ID: 960747696

View in Genome Browser
Species Human (GRCh38)
Location 3:120908254-120908276
Sequence CGGGCTCCGGCCGCTTCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960747696_960747712 16 Left 960747696 3:120908254-120908276 CCCAGAGAAGCGGCCGGAGCCCG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 960747712 3:120908293-120908315 CAGCTTCCCGGGCTGGCAGGCGG 0: 1
1: 0
2: 4
3: 65
4: 427
960747696_960747715 23 Left 960747696 3:120908254-120908276 CCCAGAGAAGCGGCCGGAGCCCG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 960747715 3:120908300-120908322 CCGGGCTGGCAGGCGGCTAGAGG 0: 1
1: 0
2: 2
3: 10
4: 175
960747696_960747706 9 Left 960747696 3:120908254-120908276 CCCAGAGAAGCGGCCGGAGCCCG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 960747706 3:120908286-120908308 GCCCCCTCAGCTTCCCGGGCTGG 0: 1
1: 0
2: 1
3: 32
4: 340
960747696_960747704 4 Left 960747696 3:120908254-120908276 CCCAGAGAAGCGGCCGGAGCCCG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 960747704 3:120908281-120908303 CCTCGGCCCCCTCAGCTTCCCGG 0: 1
1: 0
2: 4
3: 34
4: 614
960747696_960747711 13 Left 960747696 3:120908254-120908276 CCCAGAGAAGCGGCCGGAGCCCG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 960747711 3:120908290-120908312 CCTCAGCTTCCCGGGCTGGCAGG 0: 1
1: 0
2: 1
3: 77
4: 1327
960747696_960747705 5 Left 960747696 3:120908254-120908276 CCCAGAGAAGCGGCCGGAGCCCG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 960747705 3:120908282-120908304 CTCGGCCCCCTCAGCTTCCCGGG 0: 1
1: 0
2: 2
3: 50
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960747696 Original CRISPR CGGGCTCCGGCCGCTTCTCT GGG (reversed) Exonic
901357773 1:8666435-8666457 CTGGCTGCAGCTGCTTCTCTTGG - Intronic
901506523 1:9689252-9689274 CGGGGTCCCGCGGCTGCTCTGGG + Intronic
903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG + Intergenic
903833620 1:26189221-26189243 CGGGCTCTGCCCACTTCCCTGGG + Intronic
906288795 1:44605892-44605914 CGGGCACCGGCCACTACCCTGGG + Intronic
906519804 1:46460309-46460331 TTGGCACCGGCCTCTTCTCTTGG - Intergenic
908355666 1:63323302-63323324 CCGGCTCCGGCCGCCTCCTTGGG - Exonic
912419780 1:109535224-109535246 TGGGCTCTGTCCCCTTCTCTGGG - Intergenic
912490082 1:110057967-110057989 AGGGCTCTGGCATCTTCTCTGGG + Intronic
914667002 1:149840498-149840520 CGGGCTGCGGACGCTTTCCTGGG - Exonic
914668765 1:149853292-149853314 CGGGCTGCGGACGCTTTCCTGGG + Exonic
919362151 1:196609007-196609029 GGGGCTCCAGACCCTTCTCTGGG + Exonic
922727731 1:227931246-227931268 CGGGCTCCATCCTCTTCTATGGG + Intronic
922770362 1:228178811-228178833 CAGGCTCCTGCCTCTCCTCTCGG - Exonic
923035097 1:230280155-230280177 CGGGCTCTGGCCCCTTCTCCCGG - Exonic
1066400819 10:35074006-35074028 CGTGCTGCGGCCGGTGCTCTAGG + Intronic
1071306719 10:84305670-84305692 CGGGCTCTTCCCTCTTCTCTTGG + Intergenic
1076521961 10:131086830-131086852 GGGGCTCCGGTGGCTTCTCCAGG - Intergenic
1076899424 10:133330038-133330060 CGGGCACCCTCGGCTTCTCTGGG - Intronic
1077506256 11:2931195-2931217 CTGCCCCCGGCCGCTTCTCCTGG - Intergenic
1079630314 11:22666822-22666844 TGGGCTCCTGCAGCTTCTCGGGG - Exonic
1082029509 11:47594284-47594306 GGGGCTCCGGCTGCTTTTCCCGG + Exonic
1083596822 11:63921500-63921522 TGAGCTCCTGCCACTTCTCTAGG - Intergenic
1088653267 11:111976923-111976945 GGGGCTCTGGCCGCTCCTCGGGG - Intronic
1091748878 12:3010458-3010480 CGGGCTCAGGCCTCCTCTCCAGG + Intronic
