ID: 960748799

View in Genome Browser
Species Human (GRCh38)
Location 3:120922428-120922450
Sequence AGGGGTATCCAATTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960748799_960748804 12 Left 960748799 3:120922428-120922450 CCTTCTTCCAATTGGATACCCCT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 960748804 3:120922463-120922485 CTTGCCTAATTGCTATAGTCAGG 0: 1
1: 2
2: 27
3: 206
4: 1203
960748799_960748806 27 Left 960748799 3:120922428-120922450 CCTTCTTCCAATTGGATACCCCT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 960748806 3:120922478-120922500 TAGTCAGGACTTTCTGTATTAGG 0: 1
1: 0
2: 1
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960748799 Original CRISPR AGGGGTATCCAATTGGAAGA AGG (reversed) Intronic
900489700 1:2941652-2941674 AATGGGATACAATTGGAAGATGG - Intergenic
901758354 1:11455090-11455112 AGGGGAATGTAAGTGGAAGAGGG - Intergenic
902339309 1:15772379-15772401 AGGGGTGTCCAGCTGGAAGCAGG + Intronic
902672398 1:17983836-17983858 TGGAGTCTCCAATTGGAACATGG - Intergenic
906070558 1:43013433-43013455 TGGGGTAGCCATTTGGAGGATGG + Intergenic
911412405 1:97526321-97526343 AGAGAAAGCCAATTGGAAGAGGG - Intronic
912426827 1:109601019-109601041 AGGGCTATCCTATTTGGAGATGG + Exonic
915730629 1:158051624-158051646 AGGGGAATTAAATTGGAAGAAGG - Intronic
916165842 1:161966734-161966756 AGCTGTATCCATTTGGAAGGCGG + Intergenic
916881323 1:169022115-169022137 AGGGGTTTCTAATTATAAGAAGG - Intergenic
917922222 1:179760087-179760109 AGTGGCAGCCAGTTGGAAGATGG + Intronic
918411345 1:184261088-184261110 AGAGATCTCAAATTGGAAGAGGG + Intergenic
919168854 1:193928709-193928731 AGTGGGGTCCACTTGGAAGAGGG + Intergenic
919227273 1:194721842-194721864 AGGGGTAGCCAATTTCAGGAAGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920052117 1:203170586-203170608 AGGGACATTGAATTGGAAGAAGG + Intronic
921295392 1:213696627-213696649 AGGTGTACTCAATTGGAAAAAGG - Intergenic
921403852 1:214757443-214757465 AGGGGTAGCCAAGTGGGAGATGG + Intergenic
921595205 1:217047166-217047188 ATGGGTATTAAATTAGAAGATGG - Intronic
923322361 1:232847401-232847423 AGTGGTACACACTTGGAAGAGGG + Intergenic
924737127 1:246768350-246768372 GGGGGTATCTAACTCGAAGAGGG + Intergenic
1065340605 10:24701215-24701237 TGGGGAAACCAAATGGAAGAGGG - Intronic
1071922535 10:90367765-90367787 AGGGGTATTCAATTAGGAAAAGG - Intergenic
1077647894 11:3942462-3942484 AGGCACATCCAAATGGAAGAGGG - Intronic
1079227037 11:18615501-18615523 AGGGGCATTCCTTTGGAAGAAGG + Exonic
1083876536 11:65526912-65526934 AGGGGTAGCCAGCTGGCAGAGGG - Intronic
1085980853 11:81722935-81722957 AAGGATATCCAAATGGAAAAGGG + Intergenic
1088941707 11:114465535-114465557 AAGGGTATGTGATTGGAAGAGGG + Intergenic
1090313698 11:125766154-125766176 TGGGGTATCCAGTTGGAAACTGG - Intergenic
1094133014 12:27095041-27095063 AGGGGTATCCATAGAGAAGAGGG + Intergenic
1094182788 12:27609849-27609871 AGGGGTATCCATGGAGAAGAGGG + Intronic
1098180010 12:67836642-67836664 AGGGGATTCAAATTGGAAAAGGG - Intergenic
1101545152 12:105705479-105705501 TGGGGTTTACAATTGGAGGAAGG + Intergenic
