ID: 960746246

View in Genome Browser
Species Human (GRCh38)
Location 3:120892263-120892285
Sequence GGTACAATGCTAGATGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960746246_960746248 17 Left 960746246 3:120892263-120892285 CCTATAACATCTAGCATTGTACC No data
Right 960746248 3:120892303-120892325 ACAATACATATTTGTTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960746246 Original CRISPR GGTACAATGCTAGATGTTAT AGG (reversed) Intergenic
No off target data available for this crispr