ID: 960747416

View in Genome Browser
Species Human (GRCh38)
Location 3:120905681-120905703
Sequence GTCTCATTGCTGTTAATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960747413_960747416 26 Left 960747413 3:120905632-120905654 CCAACTCTGAAGTTTCTCACATT 0: 1
1: 0
2: 3
3: 26
4: 275
Right 960747416 3:120905681-120905703 GTCTCATTGCTGTTAATAGATGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960747416 Original CRISPR GTCTCATTGCTGTTAATAGA TGG Intergenic
901083214 1:6595358-6595380 GTCTCATCTCAATTAATAGAAGG - Intronic
901133817 1:6979960-6979982 GTCTCAGTGCTGTGAATTGTGGG + Intronic
901944448 1:12690343-12690365 TGCTCATTGCTGGTAAGAGAGGG + Intergenic
905354591 1:37372552-37372574 ATCTAATTTCTGTTAAGAGATGG - Intergenic
907558977 1:55371064-55371086 GATTCTTTGCTGTTAATATATGG + Intergenic
910616794 1:89206919-89206941 GACTCATATCTGTAAATAGATGG - Intergenic
912316401 1:108670886-108670908 GTATCATTGCTGGTTATACAGGG - Intergenic
912573560 1:110643222-110643244 ATGTCATTTCTGTTAATGGAGGG - Intergenic
913311064 1:117494109-117494131 GTTGCATTGCTGGTAATTGATGG + Intronic
914432704 1:147633307-147633329 ATCTCATTGGTCTTAATTGATGG - Intronic
915007532 1:152653815-152653837 GTCTCCTTGCTACTGATAGAAGG + Intergenic
918375511 1:183905336-183905358 TTGTCATTCCTGTTAATTGATGG + Intronic
920543364 1:206795812-206795834 GTTTTAAGGCTGTTAATAGAAGG - Intergenic
920788358 1:209064317-209064339 GGTTCCTTGCTGTGAATAGAAGG - Intergenic
921053270 1:211526206-211526228 GTCTCCTTTCTGGTAATAGGAGG + Intergenic
922182880 1:223249347-223249369 GTGTCATCTCTGATAATAGACGG - Intronic
923357839 1:233178126-233178148 GTCCCACTGCTGACAATAGAGGG - Intronic
924199807 1:241647005-241647027 GTTACATTGCTGTTAAAAAATGG + Intronic
1063408408 10:5817634-5817656 TTCTCACTGCTCTTATTAGAGGG + Intronic
1063598532 10:7459689-7459711 GTTTGATTGCTGTTGATAGCAGG - Intergenic
1063835857 10:10010880-10010902 GTCTCATTTCTGTTTGTAAATGG - Intergenic
1064559012 10:16577297-16577319 GTTTCATTGCTGGAAAGAGATGG + Intergenic
1067549967 10:47227325-47227347 TTCTCACTGCTTTTAATAGTAGG + Intergenic
1068094681 10:52476154-52476176 GTCTCATCCCTGATATTAGAGGG - Intergenic
1069220519 10:65877477-65877499 TTCTCATTACTGTTCAAAGAAGG + Intergenic
1071882898 10:89918720-89918742 CTCTCATTGCTGTTTCCAGAGGG + Intergenic
1072350184 10:94549719-94549741 CACTCAGTGCTTTTAATAGATGG + Intronic
1074106146 10:110391156-110391178 TTCTCATTGCTGTTATTAGGAGG - Intergenic
1086152187 11:83624194-83624216 ATCTCATTACTGTTAATGGTTGG - Intronic
1089084834 11:115808065-115808087 CTCTCAGTGCTTTTAAGAGAGGG - Intergenic
1090440688 11:126722934-126722956 ATCTCATTTCTCTTACTAGATGG + Intronic
1093720909 12:22441027-22441049 GTCTCATTCCTGTTCTCAGAGGG - Intergenic
1094713855 12:32991951-32991973 TTCTCACTGTTTTTAATAGAGGG - Intergenic
1098246805 12:68528046-68528068 TTCTCATTGGTTCTAATAGATGG + Intergenic
1099180499 12:79469517-79469539 GTTACATTGCTCTTAATATACGG + Intergenic
1099558400 12:84141475-84141497 GTTTCATTCCTGTTCATAGGAGG - Intergenic
1101584372 12:106071815-106071837 TCTTCATTGCAGTTAATAGATGG + Intronic
1102350940 12:112191550-112191572 GTCTGACTGGTGTTTATAGAGGG - Intronic
1102779157 12:115548600-115548622 GTCCCATTGCTGCAATTAGATGG + Intergenic
1104363375 12:128154417-128154439 GTCTAATTGTTCATAATAGAAGG - Intergenic
1105703680 13:22953917-22953939 GTCTTATTCCTGATTATAGAGGG - Intergenic
1106913552 13:34488090-34488112 GCCTCCTTGATGTAAATAGATGG - Intergenic
1107009080 13:35649812-35649834 GACTCTTTGCAGTGAATAGATGG + Exonic
1107116960 13:36757244-36757266 GTCTCATTGCTTCTCAAAGAGGG - Intergenic
1122316761 14:100830046-100830068 GTCACATTGCTGGCAACAGAAGG + Intergenic
1134076739 16:11297337-11297359 ATCTCACTGCTATTTATAGATGG + Intronic
1143961634 17:10726072-10726094 TTCTCATTTCTGATAATAAAAGG - Intronic
1146479822 17:33196220-33196242 GTCACATAGCTATTAAAAGATGG + Intronic
1146546602 17:33744140-33744162 GACTCATTGCTCTTAATAAGAGG - Intronic
1149956526 17:61057124-61057146 ATCTCTTTGCCATTAATAGAAGG + Intronic
1150912580 17:69404156-69404178 TTCACATTGATATTAATAGATGG - Intergenic
1158625732 18:59070068-59070090 GTCTCATCGCTGCAAATTGAGGG - Intergenic
1159468528 18:68817791-68817813 GTCTCATTTCCATTAAGAGAAGG + Intronic
1165109049 19:33490548-33490570 GTCTCCTTGGAGTTAAGAGAGGG - Intronic
1168485757 19:56760604-56760626 GTATCTTTGCTGTCATTAGACGG + Intergenic
925450698 2:3967148-3967170 GTCTCATTGCTAATATTAAATGG - Intergenic
927395605 2:22647285-22647307 GTCTCATTACTTTTACAAGATGG + Intergenic
928117038 2:28552916-28552938 GTCTCATTTCAGGTAAGAGAAGG + Exonic
932446295 2:71783680-71783702 GTCACATGGCTGATAATTGATGG - Intergenic
933488455 2:82952319-82952341 GTACAATTGCTGTTAATATATGG - Intergenic
935862893 2:107352846-107352868 GTCTTATTCCAGTTATTAGAGGG - Intergenic
938991587 2:136635347-136635369 CTCCCATGGCTGTTAATAGGAGG + Intergenic
941123940 2:161563241-161563263 GTCTCATTCCAGTTCTTAGAGGG + Intronic
942868405 2:180704943-180704965 GTCTCACTGCTTCTACTAGATGG + Intergenic
943878553 2:193107398-193107420 GTCTCCTTGTTGCTAATATAGGG + Intergenic
945035972 2:205704207-205704229 GTCTCTTTCCTATGAATAGAGGG + Intronic
945671011 2:212802819-212802841 GTCCCATTGCTGGTAACACATGG + Intergenic
945848653 2:214979284-214979306 GTCTCTTTTCTGTTGCTAGAGGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1170199683 20:13729372-13729394 GTCTGATTTCCTTTAATAGATGG - Intronic
1170333446 20:15241332-15241354 TTTTCATTATTGTTAATAGATGG + Intronic
1174785780 20:53431136-53431158 GTCTTAGTGATGTTAATACAGGG - Intronic
1177642912 21:23866884-23866906 CTCTCATGGCTGTTACTAGTGGG + Intergenic
1182576053 22:31273672-31273694 GTTTCATTGGTCTTAAGAGAAGG + Intronic
1182901928 22:33905696-33905718 GTGGCATTGCTGTGATTAGAAGG + Intronic
950910570 3:16585570-16585592 CTTTCATTGCTGTCAATTGAGGG - Intergenic
951986277 3:28625162-28625184 GACTCAGGGCTGTTAATAGATGG + Intergenic
952234588 3:31465923-31465945 CTCTCATTTCTATTAATAGCTGG + Intergenic
956934142 3:74080779-74080801 GTCCCATTTCTGTTGGTAGATGG - Intergenic
958457549 3:94350400-94350422 GTATCATTGCTGTTTAAAGAAGG - Intergenic
960747416 3:120905681-120905703 GTCTCATTGCTGTTAATAGATGG + Intergenic
964575983 3:158169009-158169031 GTCTAATGGCTGTTATTATAGGG - Intronic
968710214 4:2109449-2109471 GTCTCATTGCTTTTCTCAGAAGG - Intronic
968880127 4:3294289-3294311 GTCTCCTTGCTGTGAATGGTGGG - Intronic
969165022 4:5300354-5300376 GTCTCATTCCAGTTCATAGGAGG - Intronic
974078608 4:57190719-57190741 GTCTCATTGATTTAAATAGCTGG - Intergenic
975369512 4:73568407-73568429 GTATCATTGCTGGTTATAAAGGG + Intergenic
976472175 4:85441891-85441913 GTCTCACTGTTGTTAAGAGGTGG - Intergenic
976644986 4:87377984-87378006 GTCACATGGCTATTAAAAGATGG + Intronic
977109131 4:92928916-92928938 AGCTCATTGCTTTTACTAGATGG - Intronic
978442827 4:108751915-108751937 GACTCTTTGCTGCTAAAAGAGGG - Intronic
979708604 4:123750608-123750630 ATCTCATTGCTCTCAATGGAAGG + Intergenic
980092893 4:128460651-128460673 CACTCATTTCTGTTAAAAGATGG - Intergenic
981003727 4:139853779-139853801 GTCTCATAGCTGCTCATAGCTGG - Intronic
983910045 4:173227736-173227758 TTCTCATTGCTTTTAAGTGATGG + Intronic
988013339 5:25519172-25519194 GTCTCAGTGTTGTTGCTAGAAGG + Intergenic
991468602 5:66942932-66942954 GGCTCTTTCCTGTTCATAGATGG + Intronic
991950421 5:71942005-71942027 GCCTCATTGCTGTGAAAAGTGGG - Intergenic
993816429 5:92553107-92553129 GCCTCATTGCTGTTCAGAGTTGG - Intergenic
994281989 5:97916266-97916288 GTCTCTTTGGTGTAAATAGAAGG - Intergenic
997223173 5:132187336-132187358 GTCTCATTGCTGGTAAGTGGAGG - Intergenic
998196841 5:140080828-140080850 CTCACATGGCTGTTAGTAGAAGG - Intergenic
999184111 5:149692614-149692636 GTCTCATTTCTGTAAAGAAATGG + Intergenic
1000036089 5:157449127-157449149 AGCTCATTTCTATTAATAGAAGG - Intronic
1000760112 5:165212824-165212846 ATCTCATTGCTGAGAAGAGATGG - Intergenic
1005174344 6:23026948-23026970 GTTTTATTTCTGTTAATAAAAGG + Intergenic
1006729323 6:36224463-36224485 GTCTCATTTCTGACAAAAGAAGG + Intronic
1009469581 6:64016096-64016118 GTTGCATTGCTTTTAATAGGAGG - Intronic
1009623140 6:66101304-66101326 CTCACATTGTTGTTCATAGAGGG + Intergenic
1011198564 6:84808591-84808613 GTCTTATTGCTGTCAAGAAATGG - Intergenic
1012731676 6:102890588-102890610 GTAACATTGCTATTAAGAGATGG + Intergenic
1013041431 6:106437751-106437773 CTCTCATTGCTTTTAATCGTAGG + Intergenic
1013965070 6:115945888-115945910 GTTTGATTGTTGTTAGTAGAGGG + Intronic
1015093149 6:129383746-129383768 TTCTCATTCATGTTAGTAGATGG - Intronic
1015653826 6:135494947-135494969 GTGTCAAAGCTGTTTATAGAGGG + Intronic
1016000189 6:139033727-139033749 GTCTCATTGCTCTTCATTGCAGG + Intronic
1017918185 6:158849006-158849028 GTCTTAATACTGTTAATAGAGGG - Intergenic
1018685241 6:166298968-166298990 TTCTTATTGATGTTACTAGAAGG + Intergenic
1019048357 6:169164894-169164916 TACTCATTTCTGTTAATATAAGG - Intergenic
1021703749 7:23346555-23346577 ATGTCATTGTGGTTAATAGATGG + Intronic
1022623508 7:32009608-32009630 GTCTCATTGCTGATCTTATAAGG - Intronic
1022694667 7:32692550-32692572 GTTTCATAGCTGTTAGAAGAGGG + Intergenic
1031011766 7:116532040-116532062 TTTTGATTGCAGTTAATAGATGG - Intronic
1032506205 7:132436440-132436462 GTCTCATTGCTCATAATCTATGG - Intronic
1041209661 8:55536002-55536024 ATCTCATTGCTGTTAAAAGGAGG - Exonic
1042375978 8:68053115-68053137 GACACATTGTTGTTAATGGATGG + Exonic
1042440498 8:68820617-68820639 GTATCACTGCTGTGAACAGATGG + Intergenic
1043558475 8:81462117-81462139 TTATCATTGTTGTTAATCGAAGG + Intergenic
1048761642 8:137802073-137802095 TTCTCATTGCTTTTAATCAAGGG + Intergenic
1051160944 9:14206625-14206647 GTCTCTTTGCAGGTACTAGATGG - Intronic
1054921769 9:70550503-70550525 GCCTGGTTTCTGTTAATAGAAGG + Intronic
1055418094 9:76106216-76106238 GTCTCATTGAAGTTATTGGAAGG - Intronic
1056729817 9:89155898-89155920 GTCCCATTGATGATAAAAGATGG - Intronic
1061460665 9:130735826-130735848 TTGTCATTTCTGTTAGTAGATGG + Intronic
1186738550 X:12493032-12493054 GTCACATTGGGGTTAGTAGAGGG - Intronic
1188325097 X:28792460-28792482 GTCCCATCGCTGTTAATTTAAGG + Intronic
1193519235 X:82508791-82508813 GTCTCAATGCTGTGCATAAAAGG - Intergenic
1194026193 X:88753835-88753857 ATCTCATGACTGTTAATAAATGG - Exonic
1195330291 X:103792133-103792155 GTCTGATTGGTTTTAATTGAAGG + Exonic
1197641345 X:128971670-128971692 GACTCAGTGCTGTGAATAGGAGG - Intergenic
1200974424 Y:9192937-9192959 GTCTCAGAGGTGTGAATAGAAGG + Intergenic
1202136482 Y:21670834-21670856 GTCTCAGAGGTGTGAATAGAAGG - Intergenic