ID: 960760722

View in Genome Browser
Species Human (GRCh38)
Location 3:121071784-121071806
Sequence CTGGGGAATTAACCTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 4, 2: 7, 3: 13, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960760722_960760729 17 Left 960760722 3:121071784-121071806 CCTTCTTAAGGTTAATTCCCCAG 0: 1
1: 4
2: 7
3: 13
4: 120
Right 960760729 3:121071824-121071846 TTTATCTGAGTTATCATCAGGGG 0: 1
1: 0
2: 0
3: 18
4: 190
960760722_960760730 24 Left 960760722 3:121071784-121071806 CCTTCTTAAGGTTAATTCCCCAG 0: 1
1: 4
2: 7
3: 13
4: 120
Right 960760730 3:121071831-121071853 GAGTTATCATCAGGGGTGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 84
960760722_960760728 16 Left 960760722 3:121071784-121071806 CCTTCTTAAGGTTAATTCCCCAG 0: 1
1: 4
2: 7
3: 13
4: 120
Right 960760728 3:121071823-121071845 TTTTATCTGAGTTATCATCAGGG 0: 1
1: 0
2: 4
3: 13
4: 252
960760722_960760727 15 Left 960760722 3:121071784-121071806 CCTTCTTAAGGTTAATTCCCCAG 0: 1
1: 4
2: 7
3: 13
4: 120
Right 960760727 3:121071822-121071844 CTTTTATCTGAGTTATCATCAGG 0: 1
1: 0
2: 4
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960760722 Original CRISPR CTGGGGAATTAACCTTAAGA AGG (reversed) Intronic
908858701 1:68458516-68458538 ATGGTGAATTAGCCTTGAGAAGG - Intergenic
911224615 1:95291514-95291536 TTGGTGAATTAAACTGAAGAGGG + Intergenic
911830058 1:102539096-102539118 CTGGGGAATCCAACTTAATAGGG - Intergenic
924479164 1:244412140-244412162 CTGGGCACTTAACCTTAATTTGG + Intronic
924692608 1:246365897-246365919 CTGGGGAATTCATCTTAAAGAGG - Intronic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1070100641 10:73382714-73382736 CTGGGGAATCAAAATAAAGAAGG + Intronic
1071010227 10:80930325-80930347 CTGAAGATTTAACATTAAGATGG + Intergenic
1073431356 10:103489563-103489585 CAGAGAAATTAACCTTAAAATGG - Intergenic
1074590182 10:114805346-114805368 CTGGGGAAATCACCATAGGATGG - Intergenic
1076997044 11:302927-302949 CTGGGGAATTTACCTACAAATGG - Intergenic
1077829050 11:5843743-5843765 TTGGGGAAATTACCTCAAGAAGG + Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079205440 11:18410813-18410835 ATGAGGAATTAACCTTGAGAAGG + Intergenic
1081637173 11:44728345-44728367 TTGGGGAATTAACTTTTTGACGG + Intronic
1082947424 11:58774774-58774796 TTGGGGAATTAACCTTAAGAAGG + Intergenic
1085635067 11:78152597-78152619 CTGGGGAATTAACCACAGGGTGG + Intergenic
1085684391 11:78608605-78608627 TTGGGGAAATAACCACAAGACGG - Intergenic
1089046431 11:115504793-115504815 CTGGAGAATCTCCCTTAAGAGGG + Intronic
1092922696 12:13246570-13246592 CAGGGGAAATGACCATAAGATGG + Intergenic
1093566074 12:20605310-20605332 CTAGGCAATTTACCATAAGAAGG + Intronic
1094708808 12:32940878-32940900 CTGGGTAATTTATCTTAAAAAGG - Intergenic
1097314068 12:58153308-58153330 CTGGGGAAATAACCACAGGATGG + Intergenic