1094524830 12:31224712-31224734 AGGGCTCCAGCCTCTTTTCTTGG - Intergenic
1095418503 12:42000968-42000990 CAGGCTCCGCCCTCCTCTCTGGG + Intergenic
1096853734 12:54462031-54462053 CATGCTCCGGTGGCTTCTCTTGG + Intronic
1102140888 12:110614062-110614084 CAGTCTCCGGCAGCTTCTCGCGG + Intronic
1102865937 12:116374008-116374030 CTGGCTCAGTCCGCTTCTCCTGG - Intergenic
1103932106 12:124456350-124456372 GGGGCTGCGGCCCATTCTCTGGG + Intronic
1118073777 14:62276274-62276296 GGGGCTTTTGCCGCTTCTCTGGG - Intergenic
1122082142 14:99273594-99273616 CTGGCTCCGGCGGCTTCACCCGG + Intergenic
1123880756 15:24676093-24676115 CGGGCTGCGGCCGCCCCTCTGGG + Exonic
1129154060 15:73706787-73706809 CAGGCTCAGGCCACGTCTCTAGG - Intronic
1129817252 15:78565746-78565768 CGCGCTCCGCCTGCTGCTCTTGG + Exonic
1130086016 15:80779170-80779192 CGGGCTCTGGCGGCGGCTCTGGG - Intergenic
1130380253 15:83365729-83365751 CTGCGTCCGGCCGCTTCTCCAGG + Intergenic
1130908844 15:88257352-88257374 CCGGCTCTGGGTGCTTCTCTGGG - Intergenic
1132687815 16:1169620-1169642 CGGGCTCCCGGTGCTTCCCTCGG + Intronic
1140512399 16:75517495-75517517 CGGGCAGGGGCCGCTTCTCCAGG - Intergenic
1141826045 16:86480929-86480951 CGGGCTTCGGCCACCCCTCTTGG + Intergenic
1142115382 16:88353555-88353577 TGGGCTCCGGGAGCCTCTCTGGG - Intergenic
1143742602 17:8965478-8965500 CGGGCTGCGGCGGCTGCTCGCGG + Intronic
1146255261 17:31388645-31388667 GGGACTCCGGCCCCTTCTCTAGG - Intergenic
1147220456 17:38925775-38925797 CAGGCTCCGGCCGCAGCTCCAGG - Intergenic
1147363107 17:39943812-39943834 TGGGCTGGGGCCTCTTCTCTGGG - Intronic
1152496932 17:80679924-80679946 GGGGCTCCCTCCGCCTCTCTGGG - Intronic
1155152756 18:23135709-23135731 CGGGCGCCGCTCGCTTCTCCGGG + Intronic
1160567630 18:79797203-79797225 AGGACTCCGGACGCTTCTGTGGG - Intergenic
1160874489 19:1290803-1290825 CAGGCTCCAGCCGCGTGTCTGGG - Intronic
1161087361 19:2341233-2341255 GGGGCTCCGGCCTCTCCTCCCGG - Intronic
1161843155 19:6694449-6694471 AGGCCCCCTGCCGCTTCTCTAGG + Exonic
1162909832 19:13842807-13842829 CGGGCTCCGGCCGCCGCCCCGGG + Intergenic
1163358331 19:16829519-16829541 CGTGCACCGGCAGCTTCTCGTGG - Exonic
1163546249 19:17942929-17942951 GGAGCCCCGGCAGCTTCTCTGGG - Intronic
1163715472 19:18870127-18870149 CAGGCTCCGGCCGGTTCCCCCGG - Exonic
1164826996 19:31291113-31291135 CAGGCTGCGGCTGCTCCTCTAGG + Intronic
1166101941 19:40576374-40576396 CGGGCCCCAGCGGCTTCTCCAGG - Exonic
1167829526 19:52008155-52008177 TGGGCTCCGGCCTCATCTCTCGG + Exonic
925413921 2:3656320-3656342 CTGGCTCAGGCCACTGCTCTGGG + Intergenic
925897984 2:8488001-8488023 TGGGCTCTGGCAGCCTCTCTGGG - Intergenic
932887541 2:75560910-75560932 CGGGCTCCTGCAGCTTCTGCGGG - Intronic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
937941765 2:127291600-127291622 AGGACTCCTGCAGCTTCTCTGGG + Intronic
938074014 2:128322475-128322497 CGCGCTCCGGCCGCTGCCCGGGG + Intergenic
943333865 2:186590380-186590402 CGGCCTCCCGCTTCTTCTCTCGG + Exonic
946370574 2:219279282-219279304 CCGGCTCCGCCCTCTTCTCCCGG + Exonic
946631766 2:221677167-221677189 AGGGCTCCAGCCTCTTCTGTAGG - Intergenic
947605424 2:231482876-231482898 CGGGCCCCTGCCGCGTCCCTCGG - Intronic
947831722 2:233146251-233146273 GGGGCTCCTGCGGCTTCTCTTGG + Intronic
948221683 2:236274740-236274762 CCTGCTCAGGCCTCTTCTCTTGG - Intergenic
948801778 2:240436380-240436402 CGGGCTCGGGGCGCTCCTCCCGG + Intronic
1173310641 20:41893517-41893539 TGGGCTCTGGCCTCTTCTCTGGG + Intergenic
1173649165 20:44651911-44651933 CGCGCTCCAGCCGCCTCGCTGGG + Intronic
1174287392 20:49482876-49482898 CGGGCTCCAGGGGCATCTCTTGG - Intergenic
1174543577 20:51308388-51308410 TGGGCTCTGTCTGCTTCTCTGGG - Intergenic
1176721524 21:10397562-10397584 CCCTCTCAGGCCGCTTCTCTGGG + Intergenic
1178953942 21:37006779-37006801 CGGGCTCCGGCCGCCGCTTCGGG - Exonic
1180302715 22:11050337-11050359 CCCTCTCAGGCCGCTTCTCTGGG + Intergenic
1181695951 22:24592892-24592914 CGCGCTCCGGCCGCCGCTCGCGG + Exonic
1183452776 22:37905994-37906016 CGGGCTCCCGCTGCTCCACTGGG - Intronic
1184012311 22:41758404-41758426 AGGGCTCCTGCTGCTTATCTGGG - Exonic
1184211706 22:43039997-43040019 CCCCCTCAGGCCGCTTCTCTGGG - Intronic
953344702 3:42165615-42165637 AGGACTCAGGCCCCTTCTCTGGG - Intronic
954632848 3:52056432-52056454 CGGGCCCCAGCCGCGTCTCCGGG + Exonic
960747696 3:120908254-120908276 CGGGCTCCGGCCGCTTCTCTGGG - Exonic
968545170 4:1194564-1194586 TGGGCTCCGTCCTCTTCTCTGGG + Intronic
969865461 4:10074152-10074174 AGGGTTCCAGCCCCTTCTCTGGG + Intergenic
973126095 4:46586745-46586767 AGGGCTCTGGCTGTTTCTCTGGG + Intergenic
984928233 4:184825566-184825588 CGGCCTCCGGCTGCTTCGCCGGG + Intronic
985608854 5:875114-875136 CGGGATCTGGCCGGTGCTCTAGG - Intronic
986167775 5:5290711-5290733 TGGGCTTCAGCAGCTTCTCTTGG + Intronic
992474264 5:77087119-77087141 CCGGCTCCGGCCGCGTTTCCCGG - Exonic
997351114 5:133232168-133232190 AGTGCTCGGGCCGCATCTCTGGG + Intronic
997926127 5:138032807-138032829 CTGGCCGCGGCCGCTTCTCCAGG + Exonic
998119068 5:139561431-139561453 CGGGCTCGGCCGGCCTCTCTTGG - Exonic
998232831 5:140372343-140372365 CTGGCTCCAGCCCCTTCTCAGGG - Exonic
998446100 5:142199589-142199611 CCGGCACCGGGCGCCTCTCTGGG + Intergenic
1001536902 5:172504384-172504406 CTGGCTCCAGCCCCTGCTCTAGG - Intergenic
1001902509 5:175443882-175443904 TGGGCTGCCGCCGCCTCTCTTGG - Exonic
1007701921 6:43770793-43770815 CGGGCTCCGGCCCCTGCCCGCGG - Exonic
1016936183 6:149450923-149450945 CCCGCTCCGACCGCTTCCCTGGG - Exonic
1018091318 6:160348598-160348620 CGGGCTCCAGCCGCAGCGCTCGG - Exonic
1019120730 6:169801636-169801658 CAGGCCCCGGGGGCTTCTCTGGG + Intergenic
1020117033 7:5481720-5481742 CAGGCTCCTGCAGCTTCTCGAGG + Exonic
1023881831 7:44325238-44325260 CGCGCGCCGCCGGCTTCTCTGGG - Intronic
1036396796 8:8377268-8377290 CAGGGTCCTGCTGCTTCTCTGGG + Exonic
1036432468 8:8703022-8703044 CGGGCTCGGGCCACTCCACTTGG - Exonic
1040564055 8:48550219-48550241 AGTGCTCCTGCCACTTCTCTTGG + Intergenic
1042059152 8:64798655-64798677 CAGCCTGCGGCGGCTTCTCTCGG + Exonic
1049562244 8:143317609-143317631 CGGGGTGGGGCCGCTTCTTTGGG - Intronic
1049659920 8:143815390-143815412 CGGGCTCCGGCGGCGGCGCTCGG + Intergenic
1050094229 9:2047260-2047282 CGGGCACCGGCAGCTTCTGCGGG - Exonic
1050458445 9:5856378-5856400 CATCCTCCGGCCGCTCCTCTTGG - Intergenic
1055308299 9:74952615-74952637 CGGGCTCCGCCCGAGCCTCTGGG - Exonic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1060212706 9:121720272-121720294 CGGGCCCAGGCCTCCTCTCTGGG + Intronic
1060485037 9:124041279-124041301 CGGGCTCCGGACGCTTTCCTGGG + Intergenic
1061044920 9:128159990-128160012 CGGTCTCCCGCCGCTCCTCCCGG + Intergenic
1062287716 9:135780530-135780552 CGGCCTCCTCTCGCTTCTCTGGG - Intronic
1062694445 9:137866291-137866313 GGGGCTCGGGCTGCTTCCCTGGG - Intronic
1199724818 X:150569118-150569140 CGGGCTGCGGCCGCTCCGCAGGG - Intronic
1202604489 Y:26627195-26627217 CGGGCGCCGGCTGCCTCTCTGGG + Intergenic