAGCCATGCCAAAGG No data
960743550_960743557 20 Left 960743550 3:120861475-120861497 CCCTTCCTATAGTAGAGTTGTAC No data
Right 960743557 3:120861518-120861540 AGCCATGCCAAAGGAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960743550 Original CRISPR GTACAACTCTACTATAGGAA GGG (reversed) Intergenic
No off target data available for this crispr