1100535009 12:95500129-95500151 CTTAGGAATTAACCCCAAGAAGG - Intronic
1101051419 12:100867965-100867987 CTGGGGAAATAACATCAGGATGG + Intronic
1101924386 12:108959008-108959030 CTGGGGAATAGACTTTGAGATGG - Intronic
1106046382 13:26145921-26145943 CTGGGGAAATAACCACAGGATGG + Intronic
1107651139 13:42546424-42546446 AGGGAGAATTAACATTAAGATGG + Intergenic
1108720645 13:53128003-53128025 GTGGGGAATGAACATTAATAAGG + Intergenic
1108746069 13:53395744-53395766 CTGGGAAATTATCCTTAGTATGG + Intergenic
1111061125 13:83020244-83020266 CTGGGGAAATAACCACAAGATGG + Intergenic
1111369496 13:87298372-87298394 CCGGGGAAATAACCATAGGATGG + Intergenic
1111527090 13:89486339-89486361 CTGGAGTATTAGCCTTAGGAGGG - Intergenic
1113113503 13:106849968-106849990 CTGGGGATGTGACCTTAATAAGG + Intergenic
1114337918 14:21712150-21712172 CTGAGAAATTAATCTTAAAAGGG - Intergenic
1118661711 14:68021033-68021055 CTGGGGAAATAACCAGATGATGG + Intronic
1120320321 14:82951304-82951326 CTGGGGAATCAACCTTGCCATGG + Intergenic
1120562763 14:86017408-86017430 CTGGGGAAATAACCAGAAGATGG + Intergenic
1124571474 15:30868075-30868097 CTGGGAAAATAACCACAAGATGG - Intergenic
1127629123 15:60809924-60809946 CTGGGGAAATAGCTTCAAGAAGG - Intronic
1129041635 15:72692057-72692079 CTAGGGTATAAACCTTAAGAAGG - Intronic
1140340501 16:74154661-74154683 CTGGAGAATTAACCTAAAAATGG + Intergenic
1142288763 16:89182879-89182901 CAGGGGAATTAAACTTCAGGAGG + Intronic
1143359555 17:6357991-6358013 CTGGGGATTCAAACTTAAGGTGG - Intergenic
1146525403 17:33563117-33563139 CTGGAGATTTAAGCTTTAGAGGG - Intronic
1151080605 17:71324657-71324679 CTGGTAAATTAACCCAAAGAAGG - Intergenic
1151832058 17:76558884-76558906 CTGGAGAATAAACCTTAAGGTGG + Intergenic
1153649505 18:7227588-7227610 CTGGGGAATAAACAGTAACAAGG - Intergenic
1155546494 18:26921308-26921330 CTGGGGAGATAACCTCATGAGGG + Intronic
1156564002 18:38163239-38163261 CTGGGGAAATAACCACAGGATGG + Intergenic
1160315349 18:77838978-77839000 CTGAGGATTGAAACTTAAGAAGG + Intergenic
1160486056 18:79293643-79293665 CTGGGTAATTAATTTTAAAAAGG - Intronic
1166081019 19:40444173-40444195 CTTGGGAATTTACCTTAGGCTGG - Intronic
930453177 2:51570327-51570349 CTGGGTAATTTACTTTAAAAGGG - Intergenic
931061239 2:58531918-58531940 TTGAGGAAATAACCTTAACAAGG - Intergenic
935689102 2:105714410-105714432 CTGGGGATTTAACGTTCTGATGG - Intergenic
936377795 2:111957228-111957250 ATGGAGAATAGACCTTAAGAAGG - Intronic
939359298 2:141148394-141148416 CTGGGGAATTAATCTACAGGAGG + Intronic
939577854 2:143917663-143917685 ATGGGGAATCAGCCTTAACAGGG - Intergenic
939702192 2:145406892-145406914 TAAGGGAATTAACCATAAGAGGG - Intergenic
942635835 2:178004486-178004508 CTGGGGATTTCAAATTAAGATGG - Intronic
944330690 2:198462745-198462767 CTGGAGAAGCCACCTTAAGAAGG - Intronic
948549592 2:238761327-238761349 CTGGAGATTAAACCTGAAGAAGG + Intergenic
1171188876 20:23144288-23144310 CTGTTGAATTAGCCTTGAGAGGG - Intergenic
1174486109 20:50862374-50862396 CTGGGGAATAATTTTTAAGAGGG - Intronic
1179029285 21:37705941-37705963 CTGAGGAAATAACCTTATGTTGG - Intronic
1179086884 21:38226085-38226107 TAGGGGAACTAACTTTAAGAAGG - Intronic
952137300 3:30437595-30437617 CTGGGGAATTAAGTTTCACAGGG - Intergenic
952568507 3:34685266-34685288 TTGGGGGATTAACCTTAAGAAGG + Intergenic
953704304 3:45219793-45219815 CTGGGGAACAAACCTTAAACTGG - Intergenic
956897263 3:73675493-73675515 GTGGGGAATTAACCAAATGATGG + Intergenic
958667794 3:97162404-97162426 CTGGGGAAATAACCAAAGGATGG + Intronic
959129683 3:102339331-102339353 CTGGAGAATTAGCCTAAAGCAGG - Intronic
960760722 3:121071784-121071806 CTGGGGAATTAACCTTAAGAAGG - Intronic
960776247 3:121258249-121258271 CTGGAGAATTAAACCTAAGCAGG + Intronic
962214725 3:133511384-133511406 CTGGGGAAGTAACCACAGGATGG - Intergenic
964573967 3:158143820-158143842 TTGGGGAATTAAACTTCATATGG + Intronic
965162948 3:165158442-165158464 CTGGGGAATTTACATTATGGTGG - Intergenic
966763398 3:183436850-183436872 CTGGGGAAGTAACCACAGGATGG - Intergenic
967896755 3:194401645-194401667 CTGGGGAAATAGGCTAAAGAAGG - Intergenic
971808320 4:31390455-31390477 CATGTGAATAAACCTTAAGAAGG - Intergenic
972048045 4:34693849-34693871 CTGGGGAAGTAATCACAAGATGG + Intergenic
973340704 4:49000736-49000758 CTGGGGAAATAAGCATAAGACGG - Intronic
974404781 4:61452048-61452070 CTGGGGAATTACTCTGAAAAAGG - Intronic
977036458 4:91959463-91959485 CTGGGGAAATAATCATAGGATGG - Intergenic
977688086 4:99872202-99872224 CTGGGGAAATAACCGTAGGATGG - Intergenic
977847232 4:101780409-101780431 CTGGGGAAATAACCATAGGATGG + Intronic
978953645 4:114591189-114591211 TTGGGGGATTAACCTTAAGAAGG - Intergenic
979595869 4:122533325-122533347 CTGGGGAAATAACCACAGGATGG + Intergenic
994294554 5:98075386-98075408 CTGGGAAATTAACCTTTGAAAGG - Intergenic
996248200 5:121292328-121292350 CTTGAGAAGTAACCTTATGAAGG + Intergenic
997387060 5:133481949-133481971 TTGGGGAATTTATCTTGAGAAGG + Intronic
999637655 5:153639505-153639527 CTGAGAAATGAACCCTAAGAAGG - Intronic
1000401876 5:160837773-160837795 ATGGGGAAATAACTTTAAAATGG - Intronic
1003466845 6:6388922-6388944 CTGGGGTATGCACTTTAAGATGG + Intergenic
1003470071 6:6421258-6421280 CTGGGGAAATAACCATAGGATGG + Intergenic
1005622486 6:27632804-27632826 CTGGGGAAATAACCACAGGATGG + Intergenic
1005688852 6:28282141-28282163 CTTGGGAATTTACCCTTAGAAGG + Intronic
1009494681 6:64332303-64332325 TTGGGGAATTAACCTTAAGAAGG + Intronic
1012363111 6:98407813-98407835 CTGGGGAAATAACCATAGGATGG + Intergenic
1013411604 6:109888575-109888597 TAGGGGAATTGACCTTGAGAAGG - Intergenic
1014450346 6:121574322-121574344 CTGGGGGATTATCCATCAGAAGG + Intergenic
1015811700 6:137167428-137167450 TTGGGGAATTAACCTTAAGAAGG + Intronic
1017677602 6:156829777-156829799 CTTGAAAATTCACCTTAAGATGG - Intronic
1020960710 7:14798775-14798797 CTGGGGAAATAACCACAGGATGG - Intronic
1024809379 7:53189647-53189669 CTGGGGAAGTAACCACAGGATGG - Intergenic
1025818760 7:64944366-64944388 CTGGTGAATTATCATTAAAAAGG + Intergenic
1025823605 7:64993614-64993636 TAGGGGAATTAACTTTAAGGAGG - Intronic
1025987602 7:66467746-66467768 CTGAGAAATTAACTTTAAAATGG + Intergenic
1026027341 7:66757366-66757388 CTGAGAAATTAACTTTAAAATGG - Intronic
1026702396 7:72658511-72658533 CTAGGGAATGAAACTTAAGCGGG + Intronic
1027210609 7:76144140-76144162 CTGAGAAATTAACTTTAAAATGG + Intergenic
1027540141 7:79454742-79454764 CTGGGGAAGAATCCTTAAGACGG + Intergenic
1027685648 7:81276813-81276835 CTGGGGAAATGACCATAGGATGG - Intergenic
1030006216 7:105123165-105123187 CCAGCAAATTAACCTTAAGAGGG + Intronic
1033109226 7:138559976-138559998 TAGGGGAATTAACCTTAAGAAGG - Intronic
1033181261 7:139181120-139181142 CTGGGAACTTTATCTTAAGATGG + Exonic
1034742432 7:153489448-153489470 CTGGGGAAGTAATCTTCTGAAGG - Intergenic
1037044382 8:14279096-14279118 CTAGGGAATTCAACCTAAGATGG - Intronic
1037165452 8:15822632-15822654 TTGGGGAATTCATGTTAAGATGG + Intergenic
1039725407 8:40210414-40210436 CTGGGCTATAAACCTTAATAAGG + Intergenic
1040713571 8:50220055-50220077 ATCTGGAATTAACTTTAAGAAGG + Intronic
1041869747 8:62619219-62619241 CTGGGTCACTTACCTTAAGAAGG + Intronic
1043076328 8:75706125-75706147 CTAGGGAATTAATCAAAAGATGG - Intergenic
1046004624 8:108464188-108464210 CTGGGGAAAGAAACTTGAGAGGG + Intronic
1046843901 8:118893236-118893258 CAAGGGGATGAACCTTAAGAAGG + Intergenic
1053295499 9:36910067-36910089 CAGGAGATTTAACATTAAGAGGG - Intronic
1060094446 9:120775150-120775172 CAGGGGAATTAACTTGAAGCTGG - Intronic
1186717485 X:12267835-12267857 CTGGGGACTCAACCTATAGAAGG - Intronic
1188759375 X:34007026-34007048 CTGGGGAAGTAAACTTATGAGGG + Intergenic
1189355288 X:40305763-40305785 ATGGGCTATTAACCTTAAAAAGG - Intergenic
1192470426 X:71393978-71394000 TTGGGAAATCAACCTTAAAAAGG - Intronic
1192658034 X:73012946-73012968 CTGGGGAAGTAACCACAGGATGG + Intergenic
1192824366 X:74679742-74679764 CTGGGGAAATAACCAGAGGATGG - Intergenic
1193531482 X:82659755-82659777 CTGGGGAAATAACCTCAGTATGG + Intergenic
1194423750 X:93710324-93710346 CAGAGGAATTAACCATTAGAAGG - Exonic
1195446599 X:104959189-104959211 CTAGGGAAAAAGCCTTAAGAAGG + Intronic
1198910875 X:141612941-141612963 CTGGGGAACTCACCTTCAAAGGG - Intronic
1201378265 Y:13344945-13344967 TTGGGGAATTAACCTTAAGAAGG + Intronic
1201858373 Y:18569814-18569836 TAGGGAAATTAACTTTAAGAAGG - Intronic
1201874948 Y:18750567-18750589 TAGGGAAATTAACTTTAAGAAGG + Intronic
1202168669 Y:22018245-22018267 CTAGGGAATTAACTTTAAGAAGG + Intergenic
1202222692 Y:22568123-22568145 CTAGGGAATTAACTTTAAGAAGG - Intergenic
1202320423 Y:23627537-23627559 CTAGGGAATTAACTTTAAGAAGG + Intergenic
1202550344 Y:26042519-26042541 CTAGGGAATTAACTTTAAGAAGG - Intergenic