1102632238 12:114291168-114291190 ATGGGTATGTAATTGGAGGAAGG + Intergenic
1102785243 12:115599343-115599365 AGTGTCATCCAACTGGAAGATGG + Intergenic
1103559035 12:121782666-121782688 AGGGGGATCCAGTGGGGAGAGGG - Intronic
1104125575 12:125842494-125842516 ATGGGTGTCCAGTTGCAAGAAGG + Intergenic
1110402693 13:75112353-75112375 AGGGTATTCAAATTGGAAGAGGG + Intergenic
1111089499 13:83424721-83424743 AGGAGTGTCCCAATGGAAGAAGG + Intergenic
1114665954 14:24377327-24377349 GGGTGTAGCCAATGGGAAGAAGG - Exonic
1116148504 14:41106184-41106206 AGGGGAAATCAATGGGAAGAGGG - Intergenic
1116836093 14:49769956-49769978 AGGGGTAGAGAATTGCAAGAAGG + Intronic
1118497234 14:66319715-66319737 AAGGGCATCCAAATTGAAGAGGG + Intergenic
1121170224 14:91847629-91847651 AGGGGGATCCACTTCCAAGACGG - Intronic
1121292390 14:92786515-92786537 AAGGCTAGCCAAGTGGAAGATGG - Intergenic
1121669384 14:95696199-95696221 AGGGGTCTCCAAGTGGAAAAAGG - Intergenic
1121729027 14:96173616-96173638 AGAGGCATCCAAATGGAAGGAGG + Intergenic
1123504068 15:20920763-20920785 AAGGGTAAGCAATTGGGAGATGG - Intergenic
1123561315 15:21494457-21494479 AAGGGTAAGCAATTGGGAGATGG - Intergenic
1123597559 15:21931749-21931771 AAGGGTAAGCAATTGGGAGATGG - Intergenic
1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG + Intergenic
1131385124 15:91999425-91999447 ATGGGTATAAAATAGGAAGAGGG + Intronic
1202969662 15_KI270727v1_random:221591-221613 AAGGGTAAGCAATTGGGAGATGG - Intergenic
1132715119 16:1286283-1286305 AGGGGTGTCCACAAGGAAGACGG + Intergenic
1133642516 16:7731334-7731356 AGAGGCAGCCAATTTGAAGAAGG - Intergenic
1133770047 16:8862628-8862650 AGGGGTAGCCATTTGCAAAACGG + Intronic
1135282496 16:21164802-21164824 AGGGGGATGCAATGGAAAGATGG - Intronic
1139015623 16:62685185-62685207 AGAGGTTTCCAGCTGGAAGAGGG + Intergenic
1140713906 16:77704653-77704675 AGGGTTAGCCACATGGAAGATGG - Intergenic
1143418700 17:6771637-6771659 AGGAGTATACAATTAGAAGGTGG + Intronic
1143912868 17:10266403-10266425 AGGGTTTTCCACTTGGAAGAGGG + Intergenic
1146243966 17:31261493-31261515 AAGGGTAAGCAATTGGGAGATGG + Intronic
1150188899 17:63216380-63216402 AGGAATAACCAAATGGAAGAGGG - Intronic
1151431225 17:74064699-74064721 AGGGGTCCCAAATTGGAAGTTGG - Intergenic
1151506019 17:74527671-74527693 GGGAGAGTCCAATTGGAAGATGG + Intronic
1157307379 18:46526898-46526920 AGGGGTTTCCAACAGGGAGAGGG + Intronic
1158115090 18:53986690-53986712 AGGGTTTTTCAATTGCAAGAGGG - Intergenic
1160946616 19:1646743-1646765 AGGGGTATCCCATTAGGCGAAGG + Intronic
1161285905 19:3468252-3468274 AAGGGGATCCAATAGGAATATGG + Intronic
1161525475 19:4752360-4752382 AGGGGTAGTCAACTGGAAGGTGG - Intergenic
1165326385 19:35116695-35116717 AGGGGTATCTAAGTGGACCAGGG + Intronic
1165505332 19:36224044-36224066 CGTGGTAGCCAATTGGAAAAAGG - Intronic
1168418835 19:56187330-56187352 ACTGCTGTCCAATTGGAAGAGGG + Intergenic
925324161 2:3004261-3004283 ATGTTTATCCAATAGGAAGAAGG + Intergenic
926188537 2:10709964-10709986 AGGTGTATCCACTTGGGAAATGG - Intergenic
935720449 2:105974642-105974664 AGGGGTGTCTAAGTGGTAGAAGG - Intergenic
938372402 2:130779894-130779916 AGGGCTAGCCAATTGGAAGATGG + Intergenic
940427624 2:153548763-153548785 ATGGGTATACACTTGGAAGTGGG - Intergenic
943738992 2:191390618-191390640 AATGGTATCCTAATGGAAGAAGG - Intronic
944096792 2:195976538-195976560 AGGGCTCTACAATTGGCAGATGG - Intronic
945987706 2:216368734-216368756 AGGAGTATTCAATTGCAAGGTGG - Intronic
946210384 2:218143076-218143098 AGGGGGATCCAAGTGGGAGACGG - Intergenic
1169505135 20:6202016-6202038 AGAGGTATCCAGCTGGTAGAAGG - Intergenic
1171805286 20:29673253-29673275 AAAGGTATCCAATAGGAAGAGGG - Intergenic
1171838768 20:30183177-30183199 AAAGGTATCCAATAGGAAGAGGG + Intergenic
1173510434 20:43624003-43624025 GGTGGTATCCAGCTGGAAGATGG - Exonic
1178440296 21:32593074-32593096 AAGGGTATCCTCTGGGAAGAAGG - Intronic
1179146230 21:38770179-38770201 AGGGGTTTGCAATGGGATGATGG + Intergenic
1181609332 22:24002066-24002088 AGGGGGTTGCAACTGGAAGAAGG + Intergenic
955516508 3:59731382-59731404 AGAGGAATCCAACTAGAAGATGG - Intergenic
957438379 3:80210073-80210095 AGGGCTATGAAGTTGGAAGAGGG - Intergenic
957942796 3:87026343-87026365 AGGAGCATGCAATTGGAAGAGGG + Intergenic
960748799 3:120922428-120922450 AGGGGTATCCAATTGGAAGAAGG - Intronic
961237521 3:125380095-125380117 AAGGGTATGCAATAGGTAGATGG + Intergenic
969901680 4:10355889-10355911 AGGGGTATACCACTGGAAAAGGG + Intergenic
972244098 4:37226303-37226325 AGGCTAATCCAAATGGAAGAGGG + Intergenic
974205613 4:58699404-58699426 ATGTATATCCAAATGGAAGAAGG - Intergenic
975490879 4:74987109-74987131 AGGGGAAGCCAATTTGATGATGG - Intronic
977281463 4:95045050-95045072 TGTGGCTTCCAATTGGAAGAAGG + Intronic
978134458 4:105240528-105240550 TGGGGTATCTCATTGCAAGAGGG - Intronic
978190124 4:105901135-105901157 AGAGGTCTCCACTTGGTAGAAGG - Intronic
979354685 4:119689303-119689325 AGACGTATGCACTTGGAAGAAGG + Intergenic
982988855 4:162244953-162244975 AGGGAAATACACTTGGAAGAGGG - Intergenic
985048095 4:185961216-185961238 AGGCTTATACAATTGGGAGAGGG + Intergenic
985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG + Intergenic
986363986 5:7011150-7011172 AGGGACATCCAAAGGGAAGAAGG + Intergenic
992546821 5:77821529-77821551 AGGGGAAGCCAATTAGCAGAGGG - Intronic
992701149 5:79343082-79343104 AGAGGGATCCACTGGGAAGAGGG + Intergenic
993067836 5:83122410-83122432 ACAGGCATCCAATGGGAAGAAGG + Intronic
993976500 5:94489104-94489126 AGTGGTTTACAAGTGGAAGAGGG - Intronic
994823824 5:104687023-104687045 AGGGGTATGCACCTGGAAGCAGG + Intergenic
995437802 5:112157687-112157709 AGGGGGATAAAAATGGAAGAAGG - Intronic
995763298 5:115587392-115587414 AGTTGTATTCTATTGGAAGATGG + Intronic
996863557 5:128091711-128091733 GGGGGTTTCTAATTGGAAGAAGG + Intronic
997416545 5:133732804-133732826 AGGGGTAGCCAACTGGAAGTGGG - Intergenic
997509284 5:134442334-134442356 AGGGGCATCGAACTGGGAGAAGG - Intergenic
997722332 5:136089050-136089072 AGGAGTATCCCATGGGATGAAGG - Intergenic
1001420944 5:171586737-171586759 AGGGGCCTCCAAGTGGAAAAGGG - Intergenic
1002505342 5:179675519-179675541 AGGGGCATCCAAGTGGATCAAGG - Intergenic
1004093034 6:12524795-12524817 AGTGGCATCCAAGTGGATGATGG + Intergenic
1005204322 6:23383356-23383378 AGGGTTCTCCAATTGTAAGAAGG + Intergenic
1008854491 6:56065612-56065634 AGAGGTAGCCAATTGGAGAAAGG + Intronic
1010196910 6:73248676-73248698 AGAGGTAGCCTCTTGGAAGAGGG - Intronic
1010608719 6:77926062-77926084 AGGAGTGTGGAATTGGAAGATGG - Exonic
1011848247 6:91592983-91593005 AGGGGTATTCAATTAGGAAAAGG + Intergenic
1016927515 6:149366598-149366620 AGGGGTCAGCACTTGGAAGAAGG - Intronic
1021110075 7:16683680-16683702 AGGAGTTACAAATTGGAAGAGGG - Intronic
1022418145 7:30195891-30195913 AGGGGGCTACAAGTGGAAGAAGG + Intergenic
1023047703 7:36225319-36225341 AGGGTTATACATGTGGAAGATGG + Intronic
1023173152 7:37409528-37409550 TGGGGGATCCACTTGTAAGATGG + Intronic
1024677929 7:51654647-51654669 AGGGGTATCCCCTCTGAAGATGG + Intergenic
1024894844 7:54246009-54246031 AGGAGTAGCCAGTGGGAAGAAGG - Intergenic
1025220921 7:57106873-57106895 AGGGGTCTCTCATTGGAAAATGG + Intergenic
1025631734 7:63278691-63278713 AGGGGTCTCTCATTGGAAAATGG + Intergenic
1025708401 7:63887221-63887243 AGGGGAAGCCAATTGGAAGCCGG + Intergenic
1026213593 7:68328587-68328609 ACAGGTATTCATTTGGAAGAGGG - Intergenic
1029124856 7:98288735-98288757 AGTGGTATGCATTTGGAAAAGGG - Intronic
1029612462 7:101634359-101634381 AGTGATCTCCAGTTGGAAGAAGG - Intergenic
1030185823 7:106760642-106760664 TGGGGTCACCAATTGGAACAGGG - Intergenic
1032007296 7:128313307-128313329 AGGGGTGTCAAATTAGAAGAAGG - Intronic
1033911353 7:146267312-146267334 AGAGATAGCCAATTGGAAGCCGG + Intronic
1035813901 8:2517469-2517491 AGAGGTATCCAGCAGGAAGAAGG - Intergenic
1036097521 8:5740547-5740569 AAGGGTATTCAATTAGAAAAAGG - Intergenic
1037918637 8:22788217-22788239 AGGGGTTTCAAAATGGGAGAGGG + Intronic
1038685222 8:29710477-29710499 ATAGGGATCTAATTGGAAGAAGG - Intergenic
1041931563 8:63292817-63292839 AGAGGTACCCAATGGGTAGAGGG + Intergenic
1047178687 8:122566768-122566790 AGCGTTATCCATGTGGAAGATGG - Intergenic
1048226509 8:132592351-132592373 AGGAATATCCAATTGAAAGGAGG + Intronic
1052433416 9:28395996-28396018 AGGAGTATCCATTGGGCAGAAGG + Intronic
1052459579 9:28745200-28745222 AGGGGCAACCCATAGGAAGAAGG - Intergenic
1053372894 9:37577256-37577278 AGAGTTAGCCAAATGGAAGAGGG + Intronic
1055319212 9:75065650-75065672 TGGGGTATTCAATTACAAGATGG + Intronic
1055601682 9:77925565-77925587 AGGGCTGGTCAATTGGAAGATGG - Intronic
1056858601 9:90158596-90158618 TGGGGTATCCAACTAGAAGAAGG + Intergenic
1059519577 9:114927914-114927936 AAGGGTTTCCTATAGGAAGATGG - Intronic
1186133804 X:6497419-6497441 AGAGCTATTCATTTGGAAGAGGG - Intergenic
1188888961 X:35585939-35585961 AGGGGGATCCACTTCCAAGATGG - Intergenic
1191124120 X:56936128-56936150 AAGGGTATTCAATTAGAAAATGG - Intergenic
1194309279 X:92284563-92284585 AGGGGTACCAATATGGAAGAGGG - Intronic
1194458886 X:94140968-94140990 AGGGGTATTCATTGGGAATATGG - Intergenic
1196987842 X:121294623-121294645 AGGGCTATCAAATTGGAGGAAGG - Intergenic
1198622301 X:138527046-138527068 AGGGGTATCAAATAGACAGAGGG - Intergenic
1200617577 Y:5398812-5398834 AGGGGTACCAATATGGAAGAGGG - Intronic