ID: 960747625

View in Genome Browser
Species Human (GRCh38)
Location 3:120908026-120908048
Sequence TACCCTATCGAATCTAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960747617_960747625 24 Left 960747617 3:120907979-120908001 CCTTCGGCCTATCCACAGATTTC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG 0: 1
1: 0
2: 0
3: 0
4: 24
960747618_960747625 17 Left 960747618 3:120907986-120908008 CCTATCCACAGATTTCTTCTGCC 0: 1
1: 0
2: 1
3: 15
4: 211
Right 960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG 0: 1
1: 0
2: 0
3: 0
4: 24
960747620_960747625 12 Left 960747620 3:120907991-120908013 CCACAGATTTCTTCTGCCCTGGA 0: 1
1: 0
2: 2
3: 24
4: 257
Right 960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG 0: 1
1: 0
2: 0
3: 0
4: 24
960747621_960747625 -4 Left 960747621 3:120908007-120908029 CCCTGGAGACCACAGAACTTACC 0: 1
1: 0
2: 1
3: 17
4: 182
Right 960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG 0: 1
1: 0
2: 0
3: 0
4: 24
960747622_960747625 -5 Left 960747622 3:120908008-120908030 CCTGGAGACCACAGAACTTACCC 0: 1
1: 0
2: 1
3: 19
4: 155
Right 960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960747625 Original CRISPR TACCCTATCGAATCTAGGAT TGG Intergenic
908288313 1:62634408-62634430 TTCCCTATGAATTCTAGGATGGG - Intronic
1063952624 10:11237923-11237945 AACCTAATAGAATCTAGGATTGG + Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1091607344 12:1965868-1965890 TACACAAATGAATCTAGGATAGG + Intronic
1096218841 12:49814801-49814823 TACCCTGTGGAATCCTGGATTGG - Intronic
1097867614 12:64571974-64571996 TAACCTATGAATTCTAGGATTGG - Intergenic
1104118618 12:125775083-125775105 TACCCTAGGGGATCTAGGAAGGG + Intergenic
1116611935 14:47086302-47086324 TATCCTATAGAATCTAGAAAAGG + Intronic
1116947372 14:50848266-50848288 TACCCTTTAGACTCTAGGAATGG - Intergenic
1120188360 14:81417556-81417578 TACCCTAAGGAAACTAGGAGTGG + Intronic
1121006143 14:90491815-90491837 GCCCCCATAGAATCTAGGATGGG + Intergenic
1123832051 15:24149542-24149564 TTCCCTAAGGAATCTCGGATTGG + Intergenic
1123837039 15:24205559-24205581 TTCCCTAAGGAATCTTGGATTGG + Intergenic
1123846302 15:24305667-24305689 TTCCCTAAGGAATCTCGGATTGG + Intergenic
1133675120 16:8063869-8063891 TAGCCTATAGAGTCTAGGCTTGG - Intergenic
1157164805 18:45348675-45348697 TGCCATATCCAATCTTGGATGGG + Intronic
926428237 2:12759344-12759366 GATCCTATGGAAACTAGGATGGG + Intergenic
954092842 3:48298958-48298980 TCTCCTATCAAATCTAGAATTGG + Intronic
956385828 3:68718373-68718395 TACCCTATCGTCTCTAGCAATGG + Intergenic
960634060 3:119766366-119766388 TGCCCTAGCAAAACTAGGATTGG + Exonic
960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG + Intergenic
967399619 3:189046151-189046173 AACCCAATCGAATCTTGGTTTGG + Intronic
983884408 4:172964109-172964131 TACCCTATCCAACATAGCATGGG - Intronic
991960982 5:72044004-72044026 TTCCCTTTCTAAACTAGGATTGG + Intergenic
1187635702 X:21225780-21225802 TTCCCTTTCAAACCTAGGATTGG - Intergenic